Microfluidic paper chip biosensor based on aptamer nano-enzyme catalytic colorimetric strategy and application of microfluidic paper chip biosensor

Abstract

The invention discloses a microfluidic paper chip biosensor based on an aptamer nano-enzyme catalytic colorimetric strategy and application thereof, the microfluidic paper chip biosensor has the remarkable advantages of high sensitivity, low cost and portability, a new thought is provided for construction of a microfluidic paper chip detection platform, and the application of the microfluidic paper chip biosensor is also provided. A kanamycin colorimetric aptamer sensor which is high in sensitivity, high in specificity, economical and portable is further obtained, and the kanamycin colorimetric aptamer sensor has a wide prospect in the aspect of rapid detection of kanamycin in aquatic products and environmental samples.

Description

Technical Field

[0001] The present invention belongs to the field of biosensor technology, and in particular relates to a microfluidic paper chip biosensor based on an aptamer nanozyme catalytic colorimetric strategy and its application. Background Art

[0002] Kanamycin, one of the most important aminoglycoside antibiotics, is highly effective in treating bacterial infections caused by Gram-negative bacteria. Its remarkable efficacy and cost-effectiveness have broad application prospects in animal husbandry, agricultural production, biopharmaceuticals, and the food industry. However, in recent years, frequent food safety incidents caused by the misuse and abuse of kanamycin have raised public concerns about the safety of antibiotics. Excessive kanamycin intake has the potential to cause adverse effects in humans, including nephrotoxicity, ototoxicity, neuromuscular blockade, and allergic reactions. Therefore, it is necessary to detect kanamycin in food.

[0003] To date, traditional kanamycin detection methods mainly include liquid chromatography, mass spectrometry, capillary electrophoresis, and enzyme-linked immunosorbent assay (ELISA). Among them, the advantages of liquid chromatography are high detection sensitivity and a wide detection range, but the disadvantages are that the liquid column is easily clogged and easily contaminated. ELISA requires tedious sample pretreatment and well-trained professional operators, resulting in high detection costs. Therefore, there is an urgent need to develop highly sensitive, specific, simple to operate, and cost-effective detection and analysis technologies for kanamycin detection to meet the current general needs of social development.

[0004] Aptamer sensor technology is a novel detection technique. Aptamers, as signal recognition elements, offer the advantages of easy synthesis, wide applicability, and low cost. Compared to antibodies, aptamers do not require tedious in vivo synthesis and can be directly obtained in vitro via SELEX techniques. They also exhibit excellent sensitivity and specificity. Notably, despite rapid development, aptamer sensors still face challenges such as low affinity and slow binding between aptamers and many targets. Therefore, modulating the affinity between aptamers and targets to improve aptamer sensor performance is of great significance. Aptamer engineering is an effective strategy that can significantly enhance the binding capacity between aptamers and targets. In recent years, bivalent aptamers have shown great potential for biotin recognition due to their excellent affinity. Related studies have shown that bivalent aptamers can improve thermal stability, nuclease resistance, and binding affinity, and shorten the binding time between aptamers and targets, significantly accelerating detection speed. This increased speed is primarily attributed to the extended conformation of the aptamer. Although many work reports have demonstrated the wide application potential of bivalent aptamers in biosensors, there have been no reports on the application of bivalent aptamers in microfluidic paper chips so far.

[0005] Colorimetric aptasensors have attracted considerable attention due to their intuitive detection results, controllable detection process, and wide applicability. The construction of colorimetric aptasensors has long been a research hotspot in the field of biosensing. Many noble metal nanoparticles, known as nanozymes, have been reported to act as catalysts that mimic natural enzymes. Their ability to replace specific enzymes in enzyme-based applications has garnered widespread research interest, with a current focus on mimicking peroxidases and oxidases. Silver nanoparticles (AgNPs) possess excellent biomolecule adhesion, and their enzymatic activity is attributed to their ability to facilitate electron transfer between substrates and H₂O₂. When AgNPs and aptamers are coexisting in solution, the aptamers are adsorbed onto the surface of the silver nanoparticles. Aptamers-modified silver nanoparticles exhibit enhanced peroxidase-like activity, significantly catalyzing the oxidation of colorless TMB to blue oxTMB in the presence of H₂O₂.

