KASP molecular markers related to quality traits of brassica napus and application thereof
By developing KASP molecular markers related to quality traits of Brassica napus, and utilizing the SNP site at 55439761 bp on chromosome C03 and specific PCR amplification primers, early and accurate identification of quality traits of Brassica napus was achieved, solving the problem of low efficiency in traditional breeding and improving breeding efficiency and accuracy.
Patent Information
- Application Number
- CN202510683443.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-26
- Publication Date
- 2026-07-10
- Estimated Expiration
- 2045-05-26
Smart Images

Figure CN120442849B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetics technology, specifically relating to KASP molecular markers related to quality traits of Brassica napus and their applications. Background Technology
[0002] Brassica napus L. is one of my country's important oilseed crops, and its quality traits directly determine the nutritional and industrial application value of rapeseed. In recent years, with the increasing demand for high-quality edible oil, simply producing "double-low" (low glucosinolate and low erucic acid) Brassica napus can no longer meet the demand for rapeseed oil. Achieving comprehensive and synergistic quality improvement of Brassica napus with high oleic acid, medium linoleic acid, medium linolenic acid, low erucic acid, and low glucosinolates has become a new goal in the breeding field. However, the main quality traits of Brassica napus, such as fatty acid composition, glucosinolate content, and protein content, are typical quantitative traits, controlled by multiple genes with minor effects, and these traits are significantly correlated. Traditional breeding methods are inefficient in improving these traits and cannot meet the needs of modern breeding. This invention aims to identify the major loci controlling the main quality traits of Brassica napus, providing a theoretical basis for quality trait breeding in Brassica napus.
[0003] Marker-assisted selection (MAS) is a core technology in modern crop genetic improvement. Molecular markers can accurately reflect genomic differences in individual organisms. Their greatest advantage lies in their independence from environmental factors and their ability to be conveniently detected and analyzed in the early stages of crop growth and development (even at the seed stage). While many types of molecular markers exist, early methods suffered from high cost and low throughput. Kompetitive allele-specific PCR (KASP) offers higher accuracy, efficiency, lower cost, and high throughput, providing a more efficient, accurate, and stable selection basis for crop breeding.
[0004] Previous studies have identified quantitative trait loci (QTLs) associated with oleic acid and linolenic acid content, located on chromosomes A03 and CO3, respectively; QTLs associated with linoleic acid content are distributed on chromosomes A01, A02, and CO3; QTLs associated with erucic acid content are located on chromosomes A02, A07, A09, and CO1; and QTLs associated with glucosinolate content are distributed on chromosomes A03, A09, and CO2. Therefore, developing a molecular marker for the synergistic improvement of major quality traits in Brassica napus would provide theoretical support for future synergistic improvement of quality traits and marker-assisted breeding in Brassica napus, and has significant theoretical and practical implications. Summary of the Invention
[0005] To address the aforementioned problems in the existing technology, the technical problem to be solved by the present invention is to provide KASP molecular markers related to the quality traits of Brassica napus. Another technical problem to be solved by the present invention is to provide applications of KASP molecular markers related to the quality traits of Brassica napus for the synergistic improvement of the main quality traits of Brassica napus.
[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0007] KASP molecular markers associated with quality traits of Brassica napus, wherein the SNP site corresponding to the KASP molecular marker is located at 55439761 bp on chromosome C03 of the Brassica napus genome, and its single nucleotide polymorphism site is A / G.
[0008] Application of KASP molecular markers associated with quality traits in Brassica napus in genotyping or quality trait identification of Brassica napus.
[0009] PCR amplification primers for KASP molecular markers associated with quality traits in Brassica napus are characterized by comprising forward primer 1, forward primer 2, and reverse primer, with the specific sequences as follows:
[0010] Forward primer 1:
[0011] 5'-GAAGGTGACCAAGTTCATGCTATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGATA-3',
[0012] Forward primer 2:
[0013] 5'-GAAGGTCGGAGTCAACGGATTATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGATG-3',
[0014] Reverse primer:
[0015] 5'-TTATTTGAAAAGTTCTCTGTGCACTTGTTATTATCTGTTAAAA-3'.
[0016] Application of PCR amplification primers for KASP molecular markers associated with quality traits in Brassica napus in genotyping of Brassica napus, including:
[0017] 1) Extract genomic DNA from the leaves of the rapeseed variety to be identified;
[0018] 2) Using extracted genomic DNA as a template, PCR amplification was performed using KASP molecular marker PCR amplification primers;
[0019] 3) Determine the genotype of Brassica napus based on fluorescence detection results;
[0020] The fluorescence detection results are as follows: if the fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result is AA; if the fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result is GG.
