Real-time fluorescent PCR primer and probe combination and kit for detecting nocardia

By designing specific real-time fluorescent PCR primer and probe combinations, and combining them with Taq Pro U+MultipleProbe qPCR Mix and ddH2O, rapid and accurate detection of Nocardia was achieved, solving the problems of long detection time and low sensitivity in existing technologies. This method is suitable for processing large numbers of samples and reduces economic losses.

CN120442828APending Publication Date: 2025-08-08HEBEI AGRICULTURAL UNIV. +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510697313.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-28
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid and accurate detection of bovine mastitis caused by Nocardia, especially subclinical bovine mastitis. Furthermore, traditional cell culture methods are time-consuming, expensive, and have low sensitivity, making them unsuitable for processing large numbers of samples.

Method used

We designed specific real-time fluorescent PCR primer and probe combinations, labeled with fluorescein and fluorescence quenching groups, for rapid and accurate detection of Nocardia. Combined with Taq Pro U+MultipleProbe qPCR Mix and ddH2O, we achieved high-sensitivity detection through real-time fluorescent PCR amplification and analysis of amplification curves.

Benefits of technology

It achieves highly sensitive detection of Nocardia, with a detection limit as low as 1×102 copies/μL. It is highly specific, has a short detection time, is suitable for processing large numbers of samples, reduces economic losses, and is of great significance for the early prevention and control of mastitis in dairy cows.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442828A_ABST
    Figure CN120442828A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological detection, and particularly discloses a real-time fluorescent PCR primer and probe combination and a kit for detecting nocardia. In the primers and the probe for detecting nocardia, the sequence of an upstream primer is shown as SEQ ID NO: 1, the sequence of a downstream primer is shown as SEQ ID NO: 2, and the sequence of the probe is shown as SEQ ID NO: 3. The real-time fluorescent PCR detection method for nocardia is established through the designed primer and probe combination, the method is high in specificity, nocardia can be rapidly and accurately detected from numerous pathogenic bacteria, the sensitivity is high, the lowest detection limit can reach 1 * 10 < 2 > copies / mu L, the accuracy is good, and the detection time is short. The method is more beneficial to early detection of subclinical cow mastitis caused by nocardia, early detection of diseases is realized, the loss of farmers is reduced, and the method has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and in particular to a real-time fluorescent PCR primer and probe combination and a kit for detecting Nocardia. Background Art

[0002] Bovine mastitis is the most common disease in the global dairy industry, causing significant economic losses to the global dairy industry. Bovine mastitis is an inflammatory reaction in the mammary tissue caused by physical, chemical, or biological factors, with complex etiologies, pathogenic mechanisms, clinical manifestations, duration, and treatment. Bovine mastitis results from interactions between the cow's body, pathogenic microorganisms, and the environment. Microbial growth and proliferation in the mammary gland damages mammary tissue, reduces the synthetic capacity of mammary epithelial cells, decreases milk production, and reduces milk quality. Mastitis is categorized into clinical and subclinical types based on the presence or absence of visible changes in milk quality and symptoms in the udder. Clinical mastitis is characterized by noticeable redness, swelling, heat, and pain in the udder, with clots or flocs visible in the milk sample. Subclinical mastitis, also known as latent mastitis, is the most common type, with the udder and milk typically showing no abnormalities to the naked eye, and laboratory testing is generally required for diagnosis.

[0003] Nocardia is a bacterium widely found in soil, seawater, freshwater, and dust. Although mastitis caused by Nocardia in dairy cows is rare, cases of Nocardia mastitis have been reported in many countries and regions worldwide. Establishing a method for early, rapid, and accurate detection of Nocardia infection is of great significance. Classic cell culture methods are time-consuming, expensive, require high-tech equipment, are unsuitable for processing large numbers of samples, and have low sensitivity. Therefore, establishing a method for accurate and quantitative detection of Nocardia is of great significance for the early prevention and treatment of subclinical mastitis in dairy cows. Summary of the Invention

[0004] In view of this, the present invention provides a real-time fluorescent PCR primer and probe combination and a kit for detecting Nocardia. The primer and probe can be used to quickly and accurately detect Nocardia with good specificity and high sensitivity, and have high practical value.