[0006] Microfluidic paper chips, a low-cost paper-based material, were first proposed in the 1980s. After decades of development, the excellent properties of paper chips have gradually become known to the public, and they have begun to be used to construct a variety of biosensors. The lack of professional detection equipment in developing countries and regions often leads to limited detection capabilities, posing serious challenges to public health. The portability, rapid color development, and low cost of paper chips have broad application potential in developing countries and regions. Although more researchers are committed to exploring lower detection limits and wider linear ranges, the construction of low-cost, fast-detection microfluidic paper chip biosensors is also an important development direction.

[0007] In summary, in order to achieve rapid on-site detection, the present invention integrates bivalent aptamers with microfluidic paper chips as visual discrimination of kanamycin residues. The paper chip can output the signal of kanamycin in a short period of time, which can be easily distinguished by the naked eye and accurately quantified by detecting absorbance. These two methods complement each other to achieve quantitative and qualitative detection. RGB value detection is further performed on the color contrast image through a smartphone application to achieve intelligent detection. It shows potential applicability when applied to aquatic products and aquaculture water samples. The present invention is suitable for general sensing strategies for small molecules and has opened up a new way to develop on-site analysis based on microfluidic paper chips for clinical diagnosis, food safety and environmental analysis. Summary of the Invention

[0008] The purpose of the present invention is to design a microfluidic paper chip biosensor with an aptamer nanozyme catalyzed colorimetric strategy and its application, which can achieve high sensitivity, high specificity and portable rapid detection of kanamycin in complex samples.

[0009] In order to achieve the above object, the technical solution adopted by the present invention is as follows: The first object of the present invention is to propose a microfluidic paper chip biosensor based on an aptamer nanozyme catalytic colorimetric strategy, the preparation method of which is as follows: Step 1: Combining the peroxidase-mimicking activity of silver nanoparticles (AgNPs) with the specific binding of bivalent aptamers, ssDNA was attached to the surface of AgNPs to enhance their enzyme-mimicking activity and construct a colorimetric aptamer sensor. Step 2: The specific binding of kanamycin to the bivalent aptamer leads to a decrease in the catalytic activity of the AgNPs-aptamer complex towards tetramethylbenzidine (TMB), a decrease in the blue oxidation product oxTMB, and a lighter color of the system. Step 3: Detection is performed by comparing the absorbance RGB values of the blank control group and the positive control group. This system can react on a microfluidic paper chip to achieve rapid qualitative detection of kanamycin; The colorimetric aptamer sensor includes a top recognition element, an intermediate substrate material and a substrate signal conversion element. The bivalent aptamer serves as a recognition element and is adsorbed on the surface of the substrate material AgNPs. The substrate TMB serves as a signal conversion element and can convert the signal recognition signal into a detectable colorimetric signal. The microfluidic paper chip and the portable detection device serve as the detection platform. The microfluidic paper chip integrates sample processing and detection units. Whatman No.1 filter paper serves as the substrate material to provide a microfluidic network and a biocompatible interface. A patterned area is formed by wax printing treatment, and has hydrophilic microchannels and hydrophobic boundaries. The portable detection device is selected from a microplate reader or a smartphone with an integrated image analysis module.

[0010] Furthermore, the nucleic acid sequence of the bivalent aptamer is: GGGACTTGGTTTAGGTAATGAGTCCCGGGACTTGGTTTAGGTAATGAGTCCC. The detection limit of the colorimetric aptamer sensor is 9.66 μmol / s.

[0011] The second purpose of the present invention is to propose a detection method of a microfluidic paper chip biosensor based on an aptamer nanozyme catalytic colorimetric strategy: Preparation of DNA stock solution: Balance the centrifuge tube containing DNA powder and place it in a centrifuge for centrifugation. After centrifugation, gently remove the centrifuge tube and open the lid. Add a certain amount of double-distilled water according to the instructions on the tube wall and shake thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store it in a refrigerator at 4°C until use.

[0012] Recognition of aptamers and kanamycin: Take an appropriate amount of bivalent aptamer and mix it with TE buffer, heat it for denaturation, then slowly cool it for renaturation, and add an appropriate amount of kanamycin of different concentrations to the solution for reaction.