[0021] The application of PCR amplification primers for KASP molecular markers associated with quality traits in Brassica napus in the synergistic improvement of quality traits in Brassica napus includes:
[0022] 1) Extract genomic DNA from the leaves of the rapeseed variety to be identified;
[0023] 2) Using extracted genomic DNA as a template, PCR amplification was performed using KASP molecular marker PCR amplification primers;
[0024] 3) Determine the quality traits of Brassica napus based on fluorescence detection results;
[0025] The fluorescence detection results are as follows: if a fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result is AA, indicating that the material has the characteristics of low erucic acid content, low glucosinolate content, high oleic acid content, high linoleic acid content, low arachidonic acid content, and low protein content; if a fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result is GG, indicating that the material has the characteristics of high erucic acid content, high glucosinolate content, low oleic acid content, low linoleic acid content, high arachidonic acid content, and high protein content.
[0026] Application of KASP molecular markers associated with quality traits in Brassica napus in genetic improvement of Brassica napus.
[0027] Application of PCR amplification primers for KASP molecular markers associated with quality traits in Brassica napus in genetic improvement of Brassica napus.
[0028] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0029] 1) This invention employs principal component analysis (PCA) to integrate 10 major quality traits in Brassica napus seeds into 5 principal components through dimensionality reduction analysis. Each principal component is a linear combination of the original variables and they are uncorrelated with each other. This not only preserves most of the information in the original data but also makes the data structure clearer, facilitating subsequent genome-wide association analysis and screening for associated single nucleotide polymorphism (SNP) sites.
[0030] 2) This invention has screened a KASP molecular marker and its primer set related to the quality traits of Brassica napus, which can accurately identify genotypes with high sensitivity and specificity, effectively reducing the error rate and accurately distinguishing different genotypes. This provides a reliable molecular basis for genetic improvement and ensures the stable inheritance of superior traits. It can quickly screen individuals with superior quality traits in early generations, avoiding the long process of identifying traits after plant maturity in traditional breeding, significantly shortening the breeding cycle and accelerating the process of genetic resource improvement. It can also be applied to multiple fields such as genetic map construction, germplasm resource identification, and seed purity identification, providing comprehensive technical support for the integrated research and improvement of Brassica napus, promoting the innovative development of breeding technology, and providing new genetic resources and theoretical basis for molecular-assisted breeding.
[0031] 3) The genotyping method described in this invention has a simple operation process, requires no gel electrophoresis or complex equipment, and only uses a conventional real-time PCR instrument. Genotyping can be completed in one step by adding samples through PCR amplification and fluorescence detection, which reduces the difficulty of operation, improves work efficiency, and facilitates large-scale detection and breeding. Attached Figure Description
[0032] Figure 1 A phenotypic distribution and correlation analysis of the main quality traits of Brassica napus;
[0033] Figure 2 Figure A shows the loading analysis of the main quality traits of rapeseed (Brassica napus) and Figure B shows the principal component analysis results.
[0034] Figure 3 The main quality traits of Brassica napus are shown in the Manhattan plot (A) and QQ plot (B), with the arrows indicating significant SNP sites.
[0035] Figure 4 Molecular marker typing diagrams (A and B) of some materials at the C03_55439761 site in Brassica napus and significant differences in major quality traits (C);
[0036] Figure 5 This is a graph showing the validation results of first-generation sequencing. First-generation sequencing is reverse sequencing. A sequencing result of T with a single peak indicates the genotype is AA; a sequencing result of C with a single peak indicates the genotype is GG. Detailed Implementation
[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described below with reference to specific embodiments. Unless otherwise described in detail, the technical means used in the following embodiments are all conventional means well known to those skilled in the art.
[0038] Example 1
[0039] 1. Materials
[0040] Using a natural population comprising 275 core germplasm resources of Brassica napus (Brassica napus) owned by the research group as materials, including 174 winter rapeseed accessions, 48 semi-winter rapeseed accessions, and 53 spring rapeseed accessions, the 275 core germplasm resources were planted in the experimental field of Huaiyin Normal University, with field management similar to that of large-scale field production. To ensure purity, the sampled plants were bagged during the rapeseed flowering period. After the rapeseed matured, two plants were randomly selected from each line, and the rapeseed was harvested, fully dried, and then used to test its main quality traits.