[0005] To achieve the above-mentioned purpose, the embodiment of the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention provides a real-time fluorescent PCR primer and probe combination for detecting Nocardia, wherein the sequence of the primer pair is as follows:

[0007] Upstream primer-F: 5′-CTGGGATAAGCCTGGGAAAC-3′ (SEQ ID NO: 1),

[0008] Downstream primer-R: 5′-TAGGCCATTACCCCACCAAC-3′ (SEQ ID NO: 2);

[0009] The sequence of the probe P is: 5′-ACCTTACATCGCATGGTGTTTGGTGGA-3′ (SEQ ID NO: 3).

[0010] Compared with the prior art, the primers and probes for specific detection of Nocardia provided by the present invention can specifically bind to the nucleus of Nocardia and accurately detect Nocardia; the minimum detection limit of Nocardia can reach 1×10 2 The primers and probes provided by the present invention have no cross-amplification reactions with pathogens such as Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Staphylococcus chromogenes, and Bacillus, significantly enhancing their specificity. Furthermore, they significantly improve detection efficiency and shorten detection time, making them suitable for processing large numbers of samples. These methods are of great significance for the prevention and control of Nocardia-induced mastitis in dairy cows, effectively reducing economic losses for farmers, and have broad market prospects.

[0011] Preferably, the 5' end of the probe is labeled with fluorescein, and the 3' end is labeled with a fluorescence quenching group.

[0012] Furthermore, the fluorescein is FAM, and the fluorescence quenching group is BHQ1.

[0013] Furthermore, the probe P is: 5′-FAM-ACCTTACATCGCATGGTGTTTGGT GGA-BHQ1-3′.

[0014] In a second aspect, the present invention further provides the use of any of the above-mentioned real-time fluorescent PCR primer and probe combinations for detecting Nocardia in non-diagnostic detection of Nocardia from cattle farm environments.

[0015] In a third aspect, the present invention further provides a kit for detecting Nocardia from a cattle farm environment, comprising any of the above-mentioned real-time fluorescent PCR primers and probe combinations for detecting Nocardia.

[0016] Preferably, the kit for detecting Nocardia from cattle farm environment also includes Taq Pro U+Multiple Probe qPCR Mix and ddH2O.

[0017] Furthermore, the kit for detecting Nocardia from cattle farm environment also includes a plasmid containing a Nocardia target sequence.

[0018] The kit for detecting Nocardia designed by the present invention can quickly and accurately detect Nocardia from a variety of pathogens. The detection method is simple and fast, and the detection result is highly accurate. It can realize accurate and rapid identification of Nocardia, which is of great significance for the early prevention and treatment of cow mastitis caused by Nocardia.

[0019] In a fourth aspect, the present invention also provides a method for detecting Nocardia from a cattle farm environment using the above-mentioned kit, the specific operation being: extracting the genomic DNA of the object to be detected as a template, performing real-time fluorescence PCR amplification using the kit, and performing real-time fluorescence detection during the amplification process.

[0020] The principles for analyzing and judging the amplification curve of the sample to be tested are:

[0021] When the amplification curve in the FAM fluorescence channel is S-shaped and Ct≤35, the sample is judged to be positive for Nocardia;

[0022] When Ct>35 or no amplification is found in the FAM fluorescence channel, the sample is judged to be negative for Nocardia.

[0023] The above method for detecting Nocardia from cattle farm environment is time-saving, simple to operate, and produces intuitive reaction results. It can quickly and accurately detect Nocardia from many pathogens and has high practical value.

[0024] Preferably, the reaction system for real-time fluorescence PCR amplification includes the following reagents and amounts: the reaction system for real-time fluorescence PCR amplification includes the following reagents and amounts: Taq Pro U+Multiple Probe qPCR Mix 10 μL, 0.5 μL each of upstream primer and downstream primer, 0.5 μL of probe, 1 μL of DNA template, and ddH2O supplemented to 20 μL; wherein the concentrations of the upstream primer and downstream primer are both 10 μmol / L, the concentration of the probe is 10 μmol / L, and the concentration of the DNA template is 16.1 ng / μL.

[0025] Preferably, the conditions for the real-time fluorescence PCR amplification are: 95°C for 10 min; 95°C for 20 s, annealing temperature at 60°C for 30 s, and 40 cycles.

[0026] The above-mentioned preferred reaction conditions can further improve the detection efficiency of Nocardia.

[0027] The detection method of Nocardia provided by the present invention is simple to operate, and the detection result can be determined by analyzing the real-time fluorescence quantitative PCR amplification curve. The analysis result is simple and clear, and the minimum detection limit of Nocardia can reach 1×10 2 copies / μL(1.4×10 -2ng / μL), which is more conducive to the early detection of subclinical bovine mastitis caused by Nocardia, early discovery of the disease, and reduction of farmers' losses, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is a structural diagram of the standard plasmid constructed in Example 1 of the present invention;

[0029] Figure 2 1 is a graph showing the specificity test results of the Nocardia detection method in Example 2 of the present invention;

[0030] Figure 3 is a sensitivity test result diagram of the Nocardia detection method in Example 3 of the present invention; wherein, 1:1×10 9 copies / μL, 2: 1×10 8 copies / μL, 3: 1×10 7 copies / μL, 4: 1×10 6 copies / μL, 5: 1×10 5 copies / μL, 6: 1×10 4 copies / μL, 7: 1×10 3 copies / μL, 8: 1×10 2 copies / μL, 9: 1×10 1 copies / μL, N: negative control. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0032] Example 1

[0033] 1.1 Materials

[0034] Nocardia, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Staphylococcus chromogenes, and Bacillus were isolated and identified by clinical testing in our laboratory and then preserved.

[0035] Taq Pro U+MultipleProbe qPCR Mix: purchased from Nanjing Novozyme Biotechnology Co., Ltd. (catalog number: QN213-01 / 02 / 03).

[0036] DNA extraction kit was purchased from Beijing Biotech Biotechnology Co., Ltd.

[0037] 1.2 Design of primers and probes

[0038] Primers and probes were designed based on the conserved sequence specific to Nocardia (SEQ ID NO: 4). The designed primer sequences are as follows and were synthesized and labeled by Shanghai Sangon Biochemical Co., Ltd.

[0039] Upstream primer-F: 5′-CTGGGATAAGCCTGGGAAAC-3′ (SEQ ID NO: 1),

[0040] Downstream primer-R: 5′-TAGGCCATTACCCCACCAAC-3′ (SEQ ID NO: 2);

[0041] The sequence of the probe P is: 5′-FAM-ACCTTACATCGCATGGTGTTTGGTGGA-BHQ1-3′ (SEQ ID NO: 3).

[0042] The conserved sequence of Nocardia is: CTGGGATAAGCCTGGGAAACTGGGTCTAAT ACCGGATATGACCTTACATCGCATGGTGTTTGGTGGAAAGATTTATCGGT GCGAGATGGGCCCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTA (SEQ ID NO: 4).

[0043] 1.3 DNA / RNA extraction

[0044] DNA of Nocardia, Klebsiella, Escherichia coli, Staphylococcus aureus, Staphylococcus chromogenes, and Bacillus were extracted according to the instructions of commercially available DNA extraction kits.

[0045] The extracted DNA / RNA was stored at -20°C for subsequent experiments.

[0046] 1.4 Construction of standard plasmids

[0047] The conserved sequence of the Nocardia genome (SEQ ID NO: 4) was recombined into the pBLUE-T plasmid to obtain a recombinant plasmid, such as Figure 1 As shown. Engineered bacteria containing the recombinant plasmid were synthesized by Shanghai Bioengineering. After fermentation, plasmids were extracted using a plasmid extraction kit (Beijing Tiangen Biochemical). Plasmid concentration and purity were determined using an ultra-micro UV-visible spectrophotometer (ND-100C, MIULAB). The standard plasmid concentration was 168 ng / μL.

[0048] 1.5. Establishment of real-time fluorescence PCR method

[0049] The kit includes upstream primers, downstream primers, probes, Taq Pro U+MultipleProbe qPCRMix, positive controls, and RNase ddH2O.

[0050] Using the extracted Nocardia genomic DNA as a template, a 20 μL reaction system was prepared: 10 μL of Taq Pro U+MultipleProbe qPCR Mix, 0.5 μL of upstream primer and downstream primer each, 0.5 μL of probe, 1 μL of DNA template, and ddH2O to 20 μL; wherein the concentrations of the upstream primer and downstream primer were both 10 μmol / L, the concentration of the probe was 10 μmol / L, and the concentration of the DNA template was 16.1 ng / μL.

[0051] The above reaction system was amplified by real-time fluorescence PCR. The reaction conditions were: 95°C for 10 min; 95°C for 20 s, annealing temperature at 60°C for 30 s, 40 cycles, and fluorescence signals were collected during each annealing cycle.

[0052] The principles for analyzing and judging the amplification curve of the sample to be tested are:

[0053] When the amplification curve in the FAM fluorescence channel is S-shaped and Ct≤35, the sample is judged to be positive for Nocardia;

[0054] When Ct>35 or no amplification is found in the FAM fluorescence channel, the sample is judged to be negative for Nocardia.

[0055] Example 2

[0056] Primer specificity detection:

[0057] Using the extracted genomic DNA of Nocardia, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Staphylococcus chromogenes, and Bacillus as templates, ddH2O as a blank control, and a standard plasmid as a positive control, the two sets of primers and probes designed in Example 1 were used to perform real-time fluorescence PCR detection according to the conditions of Section 1.5 of Example 1. The optimal primer and probe combination was determined based on the typical amplification curve and the reaction system cycle threshold (Ct) value. The results are shown in Tables 1 and Figure 2 shown.

[0058] Table 1 Specificity test results

[0059] name Fluorescence value (CT value) result Standard plasmid 17.59 Positive Klebsiella pneumoniae none Negative Escherichia coli none Negative Staphylococcus aureus none Negative Staphylococcus chromogenes none Negative Bacillus none Negative

[0060] The results showed that no amplification occurred in the blank control, indicating that the reaction system was not contaminated. Figure 2It can be seen that only the genomic DNA of Nocardia shows a typical "S"-shaped amplification curve, while other pathogens such as Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Staphylococcus chromogenes, and Bacillus have no amplification curve, indicating that the established real-time fluorescence PCR method has good specificity.

[0061] Example 3

[0062] Sensitivity test:

[0063] The standard plasmid (plasmid concentration was 168 ng / μL) was diluted 10 times (1×10 9 copies / μL) was used as the starting concentration for the test.

[0064] 1×10 9 The test plasmid was diluted 10-fold in 9 steps to 1×10 1 copies / μL, that is, the concentration of the test plasmid was 1×10 9 copies / μL, 1×10 8 copies / μL, 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL and 1×10 1 The above 9 gradient concentrations of the test plasmid were used as templates for systemic testing, and the empty pBLUE-T plasmid was used as a negative control. The test results are as follows: Figure 3 shown.

[0065] The results showed that 1×10 2 copies / μL concentration and above, the FAM signal channel Ct values of the test results were all less than 35, all of which were positive, and the rest were negative, indicating that the minimum detection limit concentration was 1×10 2 copies / μL, and there was no nonspecific amplification in the negative control.

[0066] Example 4

[0067] The kit in Example 1 was used to perform real-time fluorescence quantitative PCR detection of Nocardia nucleic acid in clinical samples from cattle farm environments.

[0068] (1) Sample collection

[0069] Collect cattle farm environmental samples according to Table 2.

[0070] Table 2 Environmental samples

[0071]

[0072]

[0073] (2) DNA extraction

[0074] Extract sample DNA according to the instructions of the commercially available DNA extraction kit. (3) Real-time fluorescence quantitative PCR amplification

[0075] Real-time fluorescence quantitative PCR amplification was performed according to the conditions in Example 1.

[0076] (4) Result analysis

[0077] Table 3

[0078]

[0079]

[0080] Using the Nocardia PCR method described in Dr. Chen Wei's graduation thesis "Isolation, Identification and Pathogenic Mechanism of Nocardia cyriacigeorgica in Cow Mastitis" as a control method, the collected samples were tested in parallel according to the Nocardia detection method provided by the present invention. The results showed that the detection results of the two methods were completely consistent, indicating that the detection accuracy of this method is 100%.

[0081] In summary, the present invention has established a real-time fluorescence PCR detection method for Nocardia by combining the designed primers and probes. The method has strong specificity, high sensitivity, and a minimum detection limit of 1×10 2 The detection accuracy is good, and Nocardia can be detected quickly and accurately among many pathogens, which is conducive to the early detection of Nocardia, thereby avoiding the aggravation of the disease. It is of great significance for the prevention and treatment of dairy cow mastitis caused by Nocardia.

[0082] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A real-time fluorescent PCR primer and probe combination for detecting Nocardia, characterized in that: Comprising a primer pair and a probe, the sequences of the primer pair are as follows: Upstream primer-F: 5′-CTGGGATAAGCCTGGGAAAC-3′, Downstream primer-R: 5′-TAGGCCATTACCCCACCAAC-3′; The sequence of the probe P is: 5′-ACCTTACATCGCATGGTGTTTGGTGGA-3′.

2. The real-time fluorescent PCR primer and probe combination for detecting Nocardia according to claim 1, wherein: The 5' end of the probe is labeled with fluorescein, and the 3' end is labeled with a fluorescence quenching group.

3. The real-time fluorescent PCR primer and probe combination for detecting Nocardia according to claim 2, wherein: The fluorescein is FAM, and the fluorescence quenching group is BHQ1.

4. The real-time fluorescent PCR primer and probe combination for detecting Nocardia according to claim 3, wherein: The probe P is: 5′-FAM-ACCTTACATCGCATGGTGTTTGG TGGA-BHQ1-3′.

5. Use of the real-time fluorescent PCR primer and probe combination for detecting Nocardia according to any one of claims 1 to 4 in non-diagnostic detection of Nocardia from cattle farm environments.

6. A kit for detecting Nocardia from cattle farm environment, characterized in that: A real-time fluorescent PCR primer and probe combination for detecting Nocardia according to any one of claims 1 to 4.

7. The kit for detecting Nocardia from cattle farm environment according to claim 6, characterized in that: Also includes Taq Pro U+MultipleProbe qPCR Mix and ddH2O.

8. A method for detecting Nocardia from cattle farm environment using the kit according to claim 6 or 7, characterized in that: The specific operation is: extracting genomic DNA of the object to be tested as a template, performing real-time fluorescence PCR amplification using the kit, and performing real-time fluorescence detection during the amplification process.

9. The method for detecting Nocardia from cattle farm environment according to claim 8, characterized in that: The real-time fluorescence PCR amplification reaction system includes the following reagents and amounts: 10 μL of Taq Pro U+Multiple Probe qPCR Mix, 0.5 μL of upstream primer and downstream primer each, 0.5 μL of probe, 1 μL of DNA template, and ddH2O supplemented to 20 μL; wherein the concentrations of the upstream primer and downstream primer are both 10 μmol / L, the concentration of the probe is 10 μmol / L, and the concentration of the DNA template is 16.1 ng / μL.

10. The method for detecting Nocardia from cattle farm environment according to claim 8, characterized in that: The conditions for the real-time fluorescence PCR amplification are: 95° C. for 10 min; 95° C. for 20 s, annealing temperature at 60° C. for 30 s, and 40 cycles.