Use of cd73+nk cells in the preparation of a medicament for preventing or treating parkinson's disease

Abstract

The application discloses application of CD73+NK cells in preparation of drugs for preventing or treating Parkinson. The applicant finds in the experiment that CD73 + The NK cells can prevent MPP+-induced dopaminergic neuron loss and glial inflammatory response of VM cells. However, CD73 + TGF-β1 and IL-10 secreted by the NK cells can prevent MPP+-induced dopaminergic neuron loss and glial inflammatory response of VM cells. + The NK cells do not significantly prevent MPP+-induced dopaminergic neuron loss in transwell co-culture with VM neurons. And it is proved that CD73 + The NK cells protect the dopaminergic neurons from MPP+ neurotoxicity through an intercellular contact mechanism, i.e. CD73-SIRPA interaction.

Description

Technical Field

[0001] The present application relates to the technical field of Parkinson's disease, and in particular to the use of CD73+ NK cells in the preparation of drugs for preventing or treating Parkinson's disease. Background Art

[0002] Parkinson's disease (PD) is a common neurodegenerative disorder characterized pathologically by the degeneration of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc) of the brain and the accumulation of misfolded α-synuclein (α-syn), which forms insoluble cytoplasmic inclusions called Lewy bodies (LBs). Peripheral inflammation has been shown to exacerbate DA neuron degeneration in various PD animal models. Extracellular α-syn aggregates may trigger an amplified immune response cycle through excessive production of inflammatory mediators, contributing to the spread of PD-related functional impairments. Therefore, immunomodulation-based approaches to reduce inflammatory responses may be a potential therapeutic approach for PD.

[0003] Natural killer (NK) cells are important immune cells in the body. When peripheral inflammation is high, NK cells are recruited to the central nervous system via chemokines produced by neurons (such as CX3CL1) or CCL2 and CXCL10 produced by microglia, astrocytes, and other cells. Studies in animal models of autoimmune encephalomyelitis (EAE) have shown that NK cells migrate to the mouse brain in a CX3CL1-dependent manner and alleviate inflammation in the early stages of EAE, demonstrating their anti-inflammatory effects. Furthermore, NK cells can inhibit the transactivation of Th17 signature transcription factors by microglia, thereby reducing neuroinflammation.

[0004] NK cells are also present in the brain parenchyma of Parkinson's disease mouse models, but their role in the pathogenesis of Parkinson's disease remains to be studied. There are multiple subpopulations of NK cells that play different roles in the immune response, so they may have different effects on the PD process. Among them, CD73 + NK cells play a complex and critical role in immune regulation, tissue homeostasis and pathological environment. More and more evidence shows that CD73 + NK cells are not only crucial for maintaining immune balance in the periphery, but also promote self-tolerance and immune privilege in the central nervous system. + NK cells can achieve neuroprotection by inhibiting the inflammatory response of microglia. + Whether NK cells can directly act on dopaminergic neurons and play a neuroprotective role in the process of Parkinson's disease needs further exploration. Summary of the Invention

[0005] The present application aims to solve at least one of the technical problems existing in the prior art. To this end, the present application proposes a CD73 + Application of NK cells in the preparation of drugs for preventing or treating Parkinson's disease.

[0006] In the first aspect of the present application, CD73 is provided. + Application of NK cells in the preparation of drugs for preventing or treating Parkinson's disease.

[0007] Among them, NK cells belong to innate immune cells (non-specific immune cells), which are different from adaptive immune cells (such as T cells and B cells) that require pre-sensitization with antigens. NK cells originate from bone marrow NK cells and enter tissues such as peripheral blood, spleen, liver and lymph nodes after differentiation and development.

[0008] CD73 (Cluster of Differentiation 73), also known as Ecto-5'-nucleotidase (NT5E), is a glycosylated transmembrane glycoprotein ubiquitously expressed on the cell surface and belongs to the nucleotidase family. CD73 catalyzes the hydrolysis of extracellular adenosine monophosphate (AMP) into adenosine and inorganic phosphate (Pi), playing specific roles in immune regulation, inflammatory responses, metabolic regulation, and the tumor microenvironment. CD73 is widely expressed in various normal cells and tissues, and can also be found in cells under pathological conditions.

[0009] CD73 + NK cells are a type of NK cell that expresses CD73 molecules on its surface. It is understandable that in addition to CD73, CD73 + NK cells can still express other surface molecules, as well as co-express other activating or inhibitory receptors.

[0010] In some embodiments of the present application, CD73 + NK cells are directly isolated from at least one of the following sources: natural tissue, peripheral blood, cord blood, etc.

[0011] In some embodiments of the present application, CD73 + NK cells are obtained by inducing and culturing other types of cells in vitro.

[0012] In some embodiments of the present application, CD73 + NK cells are obtained by inducing and culturing at least one of the cells from natural tissues, peripheral blood, umbilical cord blood, etc.

[0013] In some embodiments of the present application, the in vitro induction culture conditions include culturing in a cell culture medium.

[0014] In some embodiments of the present application, the cell culture medium includes a basal culture medium and additives.

[0015] In some embodiments of the present application, the additive includes at least one of Motolimod, Resiquimod, Vesatolimod, Pidotimod, Laquinimod, and Tempol. In some embodiments, the concentrations of Motolimod, Resiquimod, Vesatolimod, Pidotimod, Laquinimod, and Tempol are each independently 0.1 to 100 mM, for example, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.8, 1, 2, 3, 4, 5, 6, 8, 10, 20, 30, 40, 50, 60, 80, or 100 mM. In some embodiments, the additive includes at least two, three, four, five, or six of Motolimod, Resiquimod, Vesatolimod, Pidotimod, Laquinimod, and Tempol. In some embodiments, the additive further includes a cytokine. In some embodiments, the cytokine includes an interleukin. In some embodiments, the cytokines include 1 to 1000 ng / mL of interleukins. In some embodiments, the cytokines include at least one, two, three, four, or five of IL-2, IL-12, IL-15, IL-18, and IL-21. In some embodiments, the concentrations of IL-2, IL-12, IL-15, IL-18, and IL-21 are each 1 to 1000 ng / mL, for example, 1, 2, 3, 4, 5, 6, 8, 10, 20, 30, 40, 50, 60, 80, 100, 200, 300, 400, 500, 600, 800, or 1000 ng / mL. In some embodiments, the cytokines include IL-2 1-100 ng / mL, IL-12 1-100 ng / mL, IL-15 1-100 ng / mL, IL-18 1-100 ng / mL, and IL-21 1-100 ng / mL. In some embodiments, the cytokines include IL-2 50 ng / mL, IL-12 10 ng / mL, IL-15 10 ng / mL, IL-18 10 ng / mL, and IL-21 10 ng / mL.