[0041] 2. Phenotypic identification of main quality traits of Brassica napus
[0042] Using the built-in model of a near-infrared cereal analyzer (FOSS INFRATEC™ 1241ANALYZER), ten major quality traits of palmitic acid (C160), stearic acid (C180), oleic acid (C181), linoleic acid (C182), linolenic acid (C183), arachidic acid (C201), erucic acid (C221), glucosinolates (SGC), protein content (SOC), and fat content (SPC) were measured in seeds of this population in 2022, 2023, and 2024. Each sample was tested twice, and the average value was taken as the specific content of the quality trait of that sample.
[0043] The results are shown in Table 1. The average contents of palmitic acid, stearic acid, oleic acid, linoleic acid, linolenic acid, arachidonic acid, erucic acid, glucosinolates, protein, and fat in this natural population were 3.69%, 2.03%, 41.31%, 17.42%, 9.10%, 7.38%, 19.70%, 101.17 μmol / g, 22.51%, and 44.02%, respectively, with coefficients of variation of 0.17, 0.20, 0.55, 0.18, 0.12, 0.90, 1.09, 0.44, 0.10, and 0.07, respectively. The population exhibited rich phenotypic variation and is suitable for genome-wide association analysis to locate loci and genes controlling quality traits.
[0044] Table 1. Variation analysis of 10 major quality traits in rapeseed seeds.
[0045] Properties average value Standard deviation Kudo Skewness Minimum value Maximum value Confidence level (95.0%) coefficient of variation C160 3.69 0.62 -0.87 -0.35 1.69 5.08 0.07 0.17 C180 2.03 0.40 9.05 0.44 0.00 4.25 0.05 0.20 C181 41.31 22.62 -1.65 -0.33 5.56 72.91 2.58 0.55 C182 17.42 3.15 -0.97 -0.19 8.08 24.68 0.36 0.18 C183 9.10 1.08 2.28 -0.04 3.65 12.34 0.12 0.12 C201 7.38 6.63 -1.56 0.37 -1.08 19.08 0.76 0.90 C221 19.70 21.51 -1.67 0.38 -2.15 56.56 2.46 1.09 SOC 44.02 2.96 9.97 -1.59 22.07 51.46 0.34 0.07 SGC 101.17 44.36 -1.18 -0.46 15.49 184.00 5.07 0.44 SPC 22.51 2.26 1.94 -0.10 11.26 30.03 0.26 0.10
[0046] 3. Group analysis and positioning
[0047] Whole-genome resequencing was performed on 275 Brassica napus accessions using the Illumina sequencing platform. The resequencing reads were aligned to the Darmor v4.1 reference genome, and 2,290,799 high-quality SNPs with a minimum allele frequency (MAF) greater than 5% and a deletion rate less than 50% were selected.
[0048] 4. Principal component analysis of major quality traits of Brassica napus
[0049] Seeds from the population between 2022 and 2024 were collected, 10 quality-related traits were evaluated, and principal component analysis was performed on them.
[0050] The results are as follows Figure 1 and Figure 2 As shown, different traits are correlated to varying degrees. Figure 1 The first principal component (PC1) explained 57.3% of the phenotypic variation, with the main contributing traits covering seven traits: palmitic acid, stearic acid, oleic acid, linoleic acid, arachidonic acid, erucic acid, and glucosinolates. The high loadings of these traits in PC1 indicate their significant impact on the phenotypic variation of Brassica napus and the strong correlations among them. Specifically, oleic acid was positively correlated with palmitic acid, stearic acid, and linoleic acid, but negatively correlated with erucic acid, arachidonic acid, and glucosinolates. This suggests that an increase in oleic acid content is accompanied by an increase in palmitic acid, stearic acid, and linoleic acid content, while inhibiting the accumulation of erucic acid, arachidonic acid, and glucosinolates. The second principal component (PC2) explained 17.9% of the phenotypic variation, with the main contributing traits being linolenic acid, protein content, and fat content. Fat content was negatively correlated with both linolenic acid and protein content. Figure 2 ).
[0051] 5. Genome-wide association analysis based on principal component analysis
[0052] The top five principal components with the largest contributions were selected, and genome-wide association analysis was performed using the built-in MLM model in GAPIT. In principal component analysis, the first principal component, as the comprehensive index with the largest variance contribution, can reflect the variation information of the original data to the greatest extent. The high-loading traits in PC1 are palmitic acid, stearic acid, oleic acid, linoleic acid, arachidonic acid, erucic acid, and glucosinolates, which have a significant impact on the phenotypic variation of Brassica napus.