[0013] Reaction of AgNPs with aptamers: Add an appropriate amount of AgNPs to the mixed solution and react for a period of time to allow the free aptamers to adsorb onto the surface of AgNPs.

[0014] Catalytic TMB color development: Add an appropriate amount of color developing substrate TMB and react for a period of time, then measure the absorbance coefficient of the solution at 660nm.

[0015] Smartphone analysis of image RGB values: The mobile application detects the RGB values of the solution system at different kanamycin concentrations, thereby obtaining the corresponding relationship between kanamycin concentration and RGB value, and completing the construction of a smart substance detection method based on bivalent nucleic acid aptamers.

[0016] Prepare the paper chip: Boil the water-wax mixture and cool until no bubbles form. Cut and punch filter paper according to the design. Place the filter paper in a template holder and quickly immerse it vertically in the wax solution. Remove the template holder and smooth the surface, marking the fold lines. Use nano-markless adhesive to securely attach two sets of filter paper to the back of the reaction area of the paper chip to prevent leakage. Store at room temperature until ready for use.

[0017] Aptamer and kanamycin recognition: Take an appropriate amount of bivalent aptamer stock solution and dissolve it in TE buffer, renature it in a constant temperature metal bath, then add it to the reaction area, and add different concentrations of kanamycin solution to react for a period of time.

[0018] Preparation of AgNPs: Ice-cold NaBH4 solution was rapidly injected into AgNO3 solution and stirred continuously until the solution changed from colorless to golden yellow. The solution was purified by 0.22 μm microporous filter and stored at 4 °C until use.

[0019] Reaction of AgNPs with aptamers: An appropriate amount of AgNPs was added to the reaction area of the paper chip to generate a bivalent aptamer-AgNPs complex.

[0020] Catalytic TMB color development: Take an appropriate amount of TMB and mix it with H2O2, add it to the reaction area of the paper chip and react for a period of time.

[0021] Furthermore, in step (1), the centrifuge tube containing the DNA powder is balanced and placed in a centrifuge, and the speed during centrifugation is set to 8000 rpm / min and the centrifugation time is 30 s.

[0022] Furthermore, in step (2), the concentration of the bivalent aptamer was 500 nmol / L, denatured at 95°C for 5 min, ice-bathed for 5 min, and then renatured at 37°C for 1 h. After adding kanamycin, the reaction temperature was set at 37°C for 90 min.

[0023] Furthermore, in step (3), AgNPs are added and reacted at 26°C for 30 min.

[0024] Furthermore, the concentration of TMB added in step (4) is 15 mmol / L, and the reaction is carried out at room temperature for 15 min.

[0025] Furthermore, the mobile application used in step (5) is "Color Selector 7.2.4".

[0026] Furthermore, after boiling and cooling in step (6) until no bubbles are generated, constant heating at 70°C may be selected.

[0027] Furthermore, the pH of the TE buffer used in step (7) is 7.0, the ice bath time should not be too long, the target reaction temperature is set to 37°C, and the reaction time is 90 min.

[0028] Furthermore, in step (8), the concentrations of AgNO3 and NaBH4 are 2 mmol / L and 1.5 mmol / L, respectively, with a volume ratio of 1:1, and the vortexing is stopped when precipitation occurs or the liquid adheres to the wall.

[0029] Furthermore, the reaction in step (9) was carried out for 30 min at a temperature of 26°C.

[0030] Furthermore, in step (10), 60 mmol / L TMB is prepared using dimethyl sulfoxide (DMSO) and mixed with 30% H2O2 to make the final TMB concentration 30 mmol / L.

[0031] The third objective of the present invention is to propose a microfluidic paper chip biosensor using an aptamer nanozyme-catalyzed colorimetric strategy for detecting kanamycin in aquatic products and aquaculture water samples. The application method is as follows: By measuring the absorbance coefficient, a linear correlation between kanamycin concentration and absorbance was achieved within the range of 25 μmol / L to 500 μmol / L, with a limit of detection (LOD) of 9.66 μmol / L. Using smartphone RGB measurement, intelligent analysis of kanamycin was achieved within the range of 25 μmol / L to 250 μmol / L, with an LOD of 4.17 μmol / L.