[0016] The concentration here refers to the concentration of the corresponding substance in the cell culture medium during actual culture.

[0017] In some embodiments of the present application, the basal culture medium includes any one of RPMI 1640, DMEM, MEM, F12, DMEM / F-12, L-15 culture medium, etc.

[0018] In some embodiments of the application, the cell culture medium is a serum-containing medium or a serum-free medium.

[0019] In some embodiments of the application, the additives further include at least one of serum, L-glutamine, HEPES, sodium phosphate, amino acids, 2-ME, antibiotics.

[0020] In some embodiments of the application, the serum includes at least one of fetal bovine serum, calf serum, and the like.

[0021] In some embodiments of the application, the antibiotics include at least one of penicillin, streptomycin.

[0022] In some embodiments of the application, the additives further include 1-20% fetal bovine serum, for example, can be 1%, 2%, 3%, 4%, 5%, 6%, 8%, 10%, 15%, 20%.

[0023] In some embodiments of the application, the additives further include 1-10 mM L-glutamine, for example, can be 1, 2, 3, 4, 5, 6, 8, 10 mM L-glutamine.

[0024] In some embodiments of the application, the additives further include 1-100 mM HEPES, for example, can be 1, 2, 3, 4, 5, 6, 8, 10, 20, 30, 40, 50, 60, 80, 100 mM HEPES.

[0025] In some embodiments of the application, the additives further include 1-10 mM sodium phosphate, for example, can be 1, 2, 3, 4, 5, 6, 8, 10 mM sodium phosphate.

[0026] In some embodiments of the application, the additives further include 1-100 nM 2-ME, for example, can be 1, 2, 3, 4, 5, 6, 8, 10, 20, 30, 40, 50, 60, 80, 100 nM 2-ME.

[0027] In some embodiments of the application, the additives further include at least 1, 2, 3, 4, 5, 6, 7, 8 of 10% fetal bovine serum, 2 mM L-glutamine, 25 mM HEPES, 1 mM sodium phosphate, 13 non-essential amino acids, 55 nM 2-ME, 100 U / ml penicillin, and 100 mg / ml streptomycin.

[0028] In some embodiments of the present application, the conditions of in vitro induction culture include culturing in a cell culture medium for 7-30 days, for example, can be 7, 8, 9, 10, 12, 14, 15, 16, 18, 20, 21, 22, 24, 26, 27, 28, 30 days.

[0029] In some embodiments of the present application, the CD73 + The NK cells can also be obtained by gene editing.

[0030] In some embodiments of the present application, the gene editing includes transfecting a gene editing system into the cells.

[0031] Wherein, transfection refers to the process of artificially introducing exogenous nucleic acid molecules into eukaryotic cells.

[0032] In some embodiments of the present application, the gene editing includes transfecting a gene editing system of CD73 into the cells.

[0033] In some embodiments of the present application, transfection can be achieved by physical, chemical, biological and other methods. In some embodiments of the present application, the physical method of transfection includes electroporation, microinjection, gene gun method, sonoporation, etc. In some embodiments of the present application, the chemical method of transfection includes calcium phosphate coprecipitation, liposome method, polymer method, nanocarrier method, etc. In some embodiments of the present application, the biological method of transfection includes viral vector method, at which time the transfection is also called transduction.

[0034] In some embodiments of the present application, the gene editing system of CD73 is transfected by at least one of liposomes, polymers, nanoparticles, viral vectors. In some embodiments of the present application, the liposomes include cationic liposomes, ionizable lipids LNP, polymer-lipid hybrids, liposome-peptide complexes, etc. In some embodiments of the present application, the polymers include linear / branched polyethyleneimine (PEI), polylysine (PLL), dendrimers (such as PAMAM), chitosan derivatives (such as trimethyl chitosan), thermosensitive polymers, etc. In some embodiments of the present application, the nanoparticles include gold nanoparticles, magnetic nanoparticles, mesoporous silica, exosomes / extracellular vesicles, metal-organic framework materials, etc. In some embodiments of the present application, the viral vectors include lentivirus, adenovirus, adeno-associated virus, retrovirus, herpes simplex virus, Newcastle disease virus, etc.

[0035] In some embodiments of the present application, the gene editing system includes a CRISPR gene editing system, such as any one of CRISPR-Cas9, CRISPR-Cas12a, CRISPR-Cas13, etc. In some embodiments of the present application, the composition of the CRISPR gene editing system includes a Cas enzyme and a guide RNA. In some embodiments of the present application, the Cas enzyme includes any one of Cas9, Cas12a, Cas13, etc. In some embodiments of the present application, the Cas enzyme can be a wild-type or mutant enzyme. In some embodiments of the present application, the guide RNA is sgRNA. In some embodiments of the present application, the Cas enzyme can be transfected in the form of a protein or a nucleic acid. It is understandable that when the Cas enzyme is transfected in the form of a nucleic acid, the corresponding enzyme is then generated in the cell.

[0036] In some embodiments of the present application, the NK cells are NK cells derived from mammals (such as monotremes, marsupials, insectivores, shrews, scaphotheres, dermoptera, chiroptera, primates, edentata, phlonotida, lagomorpha, rodents, carnivores, sirenians, hyraxes, tubulodonta, perissodactyla, artiodactyla, cetaceans, etc.), specifically including NK cells from at least one of rodents (such as mice, rats, hamsters, guinea pigs), lagomorphs (such as rabbits), perissodactyla (such as horses), artiodactyla (such as sheep, pigs), primates (such as monkeys, orangutans, gorillas, chimpanzees, humans), and carnivores (such as dogs). It is understandable that when the NK cells are non-human NK cells, their immunogenicity can be reduced by methods well known in the art, such as genetic engineering to knock out major xenoantigens, express human protective proteins, immune isolation (such as microencapsulation), donor / recipient pretreatment (immunosuppression and tolerance induction, such as administering immunosuppressants to subjects, etc.), and any one or more of these methods can be used in combination.

[0037] In some embodiments of the present application, the NK cells are at least one of autologous NK cells, allogeneic NK cells, and xenogeneic NK cells. In some embodiments of the present application, the NK cells are at least one of wild-type NK cells and pretreated NK cells (e.g., genetically engineered, pretreated with small or macromolecules, or physically or chemically treated).

[0038] In some embodiments of the present application, the prevention or treatment acts on ventral midbrain (VM) cells.

[0039] Among them, VM cells refer to cells located in the ventral tegmental area of ​​the midbrain, close to the substantia nigra and red nucleus.

[0040] In some embodiments of the present application, at least one of the loss of dopaminergic neurons acting on ventral midbrain cells and the disorder of glial neurotrophic factor expression is prevented or treated.