[0053] The results are as follows Figure 3As shown, through comprehensive analysis of the Manhattan plot and QQ plot of PC1 in the genome-wide association study, a multi-environmentally stable SNP site was located on chromosome C03, with a p-value far below the threshold (P < 9.54E-07). This molecular marker is located at 55,439,761 bp on chromosome C03 of the Brassica napus genome, and has a single nucleotide polymorphism of A / G. The specific nucleotide sequence is as follows:
[0054] CTGTTCTTACTTATATGAAAATAATAAATGTATGTTGAAAATCAAACGTA TTATTATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGAT[A / G]TGTACTTTTAACAGATAATAACAAGTGCACAGAGAACTTTTCAAATAAGACT GTGAGCGCAACTTGTCACATTTCTTTTTGCATTGGATAAAATAACAAT, where [A / G] represents a single nucleotide polymorphism (SNP). When A is a SNP, the specific nucleotide sequence is shown in SEQ ID NO.1. When G is a SNP, the specific nucleotide sequence is shown in SEQ ID NO.2.
[0055] 6. Development and validation of KASP molecular markers
[0056] For the located SNP sites, KASP molecular marker primer sequences were designed using SnapGene software, including two specific primers (forward primer 1 and forward primer 2) and one universal primer (reverse primer). Forward primer 1 contains the fluorescent group FAM (underlined portion) at its 5' end, and forward primer 2 contains the fluorescent group HEX (underlined portion) at its 5' end. The specific primer sequences and fluorescent groups are as follows:
[0057] Forward primer 1:
[0058] 5'- GAAGGTGACCAAGTTCATGCT ATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGATA-3',
[0059] Forward primer 2:
[0060] 5'- GAAGGTCGGAGTCAACGGATT ATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGATG-3',
[0061] Reverse primer:
[0062] 5'-TTATTTGAAAAGTTCTCTGTGCACTTGTTATTATCTGTTAAAA-3'.
[0063] Twenty-five accessions of Brassica napus were identified. Genomic DNA was obtained from Brassica napus using the CTAB (hexadecyltrimethylammonium bromide) crude DNA extraction method and used as templates. A mixture of three primers (SNP Primer Mix solution, with a volume ratio of forward primer 1:15:23 of reverse primer and ddH2O) was used as primers for PCR amplification and fluorescence detection. The amplification system consisted of: 5 μL HiGeno 2×Probe Mix solution, 0.14 μL 100 μmol / L SNP Primer Mix solution, 1 μL of 20–30 ng genomic DNA, and 4 μL ultrapure water. The amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing and extension at 61-55℃ for 40 s, with the annealing temperature decreasing by 0.6℃ per cycle, for a total of 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, for 30 cycles; final extension at 25℃ for 1 min. If the fluorescence phenotyping results show low expression levels, the program can be continued as follows: 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, for 6 cycles; final extension at 30℃ for 30 s. After the reaction is complete, the fluorescence phenotyping results will automatically generate images. If a fluorescent signal corresponding to the forward primer F1 is detected, the genotyping result is AA, indicating that the material has the characteristics of low erucic acid content (C22:1<4%), low glucosinolate content (SGC<90μmol / g), high oleic acid content (C18:1>55%), high linoleic acid content (C18:2>17%), low arachidonic acid content (C20:1<4%), and low protein content (SPC<22.5%). If a fluorescent signal corresponding to the forward primer F2 is detected, the genotyping result is GG, indicating that the material has the characteristics of high erucic acid content (C22:1>30%), high glucosinolate content (SGC>110μmol / g), low oleic acid content (C18:1<20%), low linoleic acid content (C18:2<15%), high arachidonic acid content (C20:1>12%), and high protein content (SPC>22.5%).
[0064] The results are as follows Figure 4 As shown, the KASP marker can accurately distinguish individuals with different genotypes. Among them, 176 materials have the characteristics of low erucic acid content, low glucosinolate content, high oleic acid content, high linoleic acid content, low arachidonic acid content, and low protein content (AA), while 99 materials have the characteristics of high erucic acid content, high glucosinolate content, low oleic acid content, low linoleic acid content, high arachidonic acid content, and high protein content (GG). The differences in each trait among individuals with different genotypes are extremely significant (p<0.001).