[0032] The above technical solution can achieve the following beneficial effects: (1) The present invention has high sensitivity and significant specificity, can achieve accurate quantification of nabimyocin within 2 hours, and can realize intelligent detection by combining with mobile applications; (2) The present invention has extremely low requirements for environmental support, is easy to operate, and is user-friendly; Overall, the present invention is user-friendly and can be operated even by non-professionals. Furthermore, the present invention designs a microfluidic paper chip reaction platform that can achieve rapid detection in a variety of environments. Compared with traditional detection methods, it does not require expensive professional equipment support, achieving low-cost rapid detection. The test results are intuitive and clear. Furthermore, the designed microfluidic paper chip is low-cost, and the present invention has high detection sensitivity and good specificity, and has broad application potential in the detection of kanamycin in aquatic products and aquaculture water samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the principle diagram of the sensor detecting kanamycin.

[0034] Figure 2 This is the appearance of the microfluidic paper chip.

[0035] Figure 3 This is a graph showing the response of kanamycin concentration to absorbance.

[0036] Figure 4 This is the standard curve of kanamycin absorbance detected by the sensor.

[0037] Figure 5 This is the standard curve of the RGB value of kanamycin detected by the sensor.

[0038] Figure 6 is a graph of sensor detection specificity. DETAILED DESCRIPTION

[0039] The present invention will be further described below with reference to the accompanying drawings: Example 1: Figure 1-2 As shown, a microfluidic paper chip biosensor based on an aptamer nanozyme-catalyzed colorimetric strategy combines the peroxidase-like activity of AgNPs with the specific binding of a bivalent aptamer. A colorimetric aptamer sensor was constructed by utilizing ssDNA to enhance the peroxidase-like activity of AgNPs by attaching to their surface. The peroxidase-like activity of AgNPs is attributed to their ability to facilitate electron transfer between the substrate TMB and H₂O₂. Using H₂O₂ as an electron acceptor, they catalyze the oxidation of TMB to produce the blue product oxTMB. Upon addition of the target, kanamycin specifically binds to the aptamer, resulting in its detachment from the AgNP surface. As the kanamycin concentration increases, the number of AgNP-aptamer complexes decreases, weakening the catalytic activity of the AgNP-aptamer complex toward TMB and reducing the amount of the oxidized product oxTMB.

[0040] The structural design of the biosensor comprehensively considers the affinity and specificity of the recognition element, the sensitivity of the signal conversion element and the requirements of the actual application scenario. The bivalent aptamer as a recognition element can be adsorbed on the surface of the substrate material AgNPs, and the high specific surface area of AgNPs provides a stable recognition interface. When kanamycin is present in the environment, the bivalent aptamer can specifically recognize kanamycin and trigger conformational changes, which is the basis for generating signals. The aptamer-AgNPs complex and the substrate TMB serve as signal conversion elements, which can convert signal recognition events into detectable colorimetric signals. Microfluidic paper chips and portable detection devices serve as detection platforms. The microfluidic paper chip integrates sample processing and detection units, and Whatman No. 1 filter paper as a substrate material provides a microfluidic network and a biocompatible interface. A patterned area is formed by wax printing treatment, with hydrophilic microchannels and hydrophobic boundaries. The portable detection device is selected from an enzyme-linked microplate reader or a smartphone with an integrated image analysis module.

[0041] The specific process involves combining the peroxidase-mimicking activity of silver nanoparticles (AgNPs) with the specific binding of bivalent aptamers. A colorimetric aptamer sensor was constructed by utilizing the ability of ssDNA to attach to the AgNP surface to enhance its enzymatic activity. The significant affinity of kanamycin for the bivalent aptamer weakened the catalytic activity of the AgNP-aptamer complex toward tetramethylbenzidine (TMB), reducing the blue oxidation product, oxTMB. This resulted in a sensing system in which the absorbance gradually decreased with increasing kanamycin concentration. Intelligent detection was achieved by analyzing the RGB values of the image using a mobile phone, and qualitative detection was achieved using a microfluidic paper chip platform.

[0042] Example 2: A microfluidic paper chip biosensor based on the aptamer nanozyme catalytic colorimetric strategy given in Example 1, wherein the specific detection process includes the following steps: Preparation of DNA stock solution: Balance the centrifuge tube containing DNA powder and place it in a centrifuge for centrifugation at 8000 rpm / min for 30 s. After the centrifugation is completed, gently remove the centrifuge tube and open the lid. Add a certain amount of double-distilled water according to the instructions on the tube wall and shake thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store at 4°C until used.

[0043] Aptamer-Kanamycin Recognition: 10 μL of a 500 nmol / L bivalent aptamer stock solution was dissolved in 40 μL of TE buffer (pH 7.0), i.e., Tris-EDTA buffer (10 mmol / L Tris, 1 mmol / L EDTA). Denature the aptamer at 95°C for 5 minutes in a thermostatic metal bath, incubate on ice for 5 minutes, and then renature at 37°C for 5 minutes. After renaturation, the aptamer was added to the reaction zones on both sides, followed by addition of kanamycin solutions of varying concentrations and mixing for a period of time.

[0044] Preparation of AgNPs: Rapidly inject 200 μL of 2 mmol / L ice-cold NaBH4 solution into 200 μL of 1.5 mmol / L AgNO3 solution and continue stirring for 5 min. After the solution changes from colorless to orange-yellow, purify the solution by filtering it through a 0.22 μm microporous filter and store it at 4 °C until use.

[0045] Incubation of AgNPs-aptamer complex: 50 μL of AgNPs was added to the reaction zones on both sides and reacted at room temperature for 30 min to generate the AgNPs-bivalent aptamer complex.

[0046] Catalytic TMB color development: Take 50 μL of 60 mmol / L TMB and mix it with 30% H2O2 to make the final TMB concentration of 30 mmol / L. Add it to the reaction zones on both sides and react at room temperature for 15 min.

[0047] Smartphone analysis of RGB values: The RGB coefficients of the system at different kanamycin concentrations were measured using the mobile application "Color Picker Version 7.2.4". The linear relationship between kanamycin concentration and RGB coefficients was obtained, completing the construction of the colorimetric aptamer sensor.

[0048] Prepare the paper chip: Boil the water-wax mixture and cool until no bubbles form. Cut and punch filter paper according to the design. Place the filter paper in a template holder and quickly immerse it vertically in the wax solution. Once fully immersed, remove the paper and place on ice to cool. Remove the template holder and smooth the surface, marking the fold lines. Use nano-markless adhesive to securely attach two sets of filter paper to the back of the reaction area of the paper chip to prevent leakage. Store at room temperature until ready for use.

[0049] The nucleic acid aptamer sequence was purchased from Shanghai Sangon Biotechnology Co., Ltd., and the specific nucleic acid aptamer sequence is: GGGACTTGGTTTAGGTAATGAGTCCCGGGACTTGGTTTAGGTAATGAGTCCC.

[0050] Example 3: Plotting of a standard curve for detection of a microfluidic paper chip biosensor using an aptamer nanozyme-catalyzed colorimetric strategy Under the optimal detection conditions, the sensitivity of the aptamer sensor was evaluated. The absorbance spectra of kanamycin at a wavelength of 660 nm were recorded at concentrations of 0 μmol / L to 5 mmol / L. The dynamic detection range of the aptamer sensor was determined with the concentration of kanamycin as the horizontal axis and the absorbance as the vertical axis. Figure 3 The concentration of kanamycin in the range of 25 to 500 μmol / L was linearly correlated with the absorbance, and the linear equation was calculated as follows: y = -0.0005933*C + 0.5222 (R 2 =0.985), where y represents the absorbance value and C represents the kanamycin concentration, and the LOD was determined to be 9.66 μmol / L.

[0051] Detection procedure: First, take 10 μL of 500 nmol / L bivalent aptamer and mix it with 40 μL TE buffer (pH: 7.0), denature it at 95°C for 5 min, ice bath it for 5 min, and renature it at 37°C for 1 hour. Then, add 10 μL of kanamycin of different concentrations to the solution and react it at 37°C for 90 min. Then, add 50 uL AgNPs to the mixed solution and react it at room temperature for 30 min to allow the free bivalent aptamer to adsorb to the AgNPs surface. Then, add 100 uL 15 mmol / L TMB and react it at room temperature for 15 min. The absorbance coefficient of the solution at a wavelength of 660 nm is measured.

[0052] AgNPs were synthesized by chemical reduction. 200 μL of 2 mmol / L ice-cold NaBH4 solution was rapidly injected into 200 μL of 1.5 mmol / L AgNO3 solution and stirred continuously for 5 min. After the solution changed from colorless to orange-yellow, it was purified by 0.22 μm microporous filter membrane and stored at 4 °C until use.

[0053] The detection performance of the aptamer sensor was studied under the optimal detection conditions. Figure 3 It can be seen that in the range of 0~5mmol / L kanamycin concentration, the absorbance of the aptamer sensor gradually decreases with the increase of kanamycin concentration. Accordingly, a linear relationship between the absorbance of the system and the kanamycin concentration (25 μmol / L~500 μmol / L) is obtained, and the linear regression equation is y=-0.0005933*C+0.5222(R 2 =0.985), where y represents the absorbance value and C represents the kanamycin concentration. The LOD was determined to be 9.66 μmol / L (LOD = 3 * relative standard deviation of the absorbance of the blank control group / slope of the standard curve), indicating that the aptamer sensor constructed in the present invention has excellent sensitivity.

[0054] The B / (R+G+B) values of the colorimetric images were analyzed by the mobile application "Color Picker". Figure 5 It can be seen that in the concentration range of 0~5 mmol / L, the B / (R+G+B) value of the colorimetric image decreases with the increase of kanamycin concentration. The corresponding range between B / (R+G+B) value and kanamycin concentration (25 μmol / L~250 μmol / L) was quantitatively derived, and the linear regression equation was y=-1.312e-0.005*C+0.3440 (R 2 =0.991), where y represents the B / (R+G+B) value and C represents the kanamycin concentration. Figure 4 As shown, the LOD was determined to be 4.17 μmol / L.

[0055] Example 4: Detection of real samples using a microfluidic paper chip biosensor based on aptamer nanozyme catalytic colorimetric strategy In order to investigate the detection capability of the microfluidic paper chip biosensor based on the aptamer nanozyme catalytic colorimetric strategy in actual samples, the kanamycin content in real samples was detected by spiking real samples with kanamycin, and the recovery rate and relative standard deviation were measured to analyze the detection performance in actual samples.

[0056] First, we selected two aquaculture water samples, seawater and freshwater, for spike recovery experiments. The seawater was taken from Liandao, Haizhou District, Lianyungang, and the freshwater was taken from Jingsi Lake, Jiangsu Ocean University. Before use, the two aquaculture water samples were filtered multiple times using a 0.22 μm sterile filter membrane to remove interferences. The pH of the water samples was then adjusted to neutral with sodium acetate buffer, and 10 μL of water samples with different concentrations of kanamycin (final concentrations were 0 μmol / L, 50 μmol / L, and 100 μmol / L, respectively) were taken for spike recovery experiments.

[0057] Silver carp meat was pretreated before the experiment. Fresh silver carp purchased from the Lianyungang seafood market were cleaned and minced using a meat grinder. Five grams of sample were then mixed with 5 mL of ultrapure water. The resulting supernatant was collected, centrifuged at 10,000 rpm for 10 minutes, and filtered through a 0.22 μm filter to remove impurities. The supernatant was used to dilute a kanamycin standard solution to obtain final concentrations of 0 μmol / L, 50 μmol / L, and 100 μmol / L. The detection signal was analyzed using the aptamer sensor.

[0058] Pretreatment of tap water: 1 mL of tap water was diluted 50 times with TE buffer (10 mmol / L Tris, 1 mmol / LEDTA), and filtered three times through a 0.22 μm filter membrane to remove interferences.

[0059] Analysis of detection signal results revealed that the constructed microfluidic paper chip biosensor, utilizing a colorimetric strategy based on aptamer nanozymes, exhibited recoveries ranging from 99.3% to 104.92% for kanamycin at concentrations of 0 μmol / L, 50 μmol / L, and 100 μmol / L in seawater, lake water, fish, and tap water. The corresponding relative standard deviations (RSDs) ranged from 3.52% to 5.22%. These results demonstrate the excellent detection performance and practical application value of the microfluidic paper chip biosensor, utilizing a colorimetric strategy based on aptamer nanozymes, in complex samples.

[0060] The specific samples and test results are shown in Table 1: Table 1 Actual sample test table

[0061] Through the above-mentioned embodiments and detection tests, the present invention can achieve highly sensitive, highly specific and portable rapid detection of kanamycin in complex samples. The technical features of the present invention effectively reduce the professional skill requirements of the operators, and realize non-differentiated operation by non-professionals. At the same time, the present invention specially constructs a portable paper reaction platform, which allows for rapid and efficient qualitative detection of small molecules under different environments. The entire detection procedure can be completed in 2 hours, which greatly reduces the time cost compared to traditional detection methods. The presentation of the test results is intuitive and clear, and there is no need for a complicated analysis process. The operator can interpret the test results quickly and accurately. In addition, the present invention has extremely low requirements for the environment and hardware equipment, and does not require expensive professional equipment support, which greatly reduces the detection cost. The present invention successfully realizes a new type of rapid detection technology for kanamycin that is highly sensitive, economical, portable and user-friendly, providing technical support for kanamycin analysis and detection technology.

[0062] The above are all preferred embodiments of the present invention. For ordinary technicians in this technical field, without departing from the principle of the present invention, various equivalent modifications to the present invention are within the scope of protection of the claims attached to this application.

Claims

1. A microfluidic paper chip biosensor based on an aptamer nanozyme catalytic colorimetric strategy, characterized by: The preparation method of the biosensor is as follows: Step 1: Combining the peroxidase-mimicking activity of silver nanoparticles (AgNPs) with the specific binding of bivalent aptamers, ssDNA was attached to the surface of AgNPs to enhance their enzyme-mimicking activity and construct a colorimetric aptamer sensor. Step 2: The specific binding of kanamycin to the bivalent aptamer leads to a decrease in the catalytic activity of the AgNPs-aptamer complex towards tetramethylbenzidine (TMB), a decrease in the blue oxidation product oxTMB, and a lighter color of the system. Step 3: Detection is performed by comparing the absorbance RGB values of the blank control group and the positive control group. This system can react on a microfluidic paper chip to achieve rapid qualitative detection of kanamycin; The colorimetric aptamer sensor includes a top recognition element, an intermediate substrate material and a substrate signal conversion element. The bivalent aptamer serves as a recognition element and is adsorbed on the surface of the substrate material AgNPs. The substrate TMB serves as a signal conversion element and can convert the signal recognition signal into a detectable colorimetric signal. The microfluidic paper chip and the portable detection device serve as the detection platform. The microfluidic paper chip integrates sample processing and detection units. Whatman No.1 filter paper serves as the substrate material to provide a microfluidic network and a biocompatible interface. A patterned area is formed by wax printing treatment, and has hydrophilic microchannels and hydrophobic boundaries. The portable detection device is selected from a microplate reader or a smartphone with an integrated image analysis module.

2. The microfluidic paper chip biosensor with aptamer nanozyme catalytic colorimetric strategy according to claim 1, characterized in that: The nucleic acid sequence of the bivalent aptamer is: GGGACTTGGTTTAGGTAATGAGTCCCGGGACTTGGTTTAGGTAATGAGTCCC.

3. The microfluidic paper chip biosensor with aptamer nanozyme catalytic colorimetric strategy according to claim 1, characterized in that: The detection limit of the colorimetric aptasensor was 9.66 μmol / L.

4. The microfluidic paper chip biosensor with aptamer nanozyme catalytic colorimetric strategy according to claim 1, characterized in that: The specific detection methods are as follows: (1) Preparation of DNA mother solution: Centrifuge the solution containing DNA powder at 8000 rpm / min for 30 s. After centrifugation, add double-distilled water and shake to mix thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store at 4°C for later use. (2) Recognition of bivalent aptamers and kanamycin: Take an appropriate amount of bivalent aptamer and mix it with TE buffer, heat it for denaturation, and then cool it for renaturation. Then, add appropriate amount of kanamycin of different concentrations to the solution for reaction; (3) Reaction of AgNPs with bivalent aptamers: AgNPs are added to the mixed solution to react, so that the free aptamers are adsorbed onto the surface of AgNPs; (4) Catalytic TMB color development: Add TMB to react and measure the absorbance of the solution at 660 nm; (5) Smartphone analysis of image RGB values: The mobile application detects the RGB values of the system at different kanamycin concentrations, and the corresponding relationship between kanamycin concentration and R / (R+G+B) value is obtained, completing the construction of the intelligent colorimetric sensing strategy; (6) Preparation of paper chip: Boil the water-wax mixture and cool it until no bubbles are generated in the water. Take the filter paper, cut and punch holes according to the design, clamp it with the template, and immerse the filter paper vertically and quickly into the wax liquid. After it is completely immersed, take it out and place it on ice to cool down. Remove the template and process it flat and draw the fold line. Use nano-markless glue to stick the two sets of filter paper to the back of the reaction area of the paper chip to prevent leakage. Store it at room temperature for use. (7) Recognition of aptamers and kanamycin: The bivalent aptamer stock solution was dissolved in TE buffer, renatured in a constant temperature metal bath, and added to the reaction area of the paper chip. Different concentrations of kanamycin were added to the reaction area for reaction; (8) Preparation of AgNPs: Quickly inject ice-cold NaBH4 solution into AgNO3 solution and continue stirring for a period of time. After the solution changes from colorless to golden yellow, purify it with a 0.22 μm microporous filter membrane and store it at 4 °C for later use. (9) Reaction of AgNPs with aptamers: An appropriate amount of AgNPs is added to the reaction area of the paper chip to react and generate an AgNPs-aptamer complex; (10) Catalytic TMB color development: Take an appropriate amount of TMB and mix it with H2O2, add it to the reaction area of the paper chip to react, and observe the color development results.

5. The microfluidic paper chip biosensor with aptamer nanozyme catalytic colorimetric strategy according to claim 4, characterized in that: In step (1), the centrifuge tube containing DNA powder is leveled and placed in a centrifuge, the speed is set to 8000 rpm / min, and the centrifugation time is 30 s; in step (2), the bivalent aptamer concentration is 500 nmol / L, the bivalent aptamer is dissolved in TE buffer and heated at 95°C for 5 minutes for denaturation, ice bathed for 5 minutes, and renaturation conditions are 37°C for 60 minutes; in step (3), the amount of AgNPs is 50 μL, the reaction is carried out for 30 minutes, and in step (4), the TMB concentration is 15 mmol / L, and the reaction is carried out for 15 minutes.

6. The microfluidic paper chip biosensor with aptamer nanozyme catalytic colorimetric strategy according to claim 4, characterized in that: In step (5), the mobile application is "Color Selector 7.2.4". In step (6), after boiling and cooling until no bubbles are generated, constant heating at 70°C can be selected. The pH of the TE buffer used in step (7) is 7.

0. The ice bath time should not be too long. The target reaction temperature is set to 37°C and the reaction time is 90 min.

7. The microfluidic paper chip biosensor with aptamer nanozyme catalytic colorimetric strategy according to claim 4, characterized in that: In step (8), the concentrations of AgNO3 and NaBH4 were 2 mmol / L and 1.5 mmol / L, respectively, with a volume ratio of 1:

1. When precipitation or liquid adhered to the wall, vortexing was stopped. In step (9), the reaction was carried out for 30 min at a temperature of 26 °C. In step (10), 60 mmol / L TMB was prepared using dimethyl sulfoxide (DMSO) and mixed with 30% H2O2 to a final TMB concentration of 30 mmol / L.

8. Application of a microfluidic paper chip biosensor based on aptamer nanozyme catalyzed colorimetric strategy for detecting kanamycin in aquatic products and aquaculture water samples.

9. The use according to claim 8, characterized in that: The application method is as follows: kanamycin detection is achieved by detecting absorbance in the range of 25 μmol / L~500 μmol / L; intelligent analysis of kanamycin is achieved in the range of 25 μmol / L~250 μmol / L through smartphone RGB measurement, and qualitative detection of kanamycin is completed using a microfluidic paper chip platform.

Images