S-SNACs (at) TPZ (at) Cas-A nano-particle, preparation method thereof and application of nano-particle in synergistic anti-tumor

Abstract

The invention belongs to the field of biological medicine, and relates to S-SNACs (at) TPZ (at) Cas-A nano-particles, a preparation method thereof and application of the S-SNACs (at) TPZ (at) Cas-A nano-particles in synergistic tumor resistance. According to the invention, an S-SNACs (at) TPZ (at) Cas-A cascade response nano platform is constructed, and a synergistic anti-tumor strategy of gene editing and hypoxia targeted therapy is realized. The S-SNACs (at) TPZ (at) Cas-A accurately releases Cas9-RNP and TPZ under the action of GSH and NTR, AMFR is successfully knocked out, FAM134B ubiquitination is inhibited, endoplasmic reticulum autophagy is blocked, the proliferation and migration capabilities of tumor cells are remarkably weakened, and the oxidative stress level is enhanced. In-vivo experiments show that the nano-system effectively inhibits tumor growth, reduces lung metastasis, improves immune microenvironment by enhancing infiltration of CD8 + T cells and dendritic cells, and shows good biological safety at the same time.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to the preparation and application of an anti-tumor drug. Background Art

[0002] Gene-editing technologies such as the CRISPR-Cas system have demonstrated tremendous potential in cancer treatment in recent years. CRISPR-Cas9 can precisely edit specific genes, knocking out genes associated with tumor development and progression, potentially fundamentally inhibiting tumor cell growth and metastasis. For example, some studies have successfully used CRISPR-Cas9 to knock out oncogenes in tumor cells, significantly suppressing their proliferation.

[0003] Tumor tissue often harbors a hypoxic microenvironment, a unique environment that fosters tumor growth, metastasis, and the development of drug resistance. Consequently, hypoxia-targeted therapy has become an important area of cancer treatment. Tirapazamine (TPZ) is a typical hypoxia-targeted drug that, under hypoxic conditions, is activated by nitroreductase (NTR), producing cytotoxic substances that specifically kill tumor cells in this hypoxic environment.

[0004] Nanoparticles offer numerous advantages as drug and gene delivery vehicles. They can improve drug stability and bioavailability, enabling targeted drug delivery. For example, some nanoparticles can be enriched in tumor tissues through passive targeting (EPR effect) or active targeting (modification with specific ligands), reducing toxic side effects on normal tissues. Application Publication No. CN112843254A discloses a method for precisely knocking out the Hsp90α gene and conducting hypothermia therapy by combining Cas9 / sgRNA with p-carboxyazobenzene-modified AuNRs. Furthermore, nanoparticles can enable the co-delivery of multiple drugs and genes, opening up the potential for combined tumor therapy. Summary of the Invention

[0005] The present invention proposes a S-SNACs@TPZ@Cas-A nanoparticle, a preparation method thereof, and an application in synergistic anti-tumor treatment. An integrated diagnosis and treatment cascade response nanoplatform (S-SNACs@TPZ@Cas-A) is developed. Through CRISPR-Cas9 targeted knockout of AMFR and release of the hypoxia-activated drug TPZ, the hypoxia adaptability of osteosarcoma is reversed, oxidative stress is enhanced, and the anti-tumor immunotherapy effect is improved.

[0006] The technical solution of the present invention is achieved as follows: TPZ was first encapsulated in silica nanoparticles (Si-NH2, SN) and Ag2S nanoparticles were adsorbed on their surface to enable near-infrared (NIR-II) imaging. Subsequently, the SN pores were blocked with azo-containing 4-PA, and the entire nanomaterial surface was further coated with β-cyclodextrin (β-CD) to form SNACs. CRISPR-Cas9 (Cas-AMFR) was anchored to the SNACs surface using the coupling effect of 4-PA. The entire nanomaterial was then capped with β-CD to ensure the stability of drug and gene tools. Finally, β-CD molecules were cross-linked with disulfide (SS) to construct a GSH-responsive "switch" on the outer layer of the nanomaterial. In the presence of high glutathione (GSH), the disulfide bonds were broken, enabling pore opening and controlled drug / gene release, resulting in the construction of a multifunctional nanoplatform (S-SNACs@TPZ@Cas-A).