[0065] 7. First-generation sequencing validation
[0066] Ten randomly selected rapeseed (Brassica napus) accessions were used to validate the genotyping results using Sanger sequencing. Using leaf genomic DNA from the rapeseed accessions as templates, sequencing primers were designed using SnapGene software for PCR amplification. The primer sequences are as follows:
[0067] Forward primer: 5'-ATAAATGTATGTTGAAAATCAAACG-3',
[0068] Reverse primer: 5'-TTTTATCCAATGCAAAAAGAAATGT-3'.
[0069] The amplification system consisted of 10 μL of 2×Taq Master Mix enzyme solution, 0.1 μL each of forward and reverse primers, 1 μL of genomic DNA, and 8.8 μL of ultrapure water. The amplification program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 40 cycles, and a final extension at 72℃ for 10 min; storage at 16℃. The PCR amplification products were subjected to agarose gel electrophoresis. After passing the 1% agarose gel electrophoresis test, the PCR amplification products and reverse primers were sent to Anhui General Biotechnology Co., Ltd. for reverse sequencing.
[0070] The results are as follows Figure 5 As shown, the sequencing results are consistent with the KASP marker results, verifying the accuracy of the KASP marker results.
[0071] The above description is illustrative only and not restrictive of the present invention. Those skilled in the art will understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all such modifications, variations or equivalents will fall within the protection scope of the present invention.
Claims
1. Application of KASP molecular markers in genotyping or quality trait identification of Brassica napus; the SNP site corresponding to the KASP molecular marker is located at 55439761 bp on chromosome C03 of the Brassica napus genome, and its single nucleotide polymorphism site is A / G.
2. KASP molecular marker PCR amplification primers, characterized in that, It includes forward primer 1, forward primer 2, and reverse primer, with the following specific sequences: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGATA-3', Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGATG-3', Reverse primer: 5'-TTATTTGAAAAGTTCTCTGTGCACTTGTTATTATCTGTTAAAA-3'; The SNP site corresponding to the KASP molecular marker is located at 55439761 bp on chromosome C03 of the Brassica napus genome, and its single nucleotide polymorphism site is A / G.
3. The application of the PCR amplification primers described in claim 2 in genotyping of Brassica napus.
4. A method for genotyping of Brassica napus, characterized in that, include: 1) Extract genomic DNA from the leaves of the rapeseed variety to be identified; 2) Using the extracted genomic DNA as a template, PCR amplification was performed using the KASP molecular marker PCR amplification primers described in claim 2; 3) Determine the genotype of Brassica napus based on fluorescence detection results; The fluorescence detection results are as follows: if the fluorescence signal corresponding to the forward primer 1 is detected, the genotyping result is AA; if the fluorescence signal corresponding to the forward primer 2 is detected, the genotyping result is GG.
5. The method according to claim 4, characterized in that, When the genotyping result is AA, it indicates that the material has the characteristics of low erucic acid content, low glucosinolate content, high oleic acid content, high linoleic acid content, low arachidonic acid content, and low protein content; when the genotyping result is GG, it indicates that the material has the characteristics of high erucic acid content, high glucosinolate content, low oleic acid content, low linoleic acid content, high arachidonic acid content, and high protein content.
6. The application of the PCR amplification primers described in claim 2 in the identification of quality traits of Brassica napus.
7. A method for identifying quality traits, characterized in that, include: 1) Extract genomic DNA from the leaves of the rapeseed variety to be identified; 2) Using the extracted genomic DNA as a template, PCR amplification was performed using the KASP molecular marker PCR amplification primers described in claim 2; 3) Determine the quality traits of Brassica napus based on fluorescence detection results; The fluorescence detection results are as follows: if the fluorescence signal corresponding to the forward primer 1 is detected, the genotyping result is AA, indicating that the material has the characteristics of low erucic acid content, low glucosinolate content, high oleic acid content, high linoleic acid content, low arachidonic acid content, and low protein content; if the fluorescence signal corresponding to the forward primer 2 is detected, the genotyping result is GG, indicating that the material has the characteristics of high erucic acid content, high glucosinolate content, low oleic acid content, low linoleic acid content, high arachidonic acid content, and high protein content.
8. Application of KASP molecular markers in genetic improvement of Brassica napus; the SNP site corresponding to the KASP molecular marker is located at 55439761 bp on chromosome C03 of the Brassica napus genome, and its single nucleotide polymorphism site is A / G.
9. The application of the PCR amplification primers described in claim 2 in the genetic improvement of Brassica napus.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker related to brassica napus dwarf character and application of SNP molecular marker
CN116516054A
SNP (Single Nucleotide Polymorphism) molecular marker closely linked with brassica napus erucic acid gene Bn.OLEA9 and application of SNP molecular marker
CN117363791A