LincRNA-p21 and application thereof

Abstract

The present disclosure provides a composition for the treatment of cancer comprising a DDB2 inhibitor and a chemotherapeutic agent wherein the DDB2 inhibitor comprises three RNA fragments from lincRNA-p21. In addition, the DDB2 inhibitor can enhance the chemosensitivity of the cancer to the chemotherapeutic agent, and is used for treating cancer which is unresponsive to chemotherapy.

Description

Technical Field

[0001] The present disclosure relates to a composition for treating cancer, wherein the composition comprises three RNA fragments derived from long noncoding RNA-p21 (lincRNA-p21) and a chemotherapeutic agent. In particular, the three RNA fragments of lincRNA-p21 with DDB2-targeting activity can enhance the sensitivity of various cancer cells to chemotherapeutic agents. Background Art

[0002] Treatment with chemotherapeutic agents triggers a DNA damage response (DDR) and activates p53 to transcriptionally regulate gene expression, which can determine the fate of cells towards aging, cell cycle progression, apoptosis, or DNA repair. In cancer cells, high DNA repair activity is achieved through nucleotide excision repair (NER), base excision repair (BER), homologous recombination (HR), or non-homologous end joining (NHEJ), which leads to the development of chemotherapy resistance. Targeting various DDR or DNA repair components has been considered a promising cancer treatment strategy. BRCA1 / 2 mutant tumors are highly sensitive to inhibition of poly (ADP-ribose) polymerase (PARP), which has led to the success of PARP inhibitors in clinical treatment. Therefore, achieving additive lethality by jointly targeting various DNA repair / DDR pathways provides a paradigm for the development of novel and potential clinical strategies.

[0003] In the DNA repair mechanism, NER plays a key role in the removal of DNA damage induced by cisplatin or doxorubicin. Under the stimulation of chemotherapy, damaged DNA-binding protein 2 (DDB2) is upregulated due to the activation of p53, becoming the first protein to recognize damaged DNA. Subsequently, DDB2 bound to DNA is polyubiquitinated and degraded by the proteasome, and the damaged DNA site is transferred to the second recognition protein XPC to further recruit other DNA repair proteins involved in NER. DDB2 expression is induced by DNA damaging agents (including doxorubicin) and leads to chemotherapy resistance (chemoresistance). Mutations or defects in DDB2 reduce the recognition of damaged DNA and the recruitment of NER-related proteins, leading to DNA repair failure. In addition, PARP1 has also been reported to promote the effectiveness of NER by interacting with the DDB2 protein and stabilizing its expression. Inhibition of DDB2 destabilizes Rad51 and increases triple-negative breast cancer cell sensitivity to PARP inhibitors, suggesting that DDB2 has additional roles in regulating HR. Beyond DNA repair, DDB2 activity occurs at several stages of tumor progression, including cancer cell proliferation, survival, epithelial-mesenchymal transition, migration and invasion, and the formation of cancer stem cells. Therefore, targeting DDB2 is a potential strategy to enhance chemosensitivity to chemotherapy and increase the anticancer activity of PARP inhibitors. However, no DDB2 inhibitors or modulators are currently available for cancer therapy.

[0004] Although nucleic acid therapies can also be applied to the treatment of cancer, issues of RNA stability, delivery, and structure remain problematic, and RNA therapies still lag behind other therapies in terms of strategies for treating cancer.

[0005] Because most long non-coding RNAs (lncRNAs) are at least 200 nt in length, using lncRNAs as a therapeutic strategy for RNA therapy is quite difficult. Consequently, lncRNAs have received little attention and application in clinical practice, and most lncRNAs are considered disease markers rather than therapeutic drugs. Summary of the Invention

[0006] This study demonstrates a negative correlation between lincRNA-p21 and DDB2 in different subtypes of breast cancer cell lines and clinical specimens expressing mutp53. Increased lincRNA-p21 enhances DDB2 polyubiquitination and proteasomal degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 E3 conjugase complex. Downregulation of DDB2 by lincRNA-p21 has been shown to inhibit DNA repair. Importantly, three essential sequences of lincRNA-p21, comprising 5'-CUUGUGUCCCCUUCCCACAG-3' (671nt-690nt; #3) (SEQ ID NO: 1); 5'-CAGGGAACCCCUUCAAUCCC-3' (875nt-894nt; #4) (SEQ ID NO: 2); and 5'-UGGGAGCCCCCUUCCUAAAA-3' (2,158nt-2,177nt; #9) (SEQ ID NO: 3), have been validated in various binding assays to directly interact with and inhibit DDB2. Calculations of structural binding capacity also revealed that the short lincRNA-p21 fragments may affect DDB2 stability and DNA repair. Experimental studies have shown that the co-treatment of the short lincRNA-p21 fragments or exosomes containing the short lincRNA-p21 fragments enhances chemotherapy-induced cytotoxicity in cancer cells.

[0007] LincRNA-p21 short sequence fragments function as lncRNA-based DDB2 inhibitors using exosomes as a delivery system, which show the potential to enhance chemotherapy sensitivity and may benefit patients with breast cancer or other cancer types that are unresponsive to chemotherapy.

[0008] As used herein, the terms "a" or "an" are used to describe components and elements of the present disclosure. This is done for convenience only and to provide a general sense of the present disclosure. Unless otherwise apparent, the description should be understood to include one or at least one and the singular also includes the plural.

[0009] As used herein, the term "or" may mean "and / or."

[0010] The present disclosure provides a nucleic acid molecule comprising a long intergenic non-coding RNA-p21 (lincRNA-p21) sequence, wherein the lincRNA-p21 sequence is selected from the group consisting of CUUGUGUCCCCUUCCCACAG (SEQ ID NO: 1), CAGGGAACCCCUUCAAUCCC (SEQ ID NO: 2), and UGGGAGCCCCCUUCCUAAAA (SEQ ID NO: 3).

[0011] The present disclosure also provides a composition comprising a lincRNA-p21 sequence, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0012] In addition, the present disclosure also provides a method for treating cancer, comprising administering a composition to a subject suffering from cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0013] The present disclosure provides a use of a composition for preparing a drug for treating cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0014] The present disclosure also provides a composition for treating cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0015] The term "subject" as used herein refers to an animal, particularly a mammal. In a preferred embodiment, the subject is a human.

[0016] Damaged DNA binding protein 2 (DDB2) is an important protein that recognizes DNA damage, initiates DNA repair, and confers resistance to chemotherapeutic agents on cancer cells. In the present disclosure, three short sequences from lincRNA-p21 interfere with the DNA damage repair pathway. Furthermore, the lincRNA-p21 sequence can inhibit DDB2-induced DNA repair, thereby enhancing the anti-cancer effects of chemotherapeutic agents. Therefore, the lincRNA-p21 sequence inhibits DDB2 expression, thereby reversing or reducing cancer cell resistance to chemotherapeutic agents and / or enhancing cancer cell sensitivity to chemotherapeutic agents. In one embodiment, the lincRNA-p21 sequence enhances the cancer's sensitivity to chemotherapeutic agents by inhibiting DDB2 expression. Therefore, DDB2 can be identified as a therapeutic target for cancer. In one embodiment, the cancer includes cancers with high DDB2 expression. In the present disclosure, cancers with high DDB2 expression refer to cancers in which the DDB2 expression level in tumor tissue is at least 1.5 times higher than that in normal tissue. In another embodiment, the cancer is poorly responsive or resistant to the chemotherapeutic agent. In a preferred embodiment, the cancer with high DDB2 expression is poorly responsive or resistant to the chemotherapeutic agent.

[0017] In certain aspects, the chemotherapeutic agent is an anticancer drug. In one embodiment, the cancer is a drug-resistant cancer. Therefore, the cancer is resistant to the chemotherapeutic agent. In the present disclosure, a method is provided for reducing drug resistance to a chemotherapeutic agent used to treat cancer, comprising administering a composition to a subject suffering from drug-resistant cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. The lincRNA-p21 sequence can reverse or reduce the resistance of cancer cells to the chemotherapeutic agent and / or enhance the sensitivity of cancer cells to the chemotherapeutic agent.

[0018] The term "treat" encompasses, but is not limited to, reducing, inhibiting or limiting the growth of cancer cells, reducing, inhibiting or limiting the metastasis of cancer cells or the invasion or metastasis of cancer cells, or reducing, inhibiting or limiting one or more symptoms of cancer or its metastasis.

[0019] In one embodiment, the cancer comprises breast cancer, liver cancer, cholangiocarcinoma, lung cancer, colon cancer, head and neck squamous cell carcinoma, stomach adenocarcinoma, and esophageal carcinoma. In a preferred embodiment, the cancer comprises breast cancer and liver cancer. In a preferred embodiment, the cancer comprises breast cancer.

[0020] In another embodiment, the cancer cells have a p53 mutation. In a preferred embodiment, the breast cancer cells have a p53 mutation. In a more preferred embodiment, the breast cancer cells are estrogen receptor (ER) positive and have a p53 mutation.

[0021] In one embodiment, the breast cancer is poorly responsive or resistant to the chemotherapeutic agent.

[0022] As used herein, a chemotherapeutic agent is a compound that can inhibit the growth of cancer cells or tumors. It is understood that one or more chemotherapeutic agents can be used in any of the methods provided herein. For example, two or more chemotherapeutic agents, three or more chemotherapeutic agents, four or more chemotherapeutic agents, etc. can be used in the methods provided herein. Exemplary chemotherapeutic agents include, but are not limited to, anticancer compounds such as cyclophosphamide, doxorubicin, 5-fluorouracil, docetaxel, paclitaxel, methotrexate, epirubicin, cisplatin, carboplatin, vinorelbine, capecitabine, gemcitabine, mitoxantrone, isabepilone, eribulin, carmustine, nitrogen mustard, sulfur mustard, platin tetranitrate, vinblastine, etoposide, camptothecin, topoisomerase inhibitors, inhibitor), and derivatives thereof, or one or more combinations thereof. In a specific embodiment, the chemotherapeutic agent comprises carboplatin, cisplatin or doxorubicin.

[0023] In certain aspects, the sequence of the lincRNA-p21 can effectively enhance the therapeutic effect of the chemotherapeutic agent. As used herein, the term "enhancing the therapeutic effect" includes any subjective or objective factors that show a beneficial response or improvement to the condition being treated as discussed herein. For example, enhancing the therapeutic effect of a chemotherapeutic agent includes reversing or reducing cancer cell resistance and / or enhancing the sensitivity of a resistant cancer to treatment with a chemotherapeutic agent. For example, enhancing the therapeutic effect of a chemotherapeutic agent also includes altering resistant cancer cells so that the cells do not develop resistance to the chemotherapeutic agent. In addition, for example, enhancing the therapeutic effect of a chemotherapeutic agent includes additionally or synergistically improving or increasing the activity of the chemotherapeutic agent.

[0024] In the present disclosure, the composition comprises one or more lincRNA-p21 sequences and one or more chemotherapeutic agents. In one embodiment, the composition further comprises a pharmaceutically acceptable carrier. The term "carrier" refers to a compound, composition, substance or structure that, when combined with a compound or composition, helps or promotes the preparation, storage, administration, delivery, effectiveness, selectivity or any other characteristics of the compound or composition to achieve its intended use or purpose. In other embodiments, the pharmaceutically acceptable carrier comprises a liposome, a nanoparticle, an exosome, a micelle, a polymeric matrix or a gel matrix. In the present disclosure, the sequence of the lincRNA-p21 is contained in a liposome, a nanoparticle, an exosome, a micelle, a polymeric matrix or a gel matrix, or forms a complex with the liposome, nanoparticle, exosome, micelle, polymeric matrix or gel matrix. In one embodiment, the pharmaceutically acceptable carrier comprises a liposome or an exosome.

[0025] In the present disclosure, the lincRNA-p21 sequence can be loaded into the exosomes. In another embodiment, the pharmaceutically acceptable carrier comprises exosomes, wherein the exosomes comprise the lincRNA-p21 sequence. The exosomes containing the lincRNA-p21 sequence are prepared for use in treating cancer. In addition, the exosomes can be combined with anti-human leukocyte antigen G (HLAG) antibodies to form anti-HLAG exosomes. Since HLAG is highly expressed in various cancers, the use of anti-HLAG antibodies is intended to improve the delivery efficiency of the exosomes containing the lincRNA-p21 sequence and the chemotherapeutic agent to cancer cells. In one embodiment, the composition further comprises a targeting molecule for binding to a biomarker on cancer cells. In a preferred embodiment, the targeting molecule comprises an anti-HLAG antibody. Therefore, the anti-HLAG antibody can combine with the lincRNA-p21 sequence or the exosomes to form a therapeutic complex for treating cancer.

[0026] In the methods provided herein, the sequence of the lincRNA-p21 can be administered before, simultaneously with, or after the chemotherapeutic agent is administered to the subject. In addition, the compositions of the present disclosure can be administered by any of a variety of routes, including: via injection (e.g., subcutaneous, intramuscular, intravenous, intraarterial, intraperitoneal), via continuous intravenous infusion, cutaneously, dermally, transdermally, orally (e.g., tablets, pills, liquid medicine, edible film strips), via implanted osmotic pumps, via suppositories, or via aerosol spraying. Routes of administration include, but are not limited to, topical, intradermal, intrathecal, intralesional, intratumoral, intravesical, intravaginal, intraocular, intrarectal, intravesical, intrapulmonary, intracranial, intraventricular, intraspinal, dermal, subcutaneous, intraarticular, placed in a body cavity, nasal inhalation, pulmonary inhalation, pressed into the skin, and electroporation. Administration can be systemic or local. The pharmaceutical composition can be delivered locally to the area in need of treatment, such as by topical administration or local injection. Multiple administrations and / or doses may also be used.

[0027] In the present disclosure, the subject is administered a therapeutically effective amount of a composition containing a lincRNA-p21 sequence and a chemotherapeutic agent. The term "therapeutically effective amount" is defined as any amount that produces the desired physiological response. The dosage range administered is a dosage range that is large enough to produce the desired effect, wherein one or more symptoms of the disease or condition are affected (e.g., alleviated or delayed). The dose should not be so large as to cause significant adverse side effects, such as unwanted cross-reactions, allergic reactions, etc.

[0028] The dosage of the lincRNA-p21 sequence or the chemotherapeutic agent is typically in the range of about 0.0001, 0.001, or 0.01 mg / kg / day to about 1000 mg / kg / day, but may be higher or lower, depending on, including but not limited to, the activity of the composition, its bioavailability, the mode of administration, and the various factors discussed above. The dosage and administration interval can be individually adjusted to provide local and / or systemic concentrations of exosomes sufficient to maintain a therapeutic or prophylactic effect. For example, the composition may be administered once a week, several times a week (e.g., every other day), once a day, or several times a day, depending on, including but not limited to, the mode of administration, the specific indication being treated, and the judgment of the prescribing physician. A skilled artisan will be able to optimize the effective local dosage without undue experimentation. In one embodiment, the therapeutically effective amount of the composition ranges from 0.01 to 100 mg / kg body weight. In a preferred embodiment, the therapeutically effective amount of the composition ranges from 0.1 to 50 mg / kg body weight. In a more preferred embodiment, the therapeutically effective amount of the composition ranges from 1 to 10 mg / kg body weight.

[0029] Chemoresistance is a major challenge in the clinical treatment of various cancers. DNA repair induced by the DDB2 protein is one of the main reasons why cancer cells are insensitive to chemotherapy. This study primarily discovered that lincRNA-p21 can directly bind to DDB2 and cause its degradation. Therefore, lincRNA-p21 could serve as the first DDB2 inhibitor, potentially improving the efficacy of clinically available chemotherapeutic drugs such as carboplatin, cisplatin, and doxorubicin.

[0030] More importantly, using different experimental models, they identified three essential short sequences required for lincRNA-p21 to bind to the DDB2 protein. Computer prediction and calculations showed that these three short lincRNA-p21 sequences can bind to regions of DDB2 that interact with the DDB1 protein. The molecular interface between them stabilizes the formation of the Cul-4 / DDB1 / DDB2 complex. Without the need for full-length lincRNA-p21, these three sequences can still directly bind to the DDB2 protein, promoting DDB2 proteolysis and increasing cancer cell sensitivity to chemotherapeutic drugs. Because lincRNA-p21 is over 3,000 nucleotides long, using full-length lincRNA-p21 as an RNA therapeutic strategy would be quite difficult in terms of product synthesis, delivery, and stability. Another important breakthrough of this disclosure is the demonstration that only three short lincRNA-p21 sequences, approximately 20 nucleotides in length, can directly bind to DDB2. The mechanism of action can be analyzed through molecular biology and molecular simulation, demonstrating that this can achieve the functions of degrading the DDB2 protein, inhibiting DNA repair, and enhancing chemotherapy sensitivity.

[0031] More importantly, the present disclosure uses exosomes to encapsulate three lincRNA-p21 short sequences (exoLinc-p21s) and uses them with the chemotherapy drug doxorubicin as a drug delivery model, demonstrating that exoLinc-p21s can enhance the toxicity and growth inhibition of the chemotherapy drug doxorubicin in cancer cells. In addition, anti-HLAG exosomes also serve as an RNA delivery system for identifying cancer cells. The anti-HLAG antibodies loaded on the exosomes can improve the delivery efficiency of exoLinc-p21s and chemotherapy drugs to cancer cells. The results show that anti-HLAG exosomes can not only promote exoLinc-p21s to cause DDB2 protein hydrolysis and tumor cell toxicity, but also improve the efficiency of delivery to tumors to increase sensitivity to chemotherapy drugs.