[0007] Specifically, the preparation steps of S-SNACs@TPZ@Cas-A nanoparticles are as follows: (1) The pH of the CTAB aqueous solution was adjusted to alkaline, and then TEOS and APTES were added. After stirring, the reaction was centrifuged, washed, and dried to obtain MSN-NH2. The MSN-NH2 solution was then mixed with TPZ, stirred, incubated, and centrifuged to obtain TPZ-loaded mesoporous silica nanoparticles, which were recorded as SNs@TPZ. (2) The SNs@TPZ solution was mixed with the Ag2S quantum dot solution, and then ultrasonically dispersed and transferred to MES-NHS buffer. EDC·HCl and NHS were then added. After stirring at room temperature, the mixture was centrifuged, washed, and dried to obtain Ag2S-modified TPZ-loaded mesoporous silica nanoparticles, which were designated as Ag2S-SNs@TPZ. (3) 4-PA was added to the mixed solution of EDC and NHS, the pH was adjusted to acidic, and the mixture was stirred at room temperature to obtain a 4-PA solution. The 4-PA solution was added dropwise to the Ag2S-SNs@TPZ prepared in step (2), and the reaction was stirred to obtain SNAs@TPZ with closed pores, which was recorded as SNACs@TPZ. (4) The Cas9 protein was incubated with the sgRNA (SEQ ID No. 1) in Tris-HCl buffer to form an RNP complex solution. The RNP complex solution was then added dropwise to a 0.1-2 mg / mL SNACs@TPZ solution and incubated at 4°C overnight to obtain S-SNACs@TPZ@Cas-A nanoparticles.

[0008] In the above step (1), 2 mL of TEOS and 0.5 mL of APTES were added to each g of CTAB; the mass ratio of MSN-NH2 to TPZ in the MSN-NH2 solution was 1:0.05-0.2; and the concentration of the MSN-NH2 solution was 0.1-1 mg / mL.

[0009] The mass ratio of SNs@TPZ, Ag2S quantum dots, EDC·HCl and NHS in the above step (2) is 1:0.05:0.05:0.05.

[0010] In the above step (3), the concentration of 4-PA in the 4-PA solution is 1-5 mM; the volume ratio of EDC and NHS is 1:1; and the mass ratio of 4-PA to Ag2S-SNs@TPZ is 1:0.1-0.5.

[0011] In the above step (4), the molar ratio of Cas9 protein to sgRNA is 1:1-1.5; the molar ratio of RNP complex to SNACs@TPZ is 1:0.1-0.5.

[0012] S-SNACs@TPZ@Cas-A nanoparticles were prepared using the above method.

[0013] The loading amount of RNP complex on the above-mentioned S-SNACs@TPZ@Cas-A nanoparticles was 0.02-2 mg / mL.

[0014] Application of the above-mentioned S-SNACs@TPZ@Cas-A nanoparticles in the preparation of anti-tumor drugs.

[0015] The above-mentioned anti-tumor drugs are based on a synergistic strategy of gene editing and hypoxia targeted therapy.

[0016] The present invention has the following beneficial effects: 1. The present invention constructs a S-SNACs@TPZ@Cas-A cascade response nanoplatform to achieve a synergistic anti-tumor strategy of gene editing and hypoxia targeted therapy. S-SNACs@TPZ@Cas-A precisely releases Cas9-RNP and TPZ under the action of GSH and NTR, successfully knocking out AMFR, inhibiting FAM134B ubiquitination, blocking endoplasmic reticulum autophagy, and significantly weakening the proliferation and migration ability of tumor cells, and enhancing oxidative stress levels. In vivo experiments showed that the nanosystem effectively inhibited tumor growth, reduced lung metastasis, and improved the immune microenvironment by enhancing CD8+ T cell and dendritic cell infiltration, while exhibiting good biosafety ( Figure 10 ).

[0017] 2. This invention elucidates for the first time the role of the AMFR-FAM134B axis in hypoxia adaptation in osteosarcoma and develops an intelligent gene editing + hypoxia-targeted cascade nanosystem to achieve precise delivery of CRISPR-Cas9 and highly effective inhibition of tumor growth. S-SNACs@TPZ@Cas-A exhibits excellent tumor suppression and immunomodulatory effects by regulating hypoxia adaptability, endoplasmic reticulum autophagy, and immune escape, overcoming challenges such as the low efficiency of traditional CRISPR delivery and strong hypoxia tolerance. At the same time, the NIR II imaging capability of this nanosystem further enhances its potential for integrated clinical diagnosis and treatment, providing a new strategy for the precision treatment of osteosarcoma and potentially extending it to other hypoxia-adaptive malignancies. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 Preparation and characterization of S-SNACs@TPZ@Cas-A; (A) Schematic diagram of the construction of S-SNACs@TPZ@Cas-A; (B) TEM images of SNACs@TPZ, SNACs@Cas-A, SNACs@TPZ@Cas-A and S-SNACs@TPZ@Cas-A (bar=50 nm); (C) Statistics of nanoparticle size; (D) Zeta potential statistics; (E) FTIR spectra of SNACs@TPZ, SNACs@Cas-A, SNACs@TPZ@Cas-A and S-SNACs@TPZ@Cas-A; (F) UV-visible absorption spectra of SNACs, SNACs@TPZ, SNACs@Cas-A, SNACs@TPZ@Cas-A and S-SNACs@TPZ@Cas-A; (G) Thermogravimetric analysis.

[0020] Figure 2Figure 3 Structural and physicochemical characterization of the S-SNACs@TPZ@Cas-A multifunctional nanoplatform; A: TEM observation of the morphology and particle size of nanoparticles SNACs (bar = 50 nm); BD: Nitrogen adsorption-desorption isotherm (BET) analysis of the pore structure and specific surface area of the nanoparticles; E: High-magnification TEM and elemental mapping detection of the distribution of silver (Ag), silicon (Si), nitrogen (N), and sulfur (S) elements in the nanoparticles (bar = 100 nm); All data are expressed as mean ± standard error, and the experiments were repeated 3 times; Statistical analysis was performed using ANOVA and Tukey's multiple comparison test, ** indicates P < 0.01, *** indicates P < 0.001.

[0021] Figure 3 Figure 4: Analysis of the cascade release performance and biological effects of S-SNACs@TPZ@Cas-A nanoparticles. A: Schematic diagram illustrating the cascade release mechanism of S-SNACs@TPZ@Cas-A under GSH and hypoxia conditions. B: TEM and DLS analysis of the particle size changes of S-SNACs@TPZ@Cas-A under GSH and normoxia conditions (bar = 50 nm). C: SDS-PAGE analysis of the Cas9 RNP loading efficiency of S-SNACs@TPZ@Cas-A. D: Western blot analysis of AMFR expression in osteosarcoma cells to assess gene knockout efficacy. E: Fluorescence microscopy observation of the distribution of FITC-labeled Cas9-AMFR in cells (bar = 50 μm). F: HPLC analysis of the TPZ release rate of S-SNACs@TPZ@Cas-A under different conditions. G: DLS analysis of the in vitro stability of S-SNACs@TPZ@Cas-A nanoparticles over 7 days. All experiments were repeated three times.

[0022] Figure 4Figure 2: Evaluation of the NIR II imaging performance of S-SNACs@TPZ@Cas-A nanoparticles. A: NIR II fluorescence spectroscopy was used to examine the optical properties of S-SNACs@TPZ@Cas-A nanoparticles. B: NIR II fluorescence imaging was used to observe the fluorescence signal changes of S-SNACs@TPZ@Cas-A at mouse tumor sites in vivo. C: Fluorescence intensity quantification was used to evaluate the imaging performance of S-SNACs@TPZ@Cas-A at different time points. D: Ex vivo NIR II imaging was used to observe the distribution of S-SNACs@TPZ@Cas-A in major organs. E: Fluorescence intensity analysis was used to quantify the fluorescence signal of S-SNACs@TPZ@Cas-A in different organs. All data are expressed as mean ± standard deviation (SD). Experiments were performed in triplicate with six mice per group. Statistical analysis was performed using ANOVA with Tukey's post hoc test. ** indicates P < 0.01, and **** indicates P < 0.0001.

[0023] Figure 5 Figure 3. Detection of tumor fluorescence signals of three nanoparticles, SNACs@TPZ, SNACs@Cas-A, and SNACs@TPZ@Cas-A. A: NIR II fluorescence imaging was used to observe the changes in fluorescence signals of SNACs@TPZ, SNACs@Cas-A, and SNACs@TPZ@Cas-A at tumor sites in mice. B: Fluorescence intensity quantification analysis was used to evaluate the imaging effect of SNACs@TPZ at different time points. C: Fluorescence intensity quantification analysis was used to evaluate the imaging effect of SNACs@Cas-A at different time points. D: Fluorescence intensity quantification analysis was used to evaluate the imaging effect of SNACs@TPZ@Cas-A at different time points. All data are expressed as mean ± standard deviation (SD). The experiments were repeated three times with 6 mice in each group. Statistical analysis was performed by ANOVA and Tukey's post hoc test. ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001.

[0024] Figure 6Figure 3 shows the delivery efficiency of S-SNACs@TPZ@Cas-A under hypoxic conditions and its effect on FAM134B-mediated endoplasmic reticulum autophagy; A: Confocal laser scanning microscopy was used to detect the distribution of FITC-labeled Cas9 in osteosarcoma cells to evaluate the delivery efficiency of S-SNACs@TPZ@Cas-A under hypoxic conditions (bar=25 μm); B: Co-IP experiment was used to detect the ubiquitination level of FAM134B to analyze the regulatory effect of S-SNACs@TPZ@Cas-A on FAM134B ubiquitination; C: Co-IP experiment was used to detect the binding ability of FAM134B to LC3 to evaluate the effect of S-SNACs@TPZ@Cas-A on FAM134B-mediated endoplasmic reticulum autophagy; D: Immunofluorescence co-localization detection of FAM134B and LC3 co-localization signals verified the inhibitory effect of S-SNACs@TPZ@Cas-A on endoplasmic reticulum autophagy (bar=50 μm); E: Western blot Blot analysis of the LC3-II / I ratio and P62 protein levels assessed changes in ER autophagy flux. F: ER autophagy activity was detected using the mRFP-GFP-LC3 fluorescent reporter system (bar = 10 μm). All data are presented as mean ± standard deviation (SD). Experiments were repeated three times. Statistical analysis was performed using ANOVA with Tukey's post hoc test. ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001.

[0025] Figure 7 Figure 2: Effects of S-SNACs@TPZ@Cas-A on osteosarcoma cell proliferation and apoptosis under hypoxic conditions. A: EdU staining to assess cell proliferation activity (bar = 50 μm); B: Live / dead cell staining to assess cell status (bar = 100 μm); C: Flow cytometry to assess cell apoptosis. All data are expressed as mean ± standard deviation (SD). Experiments were performed in triplicate and statistically analyzed by ANOVA with Tukey's post hoc test. * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001.

[0026] Figure 8Evaluation of the anti-tumor effect of S-SNACs@TPZ@Cas-A in a nude mouse 143B osteosarcoma subcutaneous xenograft tumor model; A: Experimental design flowchart showing the construction of an osteosarcoma tumor-bearing model by inoculating 143B cells into the flanks of nude mice and the grouping strategy for each treatment group; B: Tumor growth curve, evaluating the inhibitory effect of different treatment groups on tumor growth by measuring tumor volume; C: Tumor appearance diagram, showing the changes in the appearance of subcutaneous tumors in mice in each treatment group, evaluating the anti-tumor effect of S-SNACs@TPZ@Cas-A; D: Tumor weight statistics, analyzing the changes in tumor weight in different treatment groups; E: Mouse body weight changes; F: H&E staining, detecting morphological changes in tumor tissue (bar=200 μm); G: TUNEL staining, evaluating the level of cell apoptosis in tumor tissue (bar=50 μm). All data are expressed as mean ± standard deviation (SD). The experiments were repeated three times with 6 mice in each group. Statistical analysis was performed by ANOVA and Tukey's post hoc test. * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001.

[0027] Figure 9 Figure 1: Biosafety assessment of the S-SNACs@TPZ@Cas-A nanomaterial. A: Analysis of major organ weights. Changes in heart, liver, spleen, lung, and kidney weights were measured in healthy Balb / c mice after treatment with PBS and S-SNACs@TPZ@Cas-A to assess potential effects of the nanomaterial on these organs. B: Analysis of hematological parameters. The effects of S-SNACs@TPZ@Cas-A on the systemic circulatory system of mice were assessed by measuring white blood cell counts, red blood cell counts, and hemoglobin levels. C: Assessment of liver and kidney function-related biomarkers, including alanine aminotransferase, aspartate aminotransferase, creatinine, and urea, was performed to assess potential liver and kidney toxicity. D: H&E staining was performed to analyze the histomorphology of the heart, liver, spleen, lung, and kidney (bar = 200 μm). All data are expressed as mean ± standard deviation (SD). Six mice were included in each group. Statistical analysis was performed using ANOVA with Tukey's post hoc test. "ns" indicates no significant difference between the two groups.

[0028] Figure 10Evaluation of the anti-tumor effect of the S-SNACs@TPZ@Cas-A nanosystem in the orthotopic K7M2-luc osteosarcoma mouse model; A: Schematic diagram of the experimental design, showing the construction of an orthotopic osteosarcoma model and treatment process by inoculating K7M2-luc cells into the tibia of Balb / c mice; B: In vivo fluorescence imaging to detect tumor growth in mice at different time points (7 days, 12 days, 17 days, and 21 days); C: Tumor appearance observation to detect tumor changes in mice in different treatment groups; D: Tumor weight measurement to evaluate the tumor growth inhibition of mice in each group; E: Histopathology and immunohistochemistry analysis, including H&E staining to detect tumor tissue morphology changes, Ki67 immunohistochemistry to detect tumor cell proliferation levels, and AMFR immunohistochemistry to detect AMFR expression in tumor tissue (bar=200 μm); F: Flow cytometry to detect the infiltration ratio of CD8+ T cells in tumor tissue; G: Flow cytometry to detect the CD4+ T cell infiltration ratio; H: Flow cytometry analysis of the infiltration ratio of dendritic cells (DCs) in tumor tissue; I: H&E staining of lung tissue to detect lung metastasis in nude mice in each group (bar = 800 μm). All data are expressed as mean ± standard deviation (SD), with 6 mice per group. Statistical analysis was performed by ANOVA with Tukey's post hoc test. * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001.

[0029] Figure 11 Schematic diagram of the molecular mechanism by which the integrated diagnosis and treatment cascade response nanoplatform reverses endoplasmic reticulum autophagy-mediated osteosarcoma hypoxic oxidative stress resistance by inhibiting AMFR-mediated FAM134B ubiquitination, thereby enhancing immunotherapy. DETAILED DESCRIPTION

[0030] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0031] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0032] Statistical analysis of the efficacy experiments in this application was performed using GraphPad Prism 9.5 software, and data are presented as mean ± standard deviation (SD). All measurements were based on at least three independent experiments. Multiple group comparisons were performed using one-way analysis of variance (ANOVA) followed by a Tukey post hoc test, and comparisons between two groups were performed using a Student's t-test. Statistical significance was defined as p < 0.05, p < 0.01, and *p < 0.001.

[0033] The preparation steps of S-SNACs@TPZ@Cas-A nanoparticles are as follows: (1) The pH of the CTAB aqueous solution was adjusted to alkaline, and then TEOS and APTES were added. After stirring, the reaction was centrifuged, washed, and dried to obtain MSN-NH2. The MSN-NH2 solution was then mixed with TPZ, stirred, incubated, and centrifuged to obtain TPZ-loaded mesoporous silica nanoparticles, which were recorded as SNs@TPZ. (2) The SNs@TPZ solution was mixed with the Ag2S quantum dot solution, and then ultrasonically dispersed and transferred to MES-NHS buffer. EDC·HCl and NHS were then added. After stirring at room temperature, the mixture was centrifuged, washed, and dried to obtain Ag2S-modified TPZ-loaded mesoporous silica nanoparticles, which were designated as Ag2S-SNs@TPZ. (3) 4-PA was added to the mixed solution of EDC and NHS, the pH was adjusted to acidic, and the mixture was stirred at room temperature to obtain a 4-PA solution. The 4-PA solution was added dropwise to the Ag2S-SNs@TPZ prepared in step (2), and the reaction was stirred to obtain SNAs@TPZ with closed pores, which was recorded as SNACs@TPZ. (4) The Cas9 protein was incubated with the sgRNA (SEQ ID No. 1) in Tris-HCl buffer to form an RNP complex solution. The RNP complex solution was then added dropwise to a 0.1-2 mg / mL SNACs@TPZ solution and incubated at 4°C overnight to obtain S-SNACs@TPZ@Cas-A nanoparticles.

[0034] Furthermore, 2 mL of TEOS and 0.5 mL of APTES are added to each g of CTAB in the above step (1); the mass ratio of MSN-NH2 to TPZ in the MSN-NH2 solution is 1:0.05-0.2, for example, the mass ratio of MSN-NH2 to TPZ can be any one of 1:0.05-0.1, 1:0.1-0.2, 1:0.05, 1:0.1, 1:0.15, and 1:0.2; the concentration of the MSN-NH2 solution is 0.1-1 mg / mL, and can also be any one of 0.1-0.5 mg / mL, 0.5-1 mg / mL, 0.3 mg / mL, 0.5 mg / mL, 0.8 mg / mL, and 1 mg / mL.

[0035] In the above step (2), the mass ratio of SNs@TPZ, Ag2S quantum dots, EDC·HCl and NHS is 1:0.05:0.05:0.05.

[0036] In the above step (3), the concentration of 4-PA in the 4-PA solution is 1-5 mM; the volume ratio of EDC and NHS is 1:1; the mass ratio of 4-PA to Ag2S-SNs@TPZ is 1:0.1-0.5, and can also be any one of 1:0.1-0.3, 1:0.3-0.5, 1:0.1, 1:0.3, and 1:0.5.

[0037] In the above step (4), the molar ratio of Cas9 protein to sgRNA is 1:1-1.5; the molar ratio of RNP complex to SNACs@TPZ is 1:0.1-0.5, and can also be any one of 1:0.1-0.3, 1:0.3-0.5, 1:0.1, 1:0.3, and 1:0.5.

[0038] Specifically, this application uses the following method to conduct experiments: Example

[0039] The preparation method of S-SNACs@TPZ@Cas-A nanoparticles in this embodiment is as follows Figure 1 As shown in A, the steps are: (1) Synthesis of near-infrared mesoporous silica nanoparticles First, amino-modified mesoporous silica nanoparticles (MSN-NH2) were synthesized via a hydrothermal method. 0.1 g of hexadecyltrimethylammonium bromide (CTAB, #H6269, Sigma-Aldrich, USA) was dissolved in 50 mL of deionized water. Ammonia (#QC1593, Sigma-Aldