MRC1 gene molecular marker related to anti-enterocytozoon hepatopenaei disease character of litopenaeus vannamei as well as detection primer and application of MRC1 gene molecular marker

Abstract

The invention discloses a litopenaeus vannamei enterocytozoon hepatopenaeus resistance character related MRC1 gene molecular marker as well as a detection primer and application thereof. The litopenaeus vannamei enterocytozoon hepatopenaeus resistance character related MRC1 gene molecular marker is characterized in that a molecular marker A nucleotide sequence is shown as SEQ ID NO.1, and the mutation type at the 759th basic group is Tgt; c, the dominant genotype is an A / C hybrid type; the nucleotide sequences of the molecular markers B, C and D are shown as SEQ ID NO.2, and the mutation type at the corresponding 332th basic group is Tgt; a, the dominant genotype is an A / A homozygous type, and the mutation type at the 711th basic group is Tgt; a, the dominant genotype is a T / T homozygous type, and the mutation type at the 972nd basic group is Ggt; a, the dominant genotype is a G / A hybrid type; the nucleotide sequence of the molecular marker E is as shown in SEQ ID NO.3, and the mutation type at the 99th basic group is Cgt; t, the dominant genotype is C / T heterozygous type; the method has the advantages of good breeding efficiency and accuracy.

Description

Technical Field

[0001] The invention belongs to the technical field of shrimp breeding, and particularly relates to an MRC1 gene molecular marker related to shrimp hepatoenterozoan disease resistance traits of shrimp, a detection primer and an application thereof. Background Art

[0002] Litopenaeus vannamei ( Penaeus vannamei As the world's largest farmed shrimp, its industrial scale and economic value occupy an important position in the fishery. However, with the popularization of high-density intensive farming models, the frequent occurrence of shrimp diseases has become a core problem restricting the sustainable development of the industry. Among them, shrimp hepatocystis ( Enterocytozoon hepatopenaei Hepatopancreatic microsporidiosis (EHP), caused by EHP, is a highly insidious, destructive disease, and difficult to control, causing significant losses to the vannamei shrimp aquaculture industry. EHP infection can cause atrophy of the shrimp's hepatopancreatic ducts, reduce feed conversion efficiency, and increase the risk of other complications. Currently, EHP prevention and control primarily relies on improving the aquaculture environment and strengthening feed management. However, these efforts require significant human, material, and financial resources, and their effectiveness is affected by numerous factors, making it difficult to fundamentally address EHP infection. Therefore, breeding new varieties of vannamei shrimp with EHP resistance has become an urgent need for industry development.

[0003] The macrophage mannose receptor 1 (MRC1) gene is an important immune-related gene. The protein it encodes plays a vital role in the body's recognition and elimination of pathogens. Studies have shown that polymorphisms in the MRC1 gene are associated with disease resistance in various aquatic animals.

[0004] With breakthroughs in molecular biology technology, genetic marker-based assisted breeding systems have demonstrated significant advantages. Single nucleotide polymorphism (SNP) markers, with their core advantages of large-scale parallel detection, high genome coverage density, and compatibility with automated analysis platforms, have become an important technical support for achieving precise and efficient genetic improvement. SNP markers have been successfully applied in the breeding of white shrimp (Penaeus vannamei), and molecular markers associated with ammonia nitrogen tolerance, nitrate tolerance, and resistance to hepatopancreatic necrosis disease have been reported. However, due to the complexity of the genetic structure of shrimp populations, existing markers are insufficient to cover most strains, and there is a lack of SNP markers associated with resistance to enterocytozoa for genetic trait evaluation and genomic selection analysis. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide an MRC1 gene molecular marker related to the shrimp hepatoenterozoan disease resistance trait of vannamei shrimp, its detection primers and application, and to quickly, accurately and effectively use SNP marker amplification primers to detect disease-resistant shrimp individuals, with good breeding efficiency and accuracy.

[0006] The technical solution adopted by the present invention to solve the above technical problems is: a molecular marker of the MRC1 gene related to the resistance to hepatoenterocytosis of shrimp Litopenaeus vannamei, including at least one of molecular marker A, molecular marker B, molecular marker C, molecular marker D and molecular marker E; The molecular marker A is named MRC1-759, and its nucleotide sequence is shown in SEQ ID NO.1. The mutation type at the 759th base is A>C. The molecular marker B is named MRC1-1469, and its nucleotide sequence is shown in SEQ ID NO. 2. The mutation type at the 332nd base is T>A. The molecular marker C is named MRC1-1848, and its nucleotide sequence is shown in SEQ ID NO.2. The mutation type at the 711th base is T>A. The molecular marker D is named MRC1-2109, and its nucleotide sequence is shown in SEQ ID NO. 2. The mutation type at the 972nd base is G>A. The molecular marker E is named MRC1-2243, and its nucleotide sequence is shown in SEQ ID NO. 3. The mutation type at the 99th base is C>T.

[0007] The present invention also provides primers for detecting the above-mentioned MRC1 gene molecular marker. The primer pair for detecting the molecular marker A is: The sequence of the forward primer F1 is ATGTCACAGTTGCCATGCTATG, The sequence of reverse primer R1 is CAACTTCCACAAACTGCGAAGGC; The primer pairs for detecting the molecular markers B, C and D are: The sequence of the forward primer F2 is GAGCCAGTGCCTCATGTTCATTAC, The sequence of reverse primer R2 is GGGACAGACTCTCCTGTGGTGTA; The primer pair for detecting the molecular marker E is: The sequence of the forward primer F3 is ATATAGCAGCCCATAGTTTCTGGCT, The sequence of reverse primer R3 is TCCTTGGTAGACACACAGAGGG.

[0008] The present invention also provides the use of the detection primers of the MRC1 gene molecular marker related to the shrimp hepatoenteric cytosis resistance trait of the vannamei shrimp in screening the shrimp hepatoenteric cytosis resistance parents of the vannamei shrimp.

[0009] Furthermore, the application is: if the vannamei shrimp parent is detected to have the AC genotype at the MRC1-759 site, the AA genotype at the MRC1-1469 site, the TT genotype at the MRC1-1848 site, the GA genotype at the MRC1-2109 site, and the CT genotype at the MRC1-2243 site, it is selected as a parent resistant to shrimp hepatoenterocystis disease.

[0010] Furthermore, the specific steps are as follows: Step 1, extracting genomic DNA from muscle tissue of the tested Litopenaeus vannamei; Step 2: Using the extracted DNA as a template, PCR amplification is performed using the detection primers for the five SNP markers, and then the obtained PCR amplification products are sequenced to determine the genotypes of molecular markers A, B, C, D, and E; Step 3. When the genotype of molecular marker A is the AC genotype of the dominant genotype, the individual is selected as a reserve parent for vannamei variety breeding; when the genotype of molecular marker B is the AA genotype of the dominant genotype, the individual is selected as a reserve parent for vannamei variety breeding; when the genotype of molecular marker C is the TT genotype of the dominant genotype, the individual is selected as a reserve parent for vannamei variety breeding; when the genotype of molecular marker D is the GA genotype of the dominant genotype, the individual is selected as a reserve parent for vannamei variety breeding; when the genotype of molecular marker E is the CT genotype of the dominant genotype, the individual is selected as a reserve parent for vannamei variety breeding.

[0011] Compared with the existing technology, the advantages of the present invention are: the MRC1 gene molecular marker associated with the shrimp hepatoenteric cytozoonosis resistance trait of the present invention, its detection primers, and its application. Based on the MRC1 gene screening of the shrimp, SNP molecular markers associated with the shrimp hepatoenteric cytozoonosis trait are obtained. The SNP molecular markers are used as functional markers for the shrimp hepatoenteric cytozoonosis resistance trait of the shrimp, and are used for breeding shrimp varieties with excellent shrimp hepatoenteric cytozoonosis resistance. The method can be applied to the breeding of new shrimp hepatoenteric cytozoonosis-resistant shrimp varieties, and the genotypes of the selected individuals are stable and do not undergo genetic differentiation. At the same time, the method of the present invention has good breeding efficiency and accuracy, providing a good foundation for the cultivation and improvement research of the shrimp varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1: These are partial fragment sequences of the products obtained by amplifying the MRC1 gene in the embodiment. a represents positions 757 to 761 of the amplified product 1 sequence, wherein the AA, CC, and AC peak graphs of the MRC1-759 A>C site are shown; b represents positions 320 to 334 of the amplified product 2 sequence, wherein the TT, AA, and TA peak graphs of the MRC1-1469 T>A site are shown; c represents positions 769 to 713 of the amplified product 2 sequence, wherein the TT, AA, and TA peak graphs of the MRC1-1848 T>A site are shown; d represents positions 970 to 974 of the amplified product 2 sequence, wherein the GG, AA, and GA peak graphs of the MRC1-2109 G>A site are shown; and e represents positions 97 to 101 of the amplified product 3 sequence, wherein the CC, TT, and CT peak graphs of the MRC1-2243 C>T site are shown. DETAILED DESCRIPTION

[0013] The present invention will be described in further detail below with reference to the accompanying drawings and examples. Specific experimental conditions and methods not specified in the following examples are conventional methods well known to those skilled in the art.

[0014] The screening process for the MRC1 gene molecular marker associated with the resistance to hepatoenterocytosis in Litopenaeus vannamei is as follows: Step 1: Experimental animals: 400 L. vannamei weighing approximately 3 grams were mixed and cultured for 7 days. They were then fed EHP-infected L. vannamei in the same culture tanks to artificially infect them with EHP. They were then fed a standard diet for two months. The final weight of the L. vannamei was calculated, and 100 L. vannamei with a final weight greater than 8 grams and 100 L. vannamei with a final weight less than 6 grams were selected as samples for the E. vannamei hepatocellularis-susceptible and E. vannamei-resistant groups, respectively. Step 2: Test method 2.1 Initial screening of MRC1 gene molecular markers Genomic DNA was extracted from muscle tissue of Litopenaeus vannamei in the sensitive and tolerant groups using the TIANGEN Marine Animal Tissue Genomic DNA Kit and stored at -20°C until further use. SNP marker A is located in the second exon of the MRC1 gene, marker B is located in the fourth exon of the MRC1 gene, marker C is located in the fourth exon of the MRC1 gene, SNP marker D is located in the fifth intron of the MRC1 gene, and marker E is located in the sixth intron of the MRC1 gene.

[0015] 2.2 Primer design and amplification Using the MRC1 genome data of Litopenaeus vannamei in the NCBI database (LOC113819957) as a reference, a partial fragment of the MRC1 gene was amplified, and primers F1, R1, F2, R2, F3, and R3 were designed. Then, SNP sites located in the MRC1 gene were amplified and screened. The sequence of the forward primer F1 is: ATGTCACAGTTGCCATGCTATG; The sequence of reverse primer R1 is: CAACTTCCACAAACTGCGAAGGC; The sequence of the forward primer F2 is: GAGCCAGTGCCTCATGTTCATTAC; The sequence of reverse primer R2 is: GGGACAGACTCTCCTGTGGTGTA; The sequence of the forward primer F3 is: ATATAGCAGCCCATAGTTTCTGGCT; The sequence of reverse primer R3 is: TCCTTGGTAGACACACAGAGGG; PCR amplification system 1 consists of the following components: 25 μL of 2×TransStar FastPfu Fly PCRSuperMix, 22 μL of ddH2O, 1 μL of primer F1, 1 μL of primer R1, and 1 μL of DNA template.

[0016] PCR amplification system 2 consisted of the following components: 25 μL of 2×TransStar FastPfu Fly PCRSuperMix, 22 μL of ddH2O, 1 μL of primer F2, 1 μL of primer R2, and 1 μL of DNA template.

[0017] PCR amplification system 3 consisted of the following components: 25 μL of 2×TransStar FastPfu Fly PCRSuperMix, 22 μL of ddH2O, 1 μL of primer F3, 1 μL of primer R3, and 1 μL of DNA template.

[0018] The reaction procedures for the above-mentioned PCR1, PCR2 and PCR3 amplifications all include the following steps: S1, pre-denaturation at 98°C for 1 min; S2, denaturation at 98°C for 10 s, annealing at 60°C for 5 s, and extension at 72°C for 30 s for 34 cycles; S3. Extend at 72°C for 5 min.

[0019] The PCR amplification products were purified and sequenced after 1wt% agarose gel electrophoresis. The sequencing results were compared and analyzed using Geneiousprime software, including nucleotide sequence alignment and peak analysis. Figure 1

[0020] The nucleotide sequence of PCR amplification product 2 is shown in SEQ ID NO.2:

[0021] The nucleotide sequence of PCR amplification product 3 is shown in SEQ ID NO.3:

[0022] Step 4: Based on the selected SNPS loci, the vannamei shrimp in the sensitive group and the tolerant group were tested and genotyped according to the above method. The samples of different SNP loci in the sensitive group and the tolerant group were counted, and the genotype frequency and allele frequency were calculated. The chi-square analysis was used for independence test. The results of the chi-square analysis are shown in Table 1. Table 1 Chi-square analysis results of MRC1 gene molecular marker sites

[0023] According to Table 1, the dominant type of molecular marker A is the AC genotype, the dominant type of molecular marker B is the AA genotype, the dominant type of molecular marker C is the TT genotype, the dominant type of molecular marker D is the GA genotype, and the dominant type of molecular marker E is the CT genotype. When molecular marker A is A / C heterozygous, molecular marker B is A / A homozygous, molecular marker C is T / T homozygous, molecular marker D is G / A heterozygous, and molecular marker E is C / T heterozygous, the individual is selected as a backup parent for breeding of Penaeus vannamei varieties. The molecular markers provided by the present invention are closely associated with the EHP resistance trait, significantly improving breeding efficiency and accuracy, and providing key technical support for the breeding of disease-resistant Penaeus vannamei varieties.

[0024] The above description is not intended to limit the present invention, nor is the present invention limited to the above specific embodiments. Any modifications, equivalent substitutions, improvements, etc. made by those skilled in the art without departing from the essence of the present invention shall be included in the scope of protection of the present invention.

Claims

1. A molecular marker for the MRC1 gene associated with resistance to hepatoenterozoan disease in Litopenaeus vannamei, characterized in that including at least one of molecular marker A, molecular marker B, molecular marker C, molecular marker D and molecular marker E; The molecular marker A is named MRC1-759, and its nucleotide sequence is shown in SEQ ID NO.

1. The mutation type at the 759th base is A>C. The molecular marker B is named MRC1-1469, and its nucleotide sequence is shown in SEQ ID NO.

2. The mutation type at the 332nd base is T>A. The molecular marker C is named MRC1-1848, and its nucleotide sequence is shown in SEQ ID NO.

2. The mutation type at the 711th base is T>A. The molecular marker D is named MRC1-2109, and its nucleotide sequence is shown in SEQ ID NO.

2. The mutation type at the 972nd base is G>A. The molecular marker E is named MRC1-2243, and its nucleotide sequence is shown in SEQ ID NO.

3. The mutation type at the 99th base is C>T.

2. A detection primer for the MRC1 gene molecular marker according to claim 1, characterized in that: The primer pair for detecting the molecular marker A described in claim 1 is: The sequence of the forward primer F1 is ATGTCACAGTTGCCATGCTATG, The sequence of reverse primer R1 is CAACTTCCACAAACTGCGAAGGC; The primer pairs for detecting the molecular markers B, C and D described in claim 1 are: The sequence of the forward primer F2 is GAGCCAGTGCCTCATGTTCATTAC, The sequence of reverse primer R2 is GGGACAGACTCTCCTGTGGTGTA; The primer pair for detecting the molecular marker E described in claim 1 is: The sequence of the forward primer F3 is ATATAGCAGCCCATAGTTTCTGGCT, The sequence of reverse primer R3 is TCCTTGGTAGACACACAGAGGG.

3. Use of the detection primers for the MRC1 gene molecular marker related to the hepatoenteric cytosis resistance trait of Litopenaeus vannamei according to claim 2 in screening parents of Litopenaeus vannamei that are resistant to hepatoenteric cytosis.

4. Use of the detection primers for the MRC1 gene molecular marker related to the resistance to hepatoenteric cytosis of Litopenaeus vannamei according to claim 3 in screening parents of Litopenaeus vannamei resistant to hepatoenteric cytosis, characterized in that The application is: if the vannamei shrimp parent is detected to have the AC genotype at the MRC1-759 site, the AA genotype at the MRC1-1469 site, the TT genotype at the MRC1-1848 site, the GA genotype at the MRC1-2109 site, and the CT genotype at the MRC1-2243 site, it is selected as a parent resistant to shrimp hepatoenterocystis disease.

5. Use of the detection primers for the MRC1 gene molecular marker related to the resistance to hepatoenteric cytosis of Litopenaeus vannamei according to claim 4 in screening parents of hepatoenteric cytosis of Litopenaeus vannamei, characterized in that The specific steps are as follows: Step 1, extracting genomic DNA from muscle tissue of the tested Litopenaeus vannamei; Step 2: Using the extracted DNA as a template, PCR amplification is performed using the detection primers for the five SNP markers, and then the obtained PCR amplification products are sequenced to determine the genotypes of molecular markers A, B, C, D, and E; Step 3. When the genotype of molecular marker A is the AC genotype of the dominant genotype, the individual is selected as a reserve parent for vannamei variety breeding; when the genotype of molecular marker B is the AA genotype of the dominant genotype, the individual is selected as a reserve parent for vannamei variety breeding; when the genotype of molecular marker C is the TT genotype of the dominant genotype, the individual is selected as a reserve parent for vannamei variety breeding; when the genotype of molecular marker D is the GA genotype of the dominant genotype, the individual is selected as a reserve parent for vannamei variety breeding; when the genotype of molecular marker E is the CT genotype of the dominant genotype, the individual is selected as a reserve parent for vannamei variety breeding.

Images