[0041] Dopaminergic neurons, a type of neuron that uses dopamine as a neurotransmitter, are characterized by their ability to synthesize, store, and release dopamine, mediating various physiological functions in the central nervous system, such as motor control, reward mechanisms, and mood regulation. Their essence lies in their ability to specifically synthesize and release dopamine. Dopaminergic neurons are primarily distributed in the midbrain, diencephalon, and brainstem. The midbrain-substantia nigra dopaminergic system originates in the substantia nigra pars compacta (SNc) and substantia nigra pars reticulata (SNr). The degeneration and death of SNc dopaminergic neurons is one of the core pathological mechanisms of Parkinson's disease (PD).

[0042] In some embodiments of the present application, dopaminergic neuron loss includes TH + NeuN + Decreased cell number.

[0043] Among them, TH refers to tyrosine hydroxylase, which is the rate-limiting enzyme in dopamine biosynthesis, used to convert the amino acid tyrosine into 3,4-dihydroxyphenylalanine (L-DOPA), which is further converted into dopamine. + It indicates that the cell has the ability to synthesize dopamine and is a specific functional marker of dopaminergic neurons. NeuN refers to Neuronal Nuclei Antigen, a neuron-specific nuclear protein belonging to the Fox-3 protein family, which is mainly expressed in the nuclei of mature neurons. + NeuN + Double positivity is a specific phenotypic marker of dopaminergic neurons.

[0044] In some embodiments of the present application, the glial neurotrophic factor expression disorder includes at least one of the up-regulated expression of pro-inflammatory cytokines and the down-regulated expression of neurotrophic factors.

[0045] Among them, pro-inflammatory cytokines are small proteins or peptides secreted by immune cells (such as macrophages, dendritic cells, T cells, and B cells) or damaged tissue cells (such as endothelial cells and fibroblasts), which can mediate the initiation, amplification, and maintenance of inflammatory responses. Neurotrophic factors are small proteins or peptides secreted by nerve cells, glial cells, or non-neural tissues (such as muscle and target organs) to support the survival, growth, differentiation, synapse formation, and maintenance of neuronal function.

[0046] In some embodiments of the present application, the proinflammatory cytokines include at least one of TNF-α and IL-1β. In some embodiments of the present application, the proinflammatory cytokines also include at least one of IL-6, IL-17, IL-18, IL-23, CXCL8, IFN-γ, etc. In some embodiments of the present application, the proinflammatory cytokines include at least one of TNF-α, IL-1β, IL-6, IL-17, IL-18, IL-23, CXCL8, IFN-γ, etc.

[0047] In some embodiments of the present application, the neurotrophic factor includes at least one of IGF-1 and GDNF. In some embodiments of the present application, the neurotrophic factor also includes at least one of NGF (Nerve Growth Factor), BDNF (Brain-Derived Neurotrophic Factor), NT-3 (Neurotrophin-3), NT-4 / 5 (Neurotrophin-4 / 5), GDNF (Glial Cell Line-Derived Neurotrophic Factor), IGF-1 (Insulin-Like Growth Factor-1), CNTF (Ciliary Neurotrophic Factor), EPO (Erythropoietin), etc. In some embodiments of the present application, the neurotrophic factor includes at least one of IGF-1, GDNF, NGF, BDNF, NT-3, NT-4 / 5, GDNF, IGF-1, CNTF, EPO, etc.

[0048] In some embodiments of the present application, the dopaminergic neuron loss and glial neurotrophic factor expression disorder in the ventral midbrain cells are caused by neurotoxins.

[0049] In some embodiments of the present application, the neurotoxin includes 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) and its metabolites.

[0050] In some embodiments of the present application, the metabolite includes 1-methyl-4-phenylpyridinium ion (MPP+).

[0051] In a second aspect of the present application, a method for reducing dopaminergic neuron loss or glial neurotrophic factor expression disorder in ventral midbrain cells is provided, the method comprising: +NK cell co-culture.

[0052] In some embodiments of the present application, CD73 + NK cells are directly isolated from at least one of the following sources: natural tissue, peripheral blood, cord blood, etc.

[0053] In some embodiments of the present application, CD73 + NK cells are obtained by inducing and culturing other types of cells in vitro.

[0054] In some embodiments of the present application, CD73 + NK cells are obtained by inducing and culturing at least one of the cells from natural tissues, peripheral blood, umbilical cord blood, etc. in vitro.

[0055] In some embodiments of the present application, the conditions for in vitro induction culture include culturing in a cell culture medium.

[0056] In some embodiments of the present application, the cell culture medium includes a basal culture medium and additives.

[0057] In some embodiments of the application, the additive comprises at least one of Motolimod, Resiquimod, Vesatolimod, Pidotimod, Laquinimod, Tempol. In some embodiments, Motolimod, Resiquimod, Vesatolimod, Pidotimod, Laquinimod, Tempol are independently 0.1-100 mM, for example, can be 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.8, 1, 2, 3, 4, 5, 6, 8, 10, 20, 30, 40, 50, 60, 80, 100 mM, respectively. In some embodiments, the additive comprises at least 2, 3, 4, 5, 6 of Motolimod, Resiquimod, Vesatolimod, Pidotimod, Laquinimod, Tempol. In some embodiments, the additive further comprises a cytokine. In some embodiments, the cytokine comprises an interleukin. In some embodiments, the cytokine comprises 1-1000 ng / mL of interleukin. In some embodiments, the cytokine comprises at least 1, 2, 3, 4, 5 of IL-2, IL-12, IL-15, IL-18, IL-21. In some embodiments, the concentration of IL-2, IL-12, IL-15, IL-18, IL-21 is 1-1000 ng / mL, for example, can be 1, 2, 3, 4, 5, 6, 8, 10, 20, 30, 40, 50, 60, 80, 100, 200, 300, 400, 500, 600, 800, 1000 ng / mL, respectively. In some embodiments, the cytokine comprises IL-2 1-100 ng / mL, IL-12 1-100 ng / mL, IL-15 1-100 ng / mL, IL-18 1-100 ng / mL, IL-21 1-100 ng / mL. In some embodiments, the cytokine comprises IL-2 50 ng / mL, IL-12 10 ng / mL, IL-15 10 ng / mL, IL-18 10 ng / mL, IL-21 10 ng / mL.

[0058] In some embodiments of the application, the basal medium comprises any one of RPMI 1640, DMEM, MEM, F12, DMEM / F-12, L-15 medium, etc.

[0059] In some embodiments of the application, the cell culture medium is a serum-containing medium or a serum-free medium.

[0060] In some embodiments of the present application, the additive further includes at least one of serum, L-glutamine, HEPES, sodium phosphate, amino acids, 2-ME, and antibiotics.