[0032] In summary, three short lincRNA-p21 sequences (Linc-p21s) essential for DDB2 binding were identified and developed as first-in-class DDB2 inhibitors. Compared to full-length lincRNA-p21, these inhibitors offer advantages such as low synthesis cost, high stability, and improved delivery efficiency. In molecular modeling analyses, Linc-p21s have been shown to stabilize the molecular interface between DDB2 and DDB1 proteins and to directly bind to DDB2 for proteasomal degradation. In cell lines and animal models, exosomes containing a cancer-targeting α-HLAG antibody as a delivery system have been shown to enhance the cytotoxic and growth-inhibitory effects of doxorubicin on cancer cells. As a first-in-class DDB2 inhibitor, exoLinc-p21s has the potential to be developed as a novel RNA-based chemosensitizer for the benefit of patients with various cancer types. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figures 1A to 1C The results showed that the expression of lincRNA-p21 was negatively correlated with cancer stage, tumor size and ERα status. Figure 1A and Figure 1B The results showed that the expression of lincRNA-p21 quantified by in situ hybridization (ISH) was higher in early stage human breast cancer tumors (stage IIA, n=12; stage IIB, n=12) than in late stage (stage IIIA, n=8; stage IIIB, n=8) ( Figure 1A ) and was negatively correlated with tumor size ( Figure 1B ). Figure 1C Quantified by ISH, lincRNA-p21 expression is higher in ERα-negative human breast cancer tumors (n=27) than in ERα-positive human breast cancer tumors (n=13). Arrows indicate lincRNA-p21 expression signals, calculated as the average number of dots per nucleus. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001.

[0034] Figures 2A to 2J Higher lincRNA-p21 expression was shown to be present in smaller tumor size, ERα-negative breast cancer, and early-stage tumors, and contributes to the chemotherapy sensitivity of breast cancer. Figure 2AThe diagram shows the treatment timeline of Tet-On-LincRNA-p21 in a tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A The growth rate of T-47D human breast cancer xenografts was also shown to be inhibited by tetracycline-induced expression of the lincRNA p21 (lower panel). Data represent three independent experiments in each group and are presented as mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001 compared with the control group using the Student's t-test. Figure 2B 、 Figure 2C and Figure 2D The results showed that carboplatin (50 μM) induced lincRNA-p21 expression in vitro and the disease stage ( Figure 2B ) and tumor size (n=61) ( Figure 2C ) was negatively correlated with ERα, and was more highly expressed in ERα-negative human breast cancer primary culture tissues (n=14) than in ERα-positive human breast cancer primary culture tissues (n=47). Figure 2D ). Welch's two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 2E Induction of lincRNA-p21 expression and chemotherapy response in breast cancer cell lines 50 Negatively correlated. Figure 2F and Figure 2G The results showed that the ectopic expression of lincRNA-p21 ( Figure 2F ) and silence( Figure 2G ) changed the degree of apoptosis induced by carboplatin in T-47D cancer cells. Figure 2H showed that silencing of lincRNA-p21 in MDA-MB-231 cancer cells reduced the expression of carboplatin-induced apoptosis markers. Figure 2I and Figure 2J showed that silencing lincRNA-p21 by two independent shRNAs could inhibit the tamoxifen-induced proliferation of BT-474 cancer cells ( Figure 2I ) and ERα silencing ( Figure 2J ) , as evidenced by the induction of apoptotic death measured by FACS assay. Figure 2F 、 Figure 2G 、 Figure 2I as well as Figure 2JThe data are representative of at least three experiments and are expressed as mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001 compared with the control group using Student's t test.

[0035] Figure 3A and Figure 3B We show that lincRNA-p21 is a mediator regulating ERα-associated chemoresistance. Figure 3A and Figure 3B show Figure 2I and Figure 2J Raw data from FACS assays. Data represent at least three experiments and are presented as mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001 compared with the control group using Student's t test.

[0036] Figures 4A to 4K It was shown that lincRNA-p21 could reduce DNA repair and was negatively correlated with the expression of DDB2. Figure 4A In immunofluorescence staining assays, silencing lincRNA-p21 reduced the formation of cisplatin-DNA adducts (Pt-(GpG) purine dimers) induced by cisplatin (50 μM) in MDA-MB-231 cancer cells in a time-dependent manner. Immunofluorescence staining images were quantified using ImageJ analysis. Figure 4B The network diagram of protein-coding genes associated with ERα positive expression was analyzed using STRING and Cytoscape 3.8.0.

[0037] Figure 4C The results show that DDB2 expression in GSE18908 dataset is higher in ERα-positive human breast cancer tissues than in ERα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05; **p<0.01; ***p<0.001. Figure 4D Kaplan-Meier survival analysis showed that patients with ERα-positive breast cancer who received neoadjuvant chemotherapy had poor overall survival (OS, n=187) and had higher DDB2 expression. Figure 4E and Figure 4F The results showed that DDB2 mRNA expression induced by carboplatin (50 μM) in vitro was higher in ERα-positive (n=47) than in ERα-negative (n=14) human breast cancer primary cultures ( Figure 4E), Welch two-sample t test: *p<0.05; **p<0.01; ***p<0.001, and positively correlated with tumor size (n=61) ( Figure 4F ). Figure 4G The extent of induction of lincRNA-p21 and DDB2 is shown in chemotherapy responses (CR: complete response (100% reduction), PR: partial response (greater than or equal to (>=) 50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)) in neoadjuvant treated patients. Figure 4H and Figure 4I Showing the dynamic expression of proteins induced by chemotherapy ( Figure 4H ) and the chromatin binding activity of DDB2 ( Figure 4I ) in ERα-positive breast cancer cell lines was higher than that in ERα-negative breast cancer cell lines. Figure 4J Western blot analysis shows that DDB2 knockdown by two independent shRNAs enhanced the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner. Figure 4K This study demonstrates that DDB2 knockdown enhances carboplatin-induced apoptosis in T-47D cancer cells as determined by FACS. Data represent at least three experiments and are presented as mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001 compared with the control group using the Student's t-test.

[0038] Figures 5A to 5E DDB2 is shown to contribute to DNA repair functions associated with chemotherapy resistance. Figure 5A Shows the ranking of ERα-related gene expression in human breast cancer tumors in KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis. Figure 5B Kaplan-Meier survival analysis showed that higher DDB2 expression was associated with worse overall survival (OS, n=76) in patients with ERα-positive / mutp53 breast cancer who received neoadjuvant chemotherapy compared with patients with ERα-negative / mutp53 breast cancer. Figure 5C Box plot showing DDB2 expression in various cancer types analyzed from the pan-cancer database GEPIA. Figure 5DThe results show that the DNA repair efficacy of T-47D and MDA-MB-231 cancer cells in response to cisplatin (50 μM) was examined in a time-dependent manner using an anti-cisplatin modified DNA antibody in an immunofluorescence staining assay. Images of immunofluorescence staining were quantified using ImageJ analysis. Figure 5E showed that chemotherapy induces DDB2 expression in ERα-positive but not ERα-negative breast cancer cells.

[0039] Figure 6A and Figure 6B These results indicate that lincRNA-p21 may target DDB2 and interfere with its nuclear translocation to achieve chemotherapy sensitization. Figure 6A and Figure 6B Carboplatin (50 μM) induced nuclear translocated protein accumulation ( Figure 6A ), and the level of DDB2 enriched by doxorubicin (0.5 μM) in triton-resistant (chromatin-bound) lysates ( Figure 6B ) appeared in ERα-positive breast cancer cell lines, but not in ERα-negative breast cancer cell lines.

[0040] Figures 7A to 7K We show that lincRNA-p21 downregulates DDB2 expression by enhancing the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A Carboplatin (50 μM) and doxorubicin (0.5 μM) induce the expression of lincRNA-p21 in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right panels), but not in ERα-positive T-47D cells (top and left panels). In contrast, these chemotherapeutic agents induce DDB2 mRNA levels in ERα-positive breast cancer cell lines (bottom and left panels). Figure 7B Carboplatin induced nuclear translocation of lincRNA-p21 in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right panel), but not in ERα-positive T-47D cancer cells (left panel). Figure 7C qRT-PCR analysis shows that ectopic expression (left panel) and silencing (right panel) of lincRNA-p21 did not affect the level of DDB2 mRNA in T-47D and MDA-MB-231 cancer cells. Figure 7D It was shown that DDB2 mRNA levels in T-47D#Tet-On-LincRNA-p21 cancer cells were not changed by lincRNA-p21 induction. Figure 7EIt was shown that treatment with the proteasome inhibitor MG132 (10 μM) increased DDB2 expression in a time-dependent manner. Figure 7F Western blot assay Figure 8D The original data. Figure 7G The figure shows the in vivo binding of doxorubicin (0.5 μM)-induced lincRNA-p21 to DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells, as verified by RNA-IP experiments. Figure 7H In vitro treatment with RNase A reduced carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 7I It was shown that knockdown of lincRNA-p21 reduced the level of DDB2 protein in anti-Cul-4 and anti-DDB1 immune complexes induced by carboplatin (50 μM) in the presence of MG132. Figure 7J Figure 3. DDB2 in carboplatin-treated T-47D cancer cell lysates can be pulled down in vitro by different fragments of biotinylated lincRNA-p21. Dot plots indicate equal input of biotinylated RNA. Figure 7K We show that carboplatin (50 μM) induces in vivo binding of lincRNA-p21 to DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis followed by RNase A digestion. Figure 7A 、 Figure 7C 、 Figure 7D 、 Figure 7G and Figure 7K The data are representative of three experiments and are expressed as mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001 compared with the control group using Student's t test.

[0041] Figures 8A to 8N We show that lincRNA-p21 serves as a scaffold for the Cul-4 / DDB1 / DDB2 complex to enhance DDB2 protein ubiquitination and degradation. Figure 8A showed that ectopic expression of lincRNA-p21 reduced the protein level of DDB2. Figure 8B showed that knockdown of lincRNA-p21 increased the protein level of DDB2. Figure 8C It was shown that DDB2 protein expression was inhibited by lincRNA-p21 induction in stable cancer cell clones of the T-47D#Tet-On system. Figure 8DEctopic expression of lincRNA-p21 was shown to reduce the stability of DDB2 protein in the presence of CHX (25 μM). The levels of DDB2 protein detected in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E It was shown that pretreatment with MG132 (10 μM) could prevent the downregulation of DDB2 induced by lincRNA-p21. Figure 8F showed that ectopic expression of lincRNA-p21 increased the polyubiquitination of DDB2 in MG132-treated T-47D cancer cells. Figure 8G and Figure 8H In RNA-IP experiments, carboplatin (50 μM)-induced DDB2 ( Figure 8G ), DDB1 and Cul-4 ( Figure 8H ) binds to lincRNA-p21 in vivo, but not in ERα-positive T-47D cancer cells. Figure 8I We show that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in a co-IP assay. Figure 8J In vitro pulldown of DDB2, DDB1, and Cul-4 by biotinylated lincRNA-p21, but not by HOTAIR or α-tubulin mRNA, is shown in lysates from carboplatin-treated T-47D cancer cells. The dot plots indicate equal input of biotinylated RNA. hnRNP-K served as a positive control for lincRNA-p21 interacting proteins. Figure 8K The diagram shows biotinylated lincRNA-p21 deleted fragments used for RNA pull-down experiments and primer sets for different regions used for RNA-IP experiments. Figure 8L Shown is the pull-down of DDB2 in vitro by biotinylated lincRNA-p21 at different deletions in lysates from carboplatin-treated T-47D cancer cells. The dot plot indicates equal input of biotinylated RNA. Figure 8M Carboplatin (50 μM) induced the in vivo binding of DDB2 to specific regions of lincRNA-p21 in T-47D cancer cells as analyzed by RNA-IP assay, followed by RNase A digestion. Figure 8G 、 Figure 8H and Figure 8MThe data are representative of at least three experiments and are expressed as mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001 compared with the control group using Student's t test. Figure 8N The diagram shows the predicted secondary structure of lincRNA-p21 (ViennaRNA web server) and the putative DDB2-binding sequence.

[0042] 9A to 9I It was shown that three lincRNA-p21 short sequences #3, #4, and #9 bound to DDB2 protein in vitro. 9A to 9D The DDB2 protein in T-47D cancer cell lysates treated with carboplatin was compared with that in the single ( Figure 9A and Figure 9B ) or compound ( Figure 9C and Figure 9D ) Biotinylated lincRNA-p21 mutants lacking p21 were subjected to in vitro pull-down assays. Dot plots show equal input of biotinylated RNA. Figure 9E The surface plasmon resonance (SPR) assay showed the dose-dependent binding activity of lincRNA-p21 short sequences #3, #4, and #9 to recombinant DDB2 protein. Figure 9F The Ct values of pure lincRNA-p21 short sequences determined by concentration gradient were used as the standard curve. Figure 9G The results show that the transfection efficiency of lincRNA-p21 short sequences #3, #4, and #9 into T-47D cancer cells is comparable at different concentrations. Figure 9H Co-treatment with three lincRNA-p21 short sequences significantly enhanced cytotoxicity in the presence of carboplatin, cisplatin, and doxorubicin. Data represent three experiments and are presented as mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001 compared with the control group using a Student's t-test. Figure 9I Treatment with MG132 was shown to reverse the inhibitory effect.

[0043] Figures 10A to 10C Shown are the effects of lincRNA-p21 short sequences #3, #4, and #9 on chemotherapy-induced cytotoxicity in breast cancer cells. Figure 10A Treatment with the three lincRNA-p21 short sequences alone increased cytotoxicity only in the presence of carboplatin, but had no effect in the presence of cisplatin or doxorubicin. Data represent three experiments and are presented as mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001 compared with the control group using the Student's t-test. Figure 10B It was shown that combined treatment of three lincRNA-p21 short sequence combinations could inhibit the expression of DDB2 protein. Figure 10C show Figure 9I The original data.

[0044] Figures 11A to 11E The 3D structure of the short lincRNA-p21 sequence bound to the N-terminal α-helix of DDB2 was modeled using computational molecular docking. Figure 11A The 3D structures of three lincRNA-p21 short sequences calculated and predicted by six RNAComposer databases (CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold) are shown. Figure 11B This figure shows 2,000 configurations (poses) generated by the ZDOCK docking mode in BIOVIA DiscoveryStudio, with one configuration generated every 6 degrees. The marked points represent potential configurations between the two macromolecules, and the points indicated by arrows are the short lincRNA-p21 sequences selected for their highest potential interaction with DDB2. Figure 11C A cluster of potential conformations is shown around the N-terminal α-helix of DDB2. Figure 11D The 3D structural model of three short lincRNA-p21 sequences coiled around the α-helix of DDB2 is shown, and the α-helix is responsible for the interaction with DDB1. Figure 11E The interaction sites between the short lincRNA-p21 sequence and DDB2 are shown in the 3D structure.

[0045] 12A to 12H The position of the lincRNA-p21 short sequence in complex with DDB2 is shown by molecular docking calculations. 12A to 12E Docking analysis results from other databases are shown, and the selected configurations are shown as labeled dots, indicating potential configurations between the two macromolecules. Figures 12F to 12H The most potential conformation prediction between the lincRNA-p21 short sequence and DDB2 in other databases is shown. Figure 12F In the figure, the turquoise configuration comes from the 5 databases (pose 22), and the pink configuration comes from contextFold (pose 27). Figure 12G In the figure, the turquoise configuration comes from 4 databases (pose19), the pink configuration comes from contextFold (pose2), and the yellow configuration comes from RNAstructure (pose 1). Figure 12HIn the figure, the turquoise configuration comes from 4 databases (pose 8), the pink configuration comes from contextFold (pose 40), and the yellow configuration comes from RNAstructure (pose 8).

[0046] 13A to 13H We show that exosome-encapsulated lincRNA-p21 short sequences #3, #4, and #9 (exoLinc-p21s) can enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A Shows exosome particles photographed by TEM. 13B to 13F Three short lincRNA-p21 sequences (#3+#4+#9) were shown to be encapsulated by exosomes (exoLinc-p21s), which were used as exosome-based therapeutics to demonstrate the inhibitory function of DNA repair ( Figure 13B ), the inhibitory function of DDB2 protein ( Figure 13C ), growth inhibitory function ( Figure 13D ), cytotoxicity enhancement effect ( Figure 13E ), and inhibition of tumor size in xenograft mouse models ( Figure 13F ). Figure 13G and Figure 13H The cytotoxic effects of exoLinc-p21s with or without anti-HLAG antibody loading were shown ( Figure 13G ) and the inhibitory function of DDB2 protein ( Figure 13H ). Figure 13D 、 Figure 13E as well as Figure 13G The data are representative of at least three experiments and are expressed as mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001 compared with the control group using Student's t test.

[0047] Figure 14A and Figure 14B The delivery efficiency of exosomes with and without anti-HLAG antibodies is shown. Figure 14A The colony area and average colony size are shown in the growth inhibition function of exoLinc-p21s. Figure 14B The delivery efficiency of exosomes presented with and without anti-HLAG antibodies was determined in a time-dependent manner by immunofluorescence staining. DETAILED DESCRIPTION

[0048] The present disclosure may be implemented in many different forms and should not be construed as limited to the embodiments set forth herein. The described embodiments should not be used to limit the scope of the present disclosure described in the claims.

[0049] Materials and methods

[0050] Clinical specimens

[0051] With informed consent, breast cancer tissue samples from 61 patients with different breast cancer subtypes were collected from the Chung Shan Medical University Hospital. The sample collection included all breast cancer subtypes without prior screening, and the samples were used under the approval of the Human Research Ethics Review Committee of the Chung Shan Medical University Hospital (CS2-18150). The tissues were homogenized and cultured for 5 days with or without carboplatin. TRIzol was then used. TM Total RNA and protein lysates were prepared using HER2+ reagents (Thermo Fisher Scientific Inc., Waltham, MA, USA).

[0052] Tissue microarray and in situ hybridization experiments

[0053] Breast cancer tissue microarrays were purchased from SuperBioChips Laboratories (Seoul, South Korea), and in situ hybridization experiments were performed to detect lincRNA-p21. Tissue microarray specimens included 40 patients with different breast cancer subtypes. The RNAscope lincRNA-p21 (TP53COR1) probe used for in situ hybridization assays was designed and purchased from Advanced Cell Diagnostics, Inc. (Newark, CA, USA). The present disclosure uses the RNAscope 2.5HD Detection Kit-BROWN and screens the signal of lincRNA-p21 in breast cancer tissue according to the manufacturer's procedure guidelines. The signal of lincRNA-p21 expression was quantified using Fiji ImageJ and normalized using the cell nucleus to calculate the area and percentage of the probe number.

[0054] Cell culture

[0055] Breast cancer cell lines MCF7 (RRID: CVCL_0031), T-47D (RRID: CVCL_0553), BT-474 (RRID: CVCL_0179), SK-BR-3 (RRID: CVCL_0033), MDA-MB-468 (RRID: CVCL_0419), and MDA-MB-231 (RRID: CVCL_0062), and liver cancer cell line HepG2 (RRID: CVCL_0027) were cultured in Dulbecco's Modified Eagle Medium containing Nutrient Mixture F-12 (DMEM / F12, HyClone TM) (ThermoFisher Scientific Inc., Waltham, MA, USA), 10% fetal bovine serum (FBS, Gibco, Thermo Fisher Scientific Inc., Waltham, MA, USA) and HyClone TM Penicillin-streptomycin solution. All cell lines were purchased from American Type Culture Collection (ATCC) and cultured at 37°C in a humidified incubator with 5% CO2 and detected by MycoAlert TM The mycoplasma detection kit (LT07-318, Thermo Fisher Scientific Inc., Waltham, MA, USA) was used to check for mycoplasma contamination.

[0056] Inhibitors and reagents

[0057] Carboplatin (41575-94-4), (Z)-4-hydroxy Tamoxifen (68047-06-3), cycloheximide (CHX, 66-81-9), (S)-MG132 (133407-82-6), and tetracycline (hydrochloride, 64-75-5) were purchased from Cayman Chemical (Michigan, USA). Cisplatin (cis-diammineplatinum (II), P4394) and doxorubicin hydrochloride (Sigma-Aldrich, D1515) were purchased from Merck KGaA (Darmstadt, Germany). TM Western enhanced chemiluminescence (ECL) substrate was purchased from Bio-Rad Laboratories, Inc. (Hercules, CA, USA).

[0058] Antibody

[0059] Anti-DDB2 antibody (#5416, RRID: AB_10694497), anti-Ac-p53 antibody (K382, #2525S, RRID: AB_330083), anti-p-ERα antibody (Ser118, #2511), anti-HA-Tag antibody (#3724, RRID: AB_1549585), anti-PARP antibody (#9542, RRID: AB_2160739) and anti-histone H3 antibody (#9715, RRID: AB_331563) were purchased from Cell Signaling Technology, Inc. (Beverly, MA, USA). Anti-DDB1 antibody (sc-25367, RRID: AB_639050), anti-Cul-4 antibody (sc-377188), anti-hnRNP-K antibody (sc-28380), anti-p53 antibody (sc-126, RRID: AB_628082) and anti-ERα antibody (sc-8002, RRID: AB_627558) were purchased from Santa Cruz Biotechnology, Inc. (CA, USA). Anti-ubiquitin antibody (P4D1-A11), anti-p21WAF1 antibody (Calbiochem, OP64, RRID: AB_2335868), anti-α-tubulin antibody (T5168, RRID: AB_477579), and anti-β-actin antibody (A2228, RRID: AB_476697) were purchased from Merck KGaA (Darmstadt, Germany). Anti-Caspase 3 antibody (Imgenex IMG-144A, RRID: AB_316677) was purchased from Novus Biologicals, LLC. (Centennial, CO, USA). Anti-p-histone H2AX antibody (Ser139, AF2288, RRID: AB_2114989) was purchased from R&D Systems Inc. (Minneapolis, MN, USA).

[0060] Western blotting analysis

[0061] The total protein lysate concentration was determined using the Bradford protein assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA) in which 30 μg of protein lysate was heated at 95°C for 5 min in sample buffer. Denatured proteins were separated by SDS-PAGE using electrophoresis buffer and transferred to PVDF membranes (0.45 μM, Millipore, Merck KGaA, Darmstadt, Germany) or NC membranes (0.22 μM, Amersham, MA) in transfer buffer. TM , GE Healthcare LifeScience, Pittsburgh, PA, USA). The transferred membranes were covered with TBST buffer with 5% milk or BSA and stained with the indicated primary antibodies overnight at 4°C, followed by incubation with HRP-conjugated secondary antibodies. TM The ECL signal was detected by Touch Imaging System (Bio-Rad).

[0062] RNA extraction and RT-PCR

[0063] After the indicated experimental treatments, cells were washed three times with ice-cold PBS and stained with TRIzol TM Reagent (ThermoFisher Scientific Inc., Waltham, MA, USA). TM The total RNA was isolated by adding 0.2 mL of chloroform to the reagent and centrifuging at 12,000 g for 15 minutes to separate the aqueous phase, the interphase, and the organic phase. Next, the RNA in the aqueous phase was precipitated by mixing with 0.25 to 0.5 mL of isopropanol and centrifuging at 12,000 g for 15 minutes. After removing the supernatant, the gel-like pellet was washed twice with 1 mL of 75% ethanol, air-dried, and dissolved in DEPC-treated water. 1 μg of total RNA, Invitrogen TM Reverse transcription polymerase chain reaction (RT-PCR) was performed using M-MLV reverse transcriptase (Thermo Fisher Scientific Inc., Waltham, MA, USA), random hexamer, dNTPs, 5X M-MLV buffer, and DTT.

[0064] Quantitative real-time PCR

[0065] For qRT-PCR, 2X KAPA SYBR FAST qPCR Master Mix Kit (KapaBiosystems, Wilmington, MA, USA) was used to detect the expression of target genes with specific primers. LightCycler 480 Real-Time PCR System (Roche Molecular Systems, Inc., Pleasanton, CA, USA) or Applied Biosystems TM QuantStudio TM Threshold cycle or Ct value was analyzed using a 5-well real-time PCR system (Thermo Fisher Scientific Inc., Waltham, MA, USA). ddCt was calculated using a housekeeping gene as a reference for normalization.

[0066] RNA immunoprecipitation (RNA-IP) assay

[0067] Cells were fixed with 1% formaldehyde and neutralized with 1 M glycine, washed twice with ice-cold PBS, scraped, and lysed with lysis buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 1 mM DTT, cOmplete TM Protease inhibitor cocktail (1 tablet contains enough protease inhibitors for 10 mL of cell extract) (Roche Molecular Systems, Inc., Pleasanton, CA, USA) and 200 U / mL RNaseOUT TM (ThermoFisher Scientific Inc., Waltham, MA, USA) with shaking. After three freeze-thaw cycles on ice, the lysate was centrifuged at 14,000 rpm for 30 minutes, and the supernatant was collected for immunoprecipitation. Sepharose protein A / G was pre-coated for 1 hour, then mixed with the antibody in NT2 buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM MgCl2, and 0.5% NP-40) and incubated overnight. The cells were then washed three times with NT2 buffer and incubated with NT2 lysis buffer (1 mM DTT, 200 U / mL RNaseOUT). TMThe immune complexes were washed three times and reverse crosslinked in 100 μL of NT2 buffer at 70°C for 5 hours. Finally, the samples were incubated with 0.25 mg / mL Sigma-Aldrich proteinase K (Merck KGaA, Darmstadt, Germany) at 55°C for 30 minutes and stained with TRIzol. TM Reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) was used for RNA extraction and qRT-PCR.

[0068] Preparation of biotinylated RNA by in vitro transcription

[0069] To examine the interaction between RNA and target proteins (including DDB1, DDB2, Cul-4 and hnRNP-K) in vitro, Invitrogen TM T7 RNA polymerase (Thermo Fisher Scientific Inc., Waltham, MA, USA) and Biotin RNA Labeling Mix (Roche Molecular Systems, Inc., Pleasanton, CA, USA) were used to prepare biotinylated RNA for use in biotin pull-down assays. Biotinylated lincRNA-p21, HOTAIR, and tubulin RNA were generated using their DNA templates synthesized using a T7-containing primer set in PCR.

[0070] Biotin pull-down assay

[0071] For in vitro pull-down assays, 3 μg of biotinylated RNA was heated to 90°C for 2 minutes and reconstituted in structure buffer (10 mM Tris-HCl (pH 7.0), 0.1 M KCl, and 10 mM MgCl2) at room temperature for 20 minutes. 7 ) were treated with or without chemotherapy and then dispersed in nuclear isolation buffer (1.28 M sucrose, 40 mM Tris-HCl (pH 7.5), 20 mM MgCl2 and 4% Triton X-100). Nuclear pellets were washed with RIP buffer (150 mM KCl, 25 mM Tris-HCl (pH 7.4), 0.5 mM DTT, 0.5% NP-40, 1 mM PMSF and cOmplete TMFolded DNA or RNA was hybridized with protease inhibitor cocktail (one tablet contains enough protease inhibitors for 10 mL of cell extract) (Roche Molecular Systems, Inc., Pleasanton, CA, USA) for one hour, and then the RNA-protein complex was pulled down using Novagen streptavidin agarose beads (Novagen Corporation, San Diego, CA, USA) and analyzed by Western blotting.

[0072] Isolation of nuclear and cytoplasmic RNA

[0073] Before scraping the cells with TD buffer (137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, and 25 mM Tris-HCl (pH 7.4)), the cells were washed twice with TD buffer and then centrifuged at maximum speed for 30 seconds at room temperature. The pellet was washed with 200 μL of TD buffer and resuspended with 100 μL of Vanadyl Ribonucleoside Complex buffer (20 mM VRC (S1402S, New England BioLabs Inc., Ipswich, MA, USA), 10 mM Tris-HCl, 0.14 M NaCl, 1.5 mM MgCl2, 1 mM DTT, and TD buffer (pH 8.6) containing 0.5% NP-40), shaken for 10 seconds, and then placed on ice for 5 minutes. The supernatant was transferred to a new Eppendorf centrifuge tube and precipitated with TRIzol. TM Before lysing with TRIzol-170 reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) to isolate cytoplasmic RNA, the cells were shaken again and centrifuged at maximum speed for 30 seconds. To isolate nuclear RNA, the pellet was washed with 200 μL of 0.5% NP-40 / TD buffer, dispersed with 100 μL of 0.5% NP-40 / TD buffer, and then lysed with Invitrogen TRIzol-170. TM Reagents for lysis.

[0074] Triton extraction assay

[0075] After treatment with carboplatin, cells were lysed for 30 minutes at 4°C using Triton extraction buffer (100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 10 mM PIPES (pH 6.8), 1 mM EGTA (pH 6.8), 0.2% Triton X-100, supplemented with 1 mM NaVO4, 1 mM PMSF, 10 mM NaF, and 1 ng / mL aprotinin). The supernatant was collected as the Triton-extractable fraction (chromatin-free proteins), while the precipitate was collected as the Triton-resistant fraction (chromatin-bound proteins). The cells were washed twice with Triton extraction buffer and further lysed with NETN buffer (20 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, supplemented with 1 mM NaVO4, 1 mM PMSF, 10 mM NaF, and 1 ng / mL aprotinin). The two parts were used to detect the free form and DNA-bound form of DDB2, respectively.

[0076] Cell survival assay protocol

[0077] MTT assay was used to detect cell survival. Cells (5 × 10 3 ) were treated with various concentrations of the indicated chemotherapy for 48 or 72 hours. The culture medium was then replaced with serum-free medium containing 5X Sigma-Aldrich MTT solution (Merck KGaA, Darmstadt, Germany) and cultured for 2.5 hours. Finally, the cells were lysed with DMSO, and the optical density (OD) at 570 nm was measured using an ELISA analyzer.

[0078] Quantification of cisplatin adducts in nuclear DNA by immunocytological assay

[0079] The effects of lincRNA-p21 and DDB2 on DNA repair were investigated by immunofluorescence staining with an anti-cisplatin-modified DNA antibody to detect cisplatin adducts. After treatment with cisplatin (50 μM) for the indicated times to induce DNA damage, cells were fixed with 4% paraformaldehyde, washed with PBS, and then covered with 1% Triton X-100 for 5 to 7 minutes at room temperature. Cells were then covered with 1% BSA in PBS for one hour at room temperature and stained with an anti-cisplatin-modified DNA antibody (Abcam, plc., Cambridge, UK) for one hour at room temperature in the dark. Subsequently, cells were stained again with a secondary antibody, goat anti-rat IgG H&L (Abcam, plc., Cambridge, UK), at room temperature in the dark for several hours. Finally, cells were mounted with DAPI mounting medium (Thermo Fisher Scientific Inc., Waltham, MA, USA), and the staining was observed using a fluorescence microscope (Leica DMIL LED, Leica Microsystems, Wetzlar, Germany). The signals of cisplatin adducts were quantified using ImageJ software and normalized to the nuclear DAPI signal.

[0080] Macromolecular docking

[0081] A schematic diagram of DDB2 (4E54) was found in the Protein Data Bank (PDB). The 3D structures of the short lincRNAs p21#3, #4, and #9 were predicted and constructed using the RNAcomposer database. These structures were then used in the ZDOCK docking model with DDB2 using BIOVIA Discovery Studio software (RRID: SCR_015651). The docking results were visualized as 3D structures using BIOVIA Discovery Studio and PyMoL software (RRID: SCR_000305).

[0082] Xenograft mouse model

[0083] A breast cancer tumor xenograft mouse model was used to verify the growth effect of lincRNA-p21 through the Tet-On system, as well as the synergistic effect between exoLinc-p21s and exoDox. T-47D breast cancer cells were injected into the mammary fat pad of five-week-old female BALB / c nude mice, and the nude mice had been subcutaneously implanted with 0.7 mg of 60-day release 17β-estradiol particles (Innovative Research of America) 3 days before subcutaneous inoculation. After one month of tumor growth in mice, the inhibitory effect of exoScramble, exoLinc-p21s and combined treatment with exoDox on tumor growth was confirmed. During the treatment period, the activity of the mice was monitored and the survival curves between the four treatment groups were calculated. The tumor diameter was continuously measured with a caliper, and the tumor volume was calculated using the formula: Volume = length × width 2 / 2.

[0084] Statistical analysis

[0085] Differences between two categorical variables were analyzed using the Student's t-test or Welch's two-sample t-test, while differences between more than two categorical variables were analyzed using one-way analysis of variance (ANOVA). Results are presented as mean ± standard deviation, n ≥ 3. P values were calculated using a two-tailed test, and statistically significant differences were defined as p < 0.05. All statistical analyses were performed using SigmaPlot 10.0, GraphPad Prism 8, or SPSS 21 software.

[0086] result

[0087] LincRNA-p21 inhibits ERα / DDB2-associated DNA repair and chemotherapy resistance

[0088] The role of lincRNA-p21 in regulating DDB2-mediated DNA repair and chemotherapy resistance remains unclear. Figure 1A and Figure 1B ), smaller size ( Figure 1B ) and ERα negative ( Figure 1C ) in breast tumors. LincRNA-p21 induced by tetracycline-inducible expression system in ERα-positive T-47D breast cancer cells inhibited tumor growth in xenograft mouse models ( Figure 2A ), revealing its tumor suppressor role in breast cancer. To test the therapeutic response of carboplatin in vitro, the induction of lincRNA-p21 in primary cultured human breast cancer tissues was followed by the late stage ( Figure 2B ), tumor size ( Figure 2C) and ERα-positive status ( Figure 2D These clinical observations suggest that lincRNA-p21 plays a key role in determining chemotherapy sensitivity in breast cancer patients. In fact, the levels of chemotherapy-induced lincRNA-p21 in various cell lines are closely related to the IC values of the corresponding chemotherapeutic agents. 50 Negatively correlated ( Figure 2E Transient overexpression of lincRNA-p21 increased carboplatin-induced apoptosis in ERα-positive T-47D cancer cells ( Figure 2F Conversely, silencing of lincRNA-p21 expression in ERα-negative MDA-MB-231 cancer cells resulted in reduced apoptosis in response to carboplatin ( Figure 2G ) and PARP and apoptosis proteinase 3 cleavage ( Figure 2H Furthermore, silencing lincRNA-p21 also attenuated the effects of tamoxifen ( Figure 2I and Figure 3A ) and ERαshRNA( Figure 2J and Figure 3B ) sensitizes cells to carboplatin-induced apoptosis. Therefore, overexpression of lincRNA-p21 can overcome ERα-related chemotherapy resistance.

[0089] To further demonstrate the inhibitory effect of lincRNA-p21 on DNA repair for chemotherapy sensitization, cisplatin-DNA adducts were examined in an immunocytological assay using an anti-cisplatin-modified DNA antibody. The results showed that silencing lincRNA-p21 by shRNA inhibited the induction of cisplatin-DNA adducts in cisplatin-treated MDA-MB-231 cancer cells ( Figure 4A ), indicating that lincRNA-p21 can increase chemotherapy sensitivity by inhibiting DNA repair function. To confirm that lincRNA-p21 reduces ERα-mediated DNA repair mechanism, the GSE18908 dataset was used to analyze the overall expression profiles of different genes between human ERα-positive and negative breast cancers. In the ERα-related pathway analyzed by KEGG pathway ( Figure 5A ), nucleotide excision repair (NER) and p53 signaling pathways (two key pathways regulating DNA repair and chemotherapy sensitivity) are upregulated in response to ERα expression. The STRING network further revealed that the expression of DDB2 (a known NER target p53 downstream factor) is enriched in ERα-positive breast cancer ( Figure 4B ) and may be involved in the chemosensitivity and DNA repair function regulated by the ERα / lincRNA-p21 axis. In addition, DDB2 levels were statistically higher in ER-positive breast cancer tissues ( Figure 4CMore importantly, Kaplan-Meier plot analysis revealed an association between higher DDB2 expression and worse overall survival in all breast cancer patients ( Figure 4D ), even in patients who received neoadjuvant chemotherapy and had p53 mutation status ( Figure 5B ). In addition, DDB2 is highly expressed in several different cancer types, such as lung cancer (LUSC), liver cancer (LIHC), bile duct cancer (CHOL), colorectal cancer (COAD), head and neck squamous cell carcinoma (HNSC), gastric adenocarcinoma (STAD), and esophageal cancer (ESCA) ( Figure 5C The in vitro induction of DDB2 protein expression by carboplatin in ERα-positive tumor tissues was also significantly higher than that in ERα-negative tumor tissues ( Figure 4E ) and is related to tumor size ( Figure 4F Furthermore, induction of higher lincRNA-p21 but lower DDB2 in breast cancer tumors of patients treated with carboplatin in vitro was associated with better clinical response to adjuvant chemotherapy ( Figure 4G ), suggesting that lincRNA-p21 may negatively regulate DDB2 expression to inhibit NER function associated with chemotherapy sensitivity in breast cancer patients.

[0090] The present disclosure next investigated the involvement of DDB2-dependent NER in ERα-associated chemoresistance. Cisplatin-DNA adducts were induced within 2 hours of treatment in ER-negative / chemosensitive MDA-MB-231 and ER-positive / chemoresistant T-47D cancer cells. These DNA lesions persisted for more than 18 hours in MDA-MB-231 cancer cells but rapidly disappeared in T-47D cancer cells ( Figure 5D Carboplatin ( Figure 4H and Figure 5E ) and doxorubicin ( Figure 5E ) increased the expression of DDB2 in ERα-positive (T-47D and BT-474) breast cancer cell lines, but did not increase the expression of DDB2 in ERα-negative (MDA-MB-231 and SK-BR-3) breast cancer cell lines. DDB2 can recognize and bind to damaged DNA sites in the cell nucleus, serving as an important initiator for further recruitment of other regulatory factors involved in NER, and is subsequently degraded by the proteasome to form a DNA repair complex. Therefore, chemotherapy-induced nuclear translocation ( Figure 6A ) and the chromatin binding activity of DDB2 ( Figure 4I and Figure 6B ) was also found in ERα-positive cancer cell lines, but not in ERα-negative cancer cell lines. In addition, silencing DDB2 expression increased PARP or apoptosis protein 3 cleavage in a dose- and time-dependent manner ( Figure 4J) and sensitize ERα-positive cancer cells to carboplatin and induce apoptosis ( Figure 4K Together, these results indicate that DDB2 is a key NER promoter mediating ERα-associated chemoresistance and can be targeted by lincRNA-p21.

[0091] LincRNA-p21 serves as a scaffold for the Cul-4 E3 conjugase complex for DDB2 proteasomal degradation

[0092] Treatment with carboplatin or doxorubicin increased the expression of lincRNA-p21 in a time-dependent manner in chemotherapy-sensitive MDA-MB-231 cancer cells, but not in chemotherapy-resistant T-47D cancer cells, and negatively correlated with chemotherapy-induced DDB2 mRNA expression ( Figure 7A Carboplatin also increased the nuclear accumulation of lincRNA-p21 in MDA-MB-231 cancer cells, but not in T-47D cancer cells ( Figure 7B ) and was negatively correlated with the nuclear translocation of DDB2 ( Figure 6A Therefore, the present disclosure then investigated whether lincRNA-p21 regulates DDB2 expression and its potential molecular mechanism. Interestingly, DDB2 protein levels were dose-dependently suppressed in T-47D cancer cells by overexpression of lincRNA-p21 ( Figure 8A ) and was enhanced by silencing lincRNA-p21 in MDA-MB-231 cancer cells ( Figure 8B ), but did not affect its mRNA level ( Figure 7C Similarly, lincRNA-p21 induced by the Tet-On control system also inhibited DDB2 protein but not RNA levels ( Figure 7D and Figure 8C ), which means that lincRNA-p21 downregulates DDB2 post-transcriptionally. The proteasome inhibitor MG132 enhances DDB2 expression in MDA-MB-231 cancer cells enriched for lincRNA-p21 ( Figure 7E In the presence of cycloheximide (CHX), overexpression of lincRNA-p21 reduced DDB2 protein stability ( Figure 7F and Figure 8D ), while MG132 can restore DDB2 protein stability ( Figure 8E ), suggesting that lincRNA-p21 is involved in regulating the proteasomal degradation of DDB2. Overexpression of lincRNA-p21 enhances the polyubiquitination of DDB2 in T-47D cancer cells ( Figure 8F). The role of lincRNA-p21 in regulating the complex formation between DDB2, its E3 conjugating enzyme Cul-4, and the adaptor protein DDB1 was then confirmed. In RNA-IP assays, a positive interaction between lincRNA-p21 and DDB2 was observed in ERα-negative but not ERα-positive breast cancer cells. Figure 8G ) and doxorubicin ( Figure 7G ) reflects the physical interaction. Carboplatin ( Figure 8H ) and doxorubicin ( Figure 7G ) also strongly increased the binding of lincRNA-p21 to DDB1, but only modestly increased its binding to Cul-4 in vivo. The interaction of DDB2 with DDB1 and the Cul-4 complex was attenuated in vitro by RNase A treatment ( Figure 7H ) and can silence lincRNA-p21 in vivo to inhibit DDB2 ( Figure 8I ), anti-DDB1 and anti-Cul-4 ( Figure 7I ) immune complexes were destroyed. Next, the in vitro specific interaction of lincRNA-p21 with DDB2, DDB1, and Cul-4 was also verified using RNA pull-down assays with biotinylated oligonucleotides ( Figure 8J Together, these data indicate that lincRNA-p21 directly binds to DDB2 / DDB1 / Cul-4 and serves as a scaffold for E3 complex formation.

[0093] To examine the specific and essential regions of lincRNA-p21 for binding to DDB2, the present disclosure subsequently synthesized different fragments of lincRNA-p21 (S1: exon 1, S2: intron, S3: exon 2) ( Figure 7J ) or deletion fragment (F1-F8) ( Figure 8K ) were used to analyze their binding activity to DDB2. In in vitro RNA pull-down assays, S1 and F3-F8 exhibited stronger binding to DDB2, suggesting that the 526-926 region is required for DDB2 binding activity. In RNA-IP analysis, RNA was pulled down from in vitro digested anti-DDB2 immunoprecipitates with or without RNase A, followed by RT-qPCR using various primer sets to amplify the following: Figure 8K LincRNA-p21 is resistant to RNase A digestion in the P3, P4, P6, P7, and P9 regions, possibly due to protection from DDB2 binding, further revealing the potential DDB2 binding region in in vivo experiments ( Figure 8M Interestingly, the binding regions of lincRNA-p21 to DDB1 and Cul-4 are similar to those of DDB2 ( Figure 7K According to the literature, DDB2 is a transcription factor that has a binding affinity for a specific common sequence on the promoter of its target gene. It is worth noting that this common sequence can be found in the P3, P4, and P9 regions of lincRNA-p21 and folded into secondary structures (P3, P4, and P9), which means that these three sequences are potential binding sites for DDB2 ( Figure 8N These results suggest that two regions of lincRNA-p21 sequences #3, #4, and #9 (527 to 926 and 2099 to 2287) are required for interaction with DDB2.

[0094] Potential short lincRNA-p21 sequences as chemosensitizing DDB2 inhibitors

[0095] To demonstrate the necessity of lincRNA-p21 sequences (P3, P4, and P9) for interaction with DDB2 in vitro, we eliminated Figure 9A and Figure 9C The essential sequences are marked with asterisks. The level of DDB2 protein pulled down by the biotinylated lincRNA-p21 full-length probe was slightly attenuated by the individual deletion of P3, P4, or P9 (Del1, Del 2, or Del 3). Figure 9B ) and is almost destroyed by combined mutations of all three sequences (Del 1+2+3) ( Figure 9D In addition, the synthetic RNA oligonucleotides corresponding to the DDB2 binding sequences (#3, #4, and #9) in lincRNA-p21 showed strong binding activity with recombinant DDB2 protein in a dose-dependent manner, with K D The value in SPR analysis is 10 -9 to 10 -8 M( Figure 9E The synthesized lincRNA-p21 short sequence showed a dose-dependent pattern in vitro and was comparable to the Scramble control group ( Figure 9F ). Next, the present disclosure transiently transfected the lincRNA-p21 short sequence into T-47D cancer cells and detected the delivery efficiency by qRT-PCR analysis ( Figure 9G Compared with Scramble, although single lincRNA-p21 short sequences (single #3, #4 or #9) showed only a small chemosensitization effect ( Figure 10A ), whereas a mixture of three lincRNA-p21 short sequences (#3+#4+#9) (Linc-p21s) enhanced the chemosensitivity of ER-positive / chemoresistant T-47D cancer cells to platinum drugs and doxorubicin in a dose-dependent manner ( Figure 9HFurthermore, the DDB2 targeting effect of Linc-p21s was confirmed by the downregulation of DDB2 protein expression after 24 hours of treatment ( Figure 10B ), while MG132 pretreatment can prevent the above situation from happening ( Figure 9I and Figure 10C ).

[0096] To further explore the potential configurations between these three lincRNA-p21 short sequences and DDB2 in computer simulation (in silico), RNAComposer, which contains six databases including CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold, was used to predict the 3D structure of the lincRNA-p21 short sequence (Linc-p21s). Interestingly, the same structural configuration was predicted by at least four databases (CentroidFold, CONTRAfold, IPknot, and RNAfold). Figure 11A ) and further used it for molecular docking analysis with DDB2 protein (PDB: 4E54). The macromolecular docking was calculated using the ZDOCK docking program, and the potential configurations of lincRNA-p21 short sequences with lower Z rank scores and higher Z docking scores from different prediction databases were screened for binding to DDB2 ( Figure 11B and 12A to 12E ). Then, these potential configurations are divided into different clusters ( Figure 11C ), with different interaction models and presented in similar binding regions. In addition, from the largest cluster with the best Z rank and Z docking score, the most potential configuration was selected to represent the interaction between the lincRNA-p21 short sequence and DDB2 ( Figure 11D and Figures 12F to 12H The interaction sites and distances between the LincRNA-p21 short sequence and DDB2 were also calculated ( Figure 11E In the 3D structure, the core nucleotides of the lincRNA-p21 short sequence (C8, C9, C10, C11, U12, and U13) interact with the most likely involved DDB2 amino acids (Lys-35, Pro-44, Cys-48, Cys-52, and Leu-53) or other amino acids of DDB2 through hydrogen bonds with the Pi-alkyl group ( Figure 11E In the complex structure, all three short lincRNA-p21 sequences are coiled around the N-terminal α-helix of DDB2. This region is crucial and responsible for the interaction with DDB1, which in turn connects to the E3 conjugating enzyme Cul-4 ( Figure 11DIt is quite reasonable that the coiling of the short lincRNA-p21 sequence with DDB2 can stabilize the formation of the DDB2 / DDB1 / Cul-4E3 conjugase complex and enhance DDB2 polyubiquitination and degradation.

[0097] Short lincRNA-p21 sequences packaged with chemotherapy drugs in exosomes show potent chemosensitization

[0098] Based on the development of RNA-based therapeutic strategies, the in vivo delivery efficiency, tumor targeting specificity, and stability of Linc-p21s are crucial for cancer patients. To improve the delivery efficiency of Linc-p21s in the human body, exosomes are used as a delivery system for this therapeutic strategy. Transmission electron microscopy (TEM) analysis showed that there was no difference in size and shape between empty exosomes and exosomes encapsulating lincRNA-p21 ( Figure 13A To verify the function of exosome-encapsulated Linc-p21s (exoLinc-p21s) in DNA repair, a cisplatin-DNA adduct assay was performed, and it was demonstrated that exoLinc-p21s prolonged the existence time of cisplatin-DNA adducts from 3 hours to 24 hours, suggesting that exoLinc-p21s can improve chemotherapy sensitivity by reducing DNA repair ( Figure 13B Western blot analysis confirmed the ability of exoLinc-p21s to inhibit doxorubicin-induced DDB2 expression in exosomes encapsulated or not encapsulated with doxorubicin ( Figure 13C Furthermore, exoLinc-p21s reduced the growth of T-47D breast cancer cells and HepG2 (high DDB2 expression) liver cancer cells in colony formation assays ( Figure 13D and Figure 14A ), and similar to the results of the transient transfection system, exoLinc-p21s containing 1 ng of short Linc-p21s could synergize the cytotoxicity of doxorubicin ( Figure 13E In a xenograft mouse model, Exo-Linc-p21s also enhanced the in vivo anti-tumor activity of doxorubicin ( Figure 13F To enhance the tumor targeting specificity of exoLinc-p21s, anti-HLAG (highly expressed in most tumors) antibodies were engineered onto the surface of exoLinc-p21s to increase tumor specificity. In fact, exoLinc-p21 with anti-HLAG antibodies did have earlier and longer accumulation in terms of uptake efficiency in T-47D cancer cells ( Figure 14BImportantly, exoLinc-p21 engineered with anti-HLAG antibodies exhibited superior cytotoxicity compared to exoLinc-p21s without anti-HLAG antibodies ( Figure 13G ) and had a stronger inhibitory effect on DDB2 protein expression ( Figure 13H ).

[0099] In summary, the data disclosed herein demonstrate that Linc-p21s encapsulated with chemotherapeutic drugs in exosomes (exoLinc-p21s) can effectively target DDB2 protein to inhibit chemotherapy-sensitized DNA repair, which may be a potential novel RNA-based DDB2 inhibitor for enhancing chemotherapy sensitivity in patients with various DDB2-expressing tumors.

[0100] Those skilled in the art will regard the foregoing summary as a description of methods for transmitting escrow application information. Those skilled in the art will recognize that these are illustrative only and that many equivalents are possible.

Claims

1. A composition comprising a sequence of long non-coding RNA-p21, wherein the sequence of the long non-coding RNA-p21 is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO:

3.

2. A composition for preparing a drug for treating cancer, characterized in that: The composition comprises a sequence of long non-coding RNA-p21 and a chemotherapeutic agent, wherein the sequence of long non-coding RNA-p21 is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO:

3.

3. The use according to claim 2, characterized in that The sequence of the long noncoding RNA-p21 enhances the sensitivity of the cancer to the chemotherapeutic agent by inhibiting the expression of DDB2.

4. The use according to claim 2, characterized in that The cancer includes cancers with high expression of DDB2.

5. The use according to claim 2, characterized in that The cancer is poorly responsive or resistant to the chemotherapeutic agent.

6. The use according to claim 2, characterized in that The cancers include breast cancer and liver cancer.

7. The use according to claim 6, characterized in that The breast cancer cells have a p53 mutation.

8. The use according to claim 7, characterized in that The breast cancer cells are estrogen receptor positive and have a p53 mutation.

9. The use according to claim 2, characterized in that The chemotherapeutic agent comprises carboplatin, cisplatin or doxorubicin.

10. The use according to claim 2, characterized in that The composition further comprises a pharmaceutically acceptable carrier.

11. The use according to claim 10, characterized in that The pharmaceutically acceptable carrier includes liposomes, nanoparticles, exosomes, micelles, polymer matrices or gel matrices.

12. The use according to claim 11, characterized in that The sequence of the long non-coding RNA-p21 is contained in the exosomes.

13. The use according to claim 2, characterized in that The composition further comprises a targeting molecule for binding to a biomarker on the cancer cell.

14. The use according to claim 13, characterized in that The targeting molecule comprises an anti-HLAG antibody.

Images