[0061] In some embodiments of the present application, the serum includes at least one of fetal bovine serum, calf serum, etc.

[0062] In some embodiments of the present application, the antibiotic includes at least one of penicillin and streptomycin.

[0063] In some embodiments of the present application, the additive further includes 1-20% fetal bovine serum, for example, 1%, 2%, 3%, 4%, 5%, 6%, 8%, 10%, 15%, or 20%.

[0064] In some embodiments of the present application, the additive further comprises 1-10 mM L-glutamine, for example, 1, 2, 3, 4, 5, 6, 8, or 10 mM L-glutamine.

[0065] In some embodiments of the present application, the additive further comprises 1-100 mM HEPES, for example, 1, 2, 3, 4, 5, 6, 8, 10, 20, 30, 40, 50, 60, 80, or 100 mM HEPES.

[0066] In some embodiments of the present application, the additive further comprises 1-10 mM sodium phosphate, for example, 1, 2, 3, 4, 5, 6, 8, or 10 mM sodium phosphate.

[0067] In some embodiments of the present application, the additive further comprises 1 to 100 nM 2-ME, for example, 1, 2, 3, 4, 5, 6, 8, 10, 20, 30, 40, 50, 60, 80, or 100 nM 2-ME.

[0068] In some embodiments of the present application, the additive further comprises at least 1, 2, 3, 4, 5, 6, 7, or 8 of 10% fetal bovine serum, 2 mM L-glutamine, 25 mM HEPES, 1 mM sodium phosphate, 13 non-essential amino acids, 55 nM 2-ME, 100 U / ml penicillin, and 100 mg / ml streptomycin.

[0069] In some embodiments of the present application, the conditions for in vitro induction culture include culturing in cell culture medium for 7 to 30 days, for example, 7, 8, 9, 10, 12, 14, 15, 16, 18, 20, 21, 22, 24, 26, 27, 28, or 30 days.

[0070] In some embodiments of the present application, CD73 +NK cells can also be obtained through gene editing.

[0071] In some embodiments of the present application, gene editing includes transfecting the gene editing system into the interior of the cell.

[0072] In some embodiments of the present application, gene editing comprises transfecting the CD73 gene editing system into the interior of the cell.

[0073] In some embodiments of the present application, transfection can be achieved by a variety of different methods, including physical, chemical, and biological methods. In some embodiments of the present application, physical methods of transfection include electroporation, microinjection, gene guns, sonoporation, etc. In some embodiments of the present application, chemical methods of transfection include calcium phosphate coprecipitation, liposomes, polymers, nanocarriers, etc. In some embodiments of the present application, biological methods of transfection include viral vectors, in which case transfection is also referred to as transduction.

[0074] In some embodiments of the present application, the CD73 gene editing system is transfected via at least one of liposomes, polymers, nanoparticles, and viral vectors. In some embodiments of the present application, liposomes include cationic liposomes, ionizable lipids (LNPs), polymer-lipid hybrids, and liposome-peptide complexes. In some embodiments of the present application, polymers include linear / branched polyethyleneimine (PEI), polylysine (PLL), dendrimers (such as PAMAM), chitosan derivatives (such as trimethyl chitosan), and thermosensitive polymers. In some embodiments of the present application, nanoparticles include gold nanoparticles, magnetic nanoparticles, mesoporous silica, exosomes / extracellular vesicles, and metal-organic frameworks. In some embodiments of the present application, viral vectors include lentiviruses, adenoviruses, adeno-associated viruses, retroviruses, herpes simplex viruses, and Newcastle disease viruses.

[0075] In some embodiments of the present application, the gene editing system includes a CRISPR gene editing system, such as any one of CRISPR-Cas9, CRISPR-Cas12a, CRISPR-Cas13, etc. In some embodiments of the present application, the composition of the CRISPR gene editing system includes a Cas enzyme and a guide RNA. In some embodiments of the present application, the Cas enzyme includes any one of Cas9, Cas12a, Cas13, etc. In some embodiments of the present application, the Cas enzyme can be a wild-type or mutant enzyme. In some embodiments of the present application, the guide RNA is sgRNA. In some embodiments of the present application, the Cas enzyme can be transfected in the form of a protein or a nucleic acid. It is understandable that when the Cas enzyme is transfected in the form of a nucleic acid, the corresponding enzyme is then generated in the cell.

[0076] In some embodiments of the present application, the NK cells are NK cells derived from mammals (such as monotremes, marsupials, insectivores, shrews, scaphotheres, dermoptera, chiroptera, primates, edentata, phlonotida, lagomorpha, rodents, carnivores, sirenians, hyraxes, tubulodonta, perissodactyla, artiodactyla, cetaceans, etc.), specifically including NK cells from at least one of rodents (such as mice, rats, hamsters, guinea pigs), lagomorphs (such as rabbits), perissodactyla (such as horses), artiodactyla (such as sheep, pigs), primates (such as monkeys, orangutans, gorillas, chimpanzees, humans), and carnivores (such as dogs). It is understandable that when the NK cells are non-human NK cells, their immunogenicity can be reduced by methods well known in the art, such as genetic engineering to knock out major xenoantigens, express human protective proteins, immune isolation (such as microencapsulation), donor / recipient pretreatment (immunosuppression and tolerance induction, such as administering immunosuppressants to subjects, etc.), and any one or more of these methods can be used in combination.

[0077] In some embodiments of the present application, the NK cells are at least one of autologous NK cells, allogeneic NK cells, and xenogeneic NK cells. In some embodiments of the present application, the NK cells are at least one of wild-type NK cells and pretreated NK cells (e.g., genetically engineered, pretreated with small or macromolecules, or physically or chemically treated).

[0078] In some embodiments of the present application, dopaminergic neuron loss includes TH + NeuN + Decreased cell number.

[0079] In some embodiments of the present application, the glial neurotrophic factor expression disorder includes at least one of the up-regulated expression of pro-inflammatory cytokines and the down-regulated expression of neurotrophic factors.

[0080] In some embodiments of the present application, the proinflammatory cytokines include at least one of TNF-α and IL-1β. In some embodiments of the present application, the proinflammatory cytokines also include at least one of IL-6, IL-17, IL-18, IL-23, CXCL8, IFN-γ, etc. In some embodiments of the present application, the proinflammatory cytokines include at least one of TNF-α, IL-1β, IL-6, IL-17, IL-18, IL-23, CXCL8, IFN-γ, etc.

[0081] In some embodiments of the present application, the neurotrophic factor includes at least one of IGF-1 and GDNF. In some embodiments of the present application, the neurotrophic factor also includes at least one of NGF, BDNF, NT-3, NT-4 / 5, GDNF, IGF-1, CNTF, EPO, etc. In some embodiments of the present application, the neurotrophic factor includes at least one of IGF-1, GDNF, NGF, BDNF, NT-3, NT-4 / 5, GDNF, IGF-1, CNTF, EPO, etc.

[0082] In some embodiments of the present application, the dopaminergic neuron loss and glial neurotrophic factor expression disorder in the ventral midbrain cells are caused by neurotoxins.

[0083] In some embodiments of the present application, the neurotoxin includes 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) and its metabolites.

[0084] In some embodiments of the present application, the metabolite includes 1-methyl-4-phenylpyridinium ion (MPP+).

[0085] In some embodiments of the present application, NK cells are inoculated in NK cell culture medium. In some embodiments of the present application, NK cell culture medium is serum-containing culture medium or serum-free culture medium. Because serum-containing culture medium has certain immune problems, in some embodiments of the present application, NK cell culture medium is serum-free culture medium.

[0086] In some embodiments of the present application, CD73 + The inoculum size for NK cell co-culture was 1 × 10 3 ~1×10 6 / mL, for example, it can be 1×10 3 / mL, 2×10 3 / mL, 3×10 3 / mL, 4×10 3 / mL, 5×10 3 / mL, 6×10 3 / mL, 7×10 3 / mL, 8×10 3 / mL, 9×10 3 / mL, 1×10 4 / mL, 2×10 4 / mL, 3×10 4 / mL, 4×10 4 / mL, 5×10 4 / mL, 6×10 4 / mL, 7×104 / mL, 8×10 4 / mL, 9×10 4 / mL, 1×10 5 / mL, 2×10 5 / mL, 3×10 5 / mL, 4×10 5 / mL, 5×10 5 / mL, 6×10 5 / mL, 7×10 5 / mL, 8×10 5 / mL, 9×10 5 / mL, 1×10 6 pieces / mL.

[0087] In some embodiments of the present application, the inoculum size of VM cells in co-culture is 1×10 3 ~1×10 6 / mL, for example, it can be 1×10 3 / mL, 2×10 3 / mL, 3×10 3 / mL, 4×10 3 / mL, 5×10 3 / mL, 6×10 3 / mL, 7×10 3 / mL, 8×10 3 / mL, 9×10 3 / mL, 1×10 4 / mL, 2×10 4 / mL, 3×10 4 / mL, 4×10 4 / mL, 5×10 4 / mL, 6×10 4 / mL, 7×10 4 / mL, 8×10 4 / mL, 9×10 4 / mL, 1×10 5 / mL, 2×10 5 / mL, 3×10 5 / mL, 4×10 5 / mL, 5×10 5 / mL, 6×10 5 / mL, 7×10 5 / mL, 8×10 5 / mL, 9×10 5 / mL, 1×10 6 pieces / mL.

[0088] In some embodiments of the present application, the co-cultivation time is 1 hour to 30 days, for example, it can be 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 12 days, 14 days, 15 days, 16 days, 18 days, 20 days, 25 days, or 30 days.

[0089] In some embodiments of the present application, the co-culture temperature is 30-40°C, for example, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, or 40°C.

[0090] In some embodiments of the present application, the co-culture is cultured in a cell culture vessel.

[0091] In some embodiments of the present application, the cell culture container includes a cell culture plate (such as a 4-well, 6-well, 8-well, 12-well, 24-well, 48-well, 96-well, 384-well, or 1536-well culture plate), a cell culture dish (such as a 35 mm, 60 mm, 100 mm, or 150 mm culture dish), a cell culture flask (such as a T25, T75, T175, or T225 culture flask), a cell factory (such as a 1-layer, 2-layer, 3-layer, 4-layer, 5-layer, 10-layer, or 40-layer cell factory), and the like.

[0092] In some embodiments of the present application, the raw material for preparing the cell culture container includes a polymer, such as polystyrene.

[0093] In some embodiments of the present application, during the culture process in the cell culture container, the culture medium is replaced and the cell culture container is subcultured every 1 to 5 days, for example, every 1, 2, 3, 4, or 5 days.

[0094] In some embodiments of the present application, the co-culture is cultured in a cell culture medium.

[0095] In some embodiments of the present application, the cell culture medium comprises a basal culture medium.

[0096] In some embodiments of the present application, the basal culture medium includes any one of RPMI 1640, DMEM, MEM, F12, DMEM / F-12, L-15 culture medium, etc.

[0097] In some embodiments of the present application, the cell culture medium is a serum-containing medium or a serum-free medium.

[0098] According to the embodiments of the present application, at least the following beneficial effects are achieved:

[0099] During the experiment, the applicant found that CD73 + NK cells can prevent the dopaminergic neuronal loss and glial inflammatory response of VM cells induced by MPP+. + NK cells secrete TGF-β1 and IL-10 on CD73 + The transwell co-culture of NK cells and VM neurons did not significantly prevent MPP+-induced dopaminergic neuronal loss. This confirmed that CD73 + NK cells protect dopaminergic neurons from MPP+ neurotoxicity through a cell-cell contact mechanism, namely CD73-SIRPA interaction.

[0100] Additional aspects and advantages of the present application will be given in part in the description below, and in part will become obvious from the description below, or will be learned through practice of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0101] Figure 1 This is the flow cytometry result in Example 1 of the present application.

[0102] Figure 2 is CD73 under different treatment conditions in Example 1 of the present application + Results of the co-culture of NK cells and VM cells. A is a photo of immunofluorescence detection and TH + NeuN + Neuron number and TH - NeuN + Comparison of neuron numbers in different groups, ** is the significance test result between MPP+ group and control group, ## is CD73 + The results of the significance test between the NK+MPP+ group and the MPP+ group; B is the results of PCR detection of different cytokine expressions, ** is the results of the significance test between the MPP+ group and the control group, ## is the CD73 + The results of the significance test between the NK+MPP+ group and the MPP+ group; C is the results of Western blot detection of different cytokine expressions, ** is the results of the significance test between the MPP+ group and the control group, ## is the CD73 + Significance test results between NK+MPP+ group and MPP+ group.

[0103] Figure 3 is CD73 under different treatment conditions in Example 2 of this application + Results of transwell co-culture of NK cells and VM neurons. A shows the expression levels of TGF-β1 and IL-10 in different groups; B shows the photos of immunofluorescence detection and TH + NeuN + Neuron number and TH- NeuN + Comparison of neuron numbers in different groups, ** is the significance test result between the MPP+ group and the control group.

[0104] Figure 4 is the time-lapse video detection result in Example 2 of the present application. Wherein, A is VM neurons marked by SIRPA and CD73 marked by CD73 + NK cells, B is the time-lapse video results of the two labeled cells at different time points.

[0105] Figure 5 The results of the gene silencing experiment in Example 3 of this application are shown in Table 3. + B is the expression level of SIRPA in VM neurons after SIRPA-shRNA lentiviral vector transfection; C is the expression level of CD73 after CD73 silencing + Photographs of immunofluorescence detection of NK cells co-cultured with VM neurons and TH + NeuN + Neuron number and TH - NeuN + Comparison of neuron numbers in different groups; D is CD73 + Immunofluorescence detection of NK cells co-cultured with VM neurons after SIRPA silencing and TH + NeuN + Neuron number and TH - NeuN + Comparison of neuron numbers in different groups.

[0106] All data are presented as mean ± standard deviation, and statistical analysis was performed using SPSS (12.0). Data were analyzed using one-way analysis of variance, followed by the Student-Newman-Keul test to compare differences between groups. Differences were considered statistically significant when p < 0.05. DETAILED DESCRIPTION

[0107] The following will clearly and completely describe the concept and technical effects of this application in conjunction with the embodiments to fully understand the purpose, features and effects of this application. Obviously, the embodiments described are only part of the embodiments of this application, not all of them. Based on the embodiments of this application, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of this application.

[0108] Embodiments of the present application are described in detail below, the embodiments described are exemplary only and are not intended to limit the present application.

[0109] In the description of the present application, the meaning of several is one or more, the meaning of multiple is two or more, greater than, less than, more than, etc. are understood to not include the number, above, below, within, etc. are understood to include the number. If it is described to the first, the second is only for the purpose of distinguishing technical features, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features or the sequence of indicated technical features.

[0110] Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terms used herein are only for the purpose of describing the embodiments of the present application and are not intended to limit the present application.

[0111] In the description of the present application, the description of the terms "one embodiment", "some embodiments", "exemplary embodiment", "example", "specific example" or "some examples" means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present specification, the exemplary description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0112] Example 1: Primary VM cells and CD73 + NK cell co-culture experiment

[0113] 1. Primary VM cell culture

[0114] C57BL / 6J pregnant mice at 13 days ± 0.5 of embryo (E13 ± 0.5) were sacrificed after anesthesia, and the embryos were taken out aseptically. The ventral midbrain (VM) tissue of the embryo was collected, washed with Hank's balanced salt solution (HBSS) at 4 °C, and incubated in 2 mL of preheated 2.5 mg / mL trypsin solution at 37 °C for 12 min. Subsequently, the cells were centrifuged and resuspended in complete DMEM medium containing 10% fetal bovine serum. The cell suspension was seeded at a density of 5 x 10 5 cells / cm 2 in a 24-well plate coated with poly-D-lysine, and incubated in a 37 °C, 5% CO2 incubator. The relatively large primary VM cell cultures at 7 days were collected for subsequent experiments.

[0115] 2. CD73 + Isolation and culture of NK cells

[0116] Cord blood mononuclear cells were isolated and Motolimod 1 mM + Resiquimod 1 mM + Vesatolimod 1 mM + Pidotimod 1 mM + Laquinimod 1 mM + Tempol 1 mM were added to the initial cell suspension. IL-2 50 ng / mL, IL-12 10 ng / mL, IL-15 10 ng / mL, IL-18 10 ng / mL, and IL-21 10 ng / mL were also added. The cells were cultured in complete RPMI 1640 medium at a concentration of 1 × 10 6 Cells were incubated at a density of 100 cells / mL for 21 days in a culture medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 25 mM HEPES, 1 mM sodium phosphate, 13 non-essential amino acids, 55 nM 2-mercaptoethanol (2-ME), 100 U / mL penicillin, and 100 mg / mL streptomycin. Figure 1 The results of flow cytometry showed that CD73 + NK cells.

[0117] Among them, Motolimod (VTX-2337) is a selective and potent Toll-like receptor 8 (TLR8) agonist with an EC50 of 100 nM and CAS number 926927-61-9. Resiquimod (R-848, S28463) is an immune response modifier that acts as a potent TLR7 / TLR8 agonist and can induce upregulation of cytokines such as TNF-α, IL-6, and IFN-α. CAS number 14475-48-9. Vesatolimod (GS-9620) is an orally available Toll-like receptor-7 (TLR-7) agonist with CAS number 1228585-88-3. Pidotimod is a synthetic dipeptide molecule with biological immunological activity against both adaptive and innate immune responses. CAS number 121808-62-6. Laquinimod (ABR-215062, LAQ) is a potent immunomodulator with CAS number 248281-84-7. Tempol (4-Hydroxy-TEMPO) is a superoxide scavenger with neuroprotective, anti-inflammatory, and analgesic effects with CAS number 2226-96-2.

[0118] 3.CD73 + Co-culture of NK cells and VM cells

[0119] The isolated and cultured CD73 +NK cells were washed with DMEM complete medium and then resuspended in DMEM complete medium at a density of 5 × 10 5 cells / mL. Add the culture medium to the collected VM cell culture at a ratio of 1:1. + After NK cells and VM cells were co-cultured for 1 hour, MPP+ was added to the co-culture at a concentration of 5 μM. After incubation for 24 hours, the co-culture was washed at least 3 times with 0.01M PBS to remove CD73. + NK cells.

[0120] 4. Immunocytochemistry

[0121] The VM cell cultures collected in step 1 were used as the control group (Control), the VM cell cultures incubated with MPP+ alone were used as the MPP+ group, and the VM cell cultures co-cultured in step 3 were used as the CD73 + NK+MPP+ group, in step 3, the VM cell culture without MPP+ was CD73 + NK group.

[0122] VM cells were fixed with 4% PFA, washed three times with 10 mM PBS, and incubated for 40 minutes at room temperature in 10 mM PBS containing 10% normal goat serum and 0.3% Triton X-100. VM cells or VM neurons were incubated with primary antibodies, including mouse anti-TH antibodies at a 1:400 dilution and rabbit anti-NeuN antibodies at a 1:200 dilution, for 48 hours at 4°C. Fluorescence detection was performed using goat secondary antibodies conjugated to FITC or Alexa Fluor 594. Images were acquired using a fluorescence microscope at 200× magnification. The sum of the number of TH+NeuN+ neurons in 25 fields per coverslip is reported as the sample statistic, and the mean number of TH‒NeuN+ neurons in five fields per coverslip is reported as the sample statistic.

[0123] The results are as follows Figure 2 As shown in A, MPP+ significantly reduced the TH + NeuN + The number of cells decreases, resulting in the loss of dopaminergic neurons. + NK+MPP+ group through CD73 + NK cell pretreatment can prevent MPP+-induced dopaminergic neuronal loss. + VM cells in the NK group were exposed to CD73 alone + NK cells without MPP+ treatment did not significantly change TH + NeuN+ Cell number. In addition, MPP+, CD73 + NK cells combined with MPP+ or CD73 alone + NK cell therapy for TH - NeuN + There was no significant effect on cell number.

[0124] 5. RNA Isolation and Real-time PCR Detection

[0125] Total RNA was extracted from cells in each group in step 4 using TRIzol reagent and converted to cDNA using a cDNA reverse transcription kit. Real-time quantitative PCR was performed on a Rotor-Gene 3000 real-time cycler using SYBR Green I as the detection system.

[0126] The primer sequences used for real-time quantitative PCR are as follows:

[0127] TNF-α Primers:

[0128] CATCTTCTCAAAATTCGAGTGACAA (SEQ ID NO. 1);

[0129] TGGGAGTAGACAAGGTACAACCC (SEQ ID NO. 2);

[0130] IL-1β Primers:

[0131] CCAGGGCATGTTAAGGAGCT (SEQ ID NO.3);

[0132] CCATCAGAGGCAAGGAGGAA (SEQ ID NO. 4);

[0133] GDNF Primers:

[0134] GGGACGCTTGGTGGTTGAT (SEQ ID NO.5);

[0135] ATGAGAATGCTGCCGAAAA (SEQ ID NO.6);

[0136] IGF-1 Primer:

[0137] AAAAGCAGCCCGCTCTATC (SEQ ID NO.7);

[0138] TTCCGAGTTGCCTCCGTTA (SEQ ID NO.8);

[0139] Internal reference GAPDH primer:

[0140] CAACAATCTCCACTTTGCCACTG (SEQ ID NO.9);

[0141] AAATGGTGAAGGTCGGTGAAC (SEQ ID NO. 10).

[0142] The results are as follows Figure 2 As shown in Figure B, MPP+ upregulated the expression of TNF-α and IL-1β at the mRNA level, but downregulated the expression of IGF-1 and GDNF, while CD73 + NK+MPP+ group through CD73 + NK cell pretreatment can prevent the expression of proinflammatory cytokines and neurotrophic factors caused by MPP+. + VM cells in the NK group were exposed to CD73 alone + Treatment of NK cells without MPP+ did not significantly alter the expression of TNF-α, IL-1β, IGF-1, or GDNF.

[0143] 6. Western blot analysis

[0144] Proteins were extracted using lysis buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS, 4% β-mercaptoethanol, 10% glycerol, 50 mM DTT, and 1 mM benzylsulfonamide) as described in steps 4 and 5. Protein samples (30 μg per lane) were separated by 12% SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The membrane was probed with antibodies against TNF-α, IL-1β, and GDNF, and a monoclonal anti-β-actin antibody was used as an internal standard to monitor loading errors. Blots were developed using an IRDye 800-conjugated secondary antibody using an Odyssey laser scanning system. The band intensity of each protein in the control and treated groups was measured using NIH Image J software and expressed relative to β-actin.

[0145] The results are as follows Figure 2 As shown in Figure C, MPP+ upregulated the expression of TNF-α and IL-1β at the mRNA and protein levels, but downregulated the expression of IGF-1 and GDNF, while CD73 + NK+MPP+ group through CD73 + NK cell pretreatment can prevent the expression of proinflammatory cytokines and neurotrophic factors caused by MPP+. + VM cells in the NK group were exposed to CD73 alone +NK cells without MPP+ treatment did not significantly change TNF-a, IL-1 b, IGF-1 or GDNF expression.

[0146] Example 2: Primary VM neurons with CD73 + NK cell transwell co-culture experiment

[0147] 1. Primary VM neuron culture

[0148] C57BL / 6J pregnant mice at embryonic day 13 ± 0.5 (E13 ± 0.5) were sacrificed after anesthesia, and the embryos were aseptically removed. The ventral midbrain (VM) tissue of the embryos was collected, washed with Hank's Balanced Salt Solution (HBSS) at 4 °C, and incubated in 2 mL of preheated 2.5 mg / mL trypsin solution at 37 °C for 12 min. Subsequently, the cells were centrifuged and resuspended in complete DMEM medium containing 10% fetal bovine serum. The cell suspension was seeded at a density of 5 x 10 5 cells / cm 2 on poly-D-lysine-coated 24-well plates and incubated in a 37 °C, 5% CO2 incubator for 7 days, with cytosine arabinoside (10 μΜ) added 24 h after seeding. The primary VM neuron cultures, which contained >90% NeuN-immunoreactive neurons, were collected for subsequent experiments.

[0149] 2. CD73 + NK cell co-culture with VM neurons

[0150] CD73 + NK cells were isolated according to the procedure of Step 2 of Reference Example 1, washed with DMEM complete medium, and then resuspended in DMEM complete medium at a density of 5 x 10 5 cells / mL, transferred to the Transwell cell culture chamber, and placed in the 24-well plate containing the VM neuron cultures. The ratio of CD73 + NK cells to VM neurons was 1:1, and after 1 h of co-culture, the VM neurons in the lower 24-well plate were treated with MPP+ at a concentration of 5 μΜ. After 24 h of incubation, the Transwell chamber was removed, and the supernatant and VM neurons in the lower 24-well plate were collected.

[0151] 3. Enzyme-linked immunosorbent assay (ELISA) quantification

[0152] The VM neuron cultures collected in Step 1 were used as the control group (Control), the VM neuron cultures incubated with MPP+ alone were used as the MPP+ group, and the VM neuron cultures treated with co-culture were used as the CD73 + NK + MPP+ group.

[0153] TGF-β1 and IL-10 levels in the collected supernatants were assessed using ELISA kits according to the manufacturer's instructions. This involved adding 50 μL of supernatant to an ELISA plate and incubating at room temperature for 2 hours. After washing, 100 μL of the corresponding HRP-conjugated IgG polyclonal antibody was added to each well and incubated for an additional 2 hours. After incubation with 100 μL of substrate solution for 30 minutes at room temperature in the dark, 100 μL of stop solution was added, and the optical density was measured at 450 nm using a multimode microplate reader. A standard curve was constructed based on the average absorbance of each standard sample, and cytokine levels were calculated based on this standard curve.

[0154] The results are as follows Figure 3 As shown in A, in the absence of CD73 + In the case of NK cell treatment, TGF-β1 and IL-10 were not detected in the supernatant of the lower VM neuron culture in the control group or MPP+ treatment alone. + When NK cells were co-cultured with VM neurons via a transwell system, the levels of TGF-β1 and IL-10 in the supernatant of the lower VM neuron culture treated with MPP+ were significantly increased. + The NK cell transwell cell culture chamber was placed in the VM neuron culture plate, which allowed the CD73 + NK cells cannot act directly on neurons, but can only affect neurons by infiltrating into the underlying neuronal culture through the cytokines secreted by the cells.

[0155] 4. Immunocytochemistry

[0156] Immunocytochemistry was performed according to the method of Example 1. Figure 3 As shown in B, the + Compared with NK cell transwell treatment, MPP+-induced loss of TH+NeuN+ cells in the lower VM neuron culture was not due to CD73 + The results of transwell treatment with NK cells showed significant improvement (p=0.057). + There was no significant change in the number of NK cells after transwell co-culture compared with the untreated control group. + NK cells were not able to significantly prevent MPP+-induced dopaminergic neuron loss in transwell co-culture.

[0157] 5. Time-lapse video microscopy

[0158] CD73 +NK cells were incubated with anti-CD73 antibodies (1:100), while VM neurons were incubated with anti-SIRPA antibodies in PBS containing 1% bovine serum albumin at 37°C for 1 hour, followed by incubation with the corresponding Alexa Fluor-conjugated secondary antibodies. After staining, SIRP-labeled VM neurons and CD73-labeled CD73+ NK cells were transferred to a co-culture chamber filled with 1.5 mL of complete DMEM medium and co-cultured as described in Step 2. The co-culture chamber was placed under a microscope connected to a digital camera and an incubator. Images were captured every 20 seconds at 200× magnification for up to 6 hours using automated software.

[0159] The results are as follows Figure 4 As shown in A and B, it can be seen from A that in VM neurons and CD73 + In NK cell co-culture, CD73 is expressed by CD73 + NK cells express SIRPA, while VM neurons express SIRPA. In B, the live cell imaging system captured CD73 labeled CD73. + Dynamic contacts between NK cells and SIRPA-labeled VM neurons. Thus, CD73 and SIRPA mediate the + Direct contact between NK cells and neurons is speculated to be achieved through the interaction between two transmembrane proteins CD73 and SIRPA. + NK cells protect neurons by contact.

[0160] Example 3: Gene silencing experiment

[0161] 1. Construction and transfection of CD73-miRNA expression vector

[0162] The CD73-miRNA expression vector was constructed and transfected into CD73 cells using nuclear transfection technology. + The transfection steps followed the instructions of the Mouse T Cell Nucleofection Kit. Briefly, after incubation with anti-CD3 and anti-CD28 for 48 hours, CD73 + NK cells were resuspended in 100 μL of T cell nucleofection solution. 4 μg of plasmid was added to 100 μL of 5×10 6 CD73 + NK cell suspension. The mixture was then transferred to an electroporation cuvette and placed in a nucleofection apparatus. After nucleofection of these cells using program X-001, the samples were immediately transferred to a 24-well plate containing 2 mL of prewarmed culture medium. Interference efficiency was assessed by Western blot analysis 48 hours after transfection.

[0163] Among them, the sequence of the CD73-miRNA expression vector targeting CD73 is as follows:

[0164] TGCTGTCAACTTCCACTTCACAAACAGTTTTGGCCACTGACTGACTGTTTGTGGTGGAAGTTGA (SEQ ID NO.11),

[0165] CCTGTCAACTTCCACCACAAACAGTCAGTCAGTGGCCAAAACTGTTTGTGAAGTGGAAGTTGAC (SEQ ID NO. 12).

[0166] The sequences of the mismatched oligonucleotides (Scr-miRNA) used as controls are as follows:

[0167] tgcTGAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT (SEQ ID NO.13),

[0168] cctgAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTc (SEQ ID NO. 14).

[0169] The results are as follows Figure 5 As shown in Figure A, CD73 expression was downregulated in CD73+ NK cells transfected with CD73-miRNA compared with the control miRNA.

[0170] 2. Construction and transfection of lentiviral vector expressing SIRPA-shRNA

[0171] shRNA targeting mouse SIRPA (GenBank accession number NM_001177646) and a scrambled sense shRNA (Scr-shRNA) used as a control were designed. The sequences are as follows:

[0172] SIRPA-shRNA: GTTCAAAGATGGGCAAGAA (SEQ ID NO. 15);

[0173] Scr-shRNA:TTCTCCGAACGTGTCACGT (SEQ ID NO. 16).

[0174] Lentiviral vectors expressing SIRPA-shRNA and Scr-shRNA were generated by a biotechnology company. Recombinant lentivirus was used at 8×10 8 VM neurons were transfected at a titer of 10 infectious units / mL and a multiplicity of infection of 10. Transfection efficiency was assessed by the expression level of SIRPA in cells 72 h after transfection.

[0175] The results are as follows Figure 5 As shown in B, SIRPA expression was downregulated in VM neurons transfected with SIRPA-shRNA compared with control shRNA.

[0176] 3. Refer to Example 2 for VM neurons and CD73 + NK cell co-culture experiment and immunocytochemistry detection were performed, and the results were as follows Figure 5 As shown in C and D, MPP+ reduced TH in VM neuronal cultures. + NeuN + Cell number, and CD73 + NK cells prevented MPP+-induced TH + NeuN + Cell loss. + Silencing the CD73 gene in NK cells reduces CD73 + NK cells play a protective role against MPP+ neurotoxicity. In addition, CD73 + NK cells cannot prevent MPP+-induced TH + NeuN + In contrast, TH in VM neuron cultures - NeuN + The number of cells did not change with MPP+, CD73 + NK cells or gene interference can cause significant changes. + NK cell contact protection of neurons depends on the CD73-SIRPA interaction.

[0177] The present application has been described in detail above with reference to the embodiments. However, the present application is not limited to the above embodiments. Various modifications can be made within the scope of knowledge possessed by a person of ordinary skill in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features of the embodiments can be combined with each other unless there is a conflict.

Claims

1. CD73 + Application of NK cells in the preparation of drugs for preventing Parkinson's disease.

2. The use according to claim 1, characterized in that The Parkinson's disease includes loss of dopaminergic neurons in the ventral midbrain and disorder of glial neurotrophic factor expression.

3. The use according to claim 2, characterized in that The dopaminergic neuron loss includes TH + NeuN + Decreased cell number.

4. The use according to claim 2, characterized in that The glial neurotrophic factor expression disorder includes at least one of the up-regulated expression of pro-inflammatory cytokines and the down-regulated expression of neurotrophic factors.

5. The use according to claim 4, characterized in that The proinflammatory cytokine includes at least one of TNF-α and IL-1β, and the neurotrophic factor includes at least one of IGF-1 and GDNF.

6. The use according to claim 2, characterized in that The dopaminergic neuron loss and glial neurotrophic factor expression disorder in the ventral midbrain cells are caused by neurotoxins.

7. The use according to claim 6, characterized in that The neurotoxin includes 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine or 1-methyl-4-phenylpyridinium ion.

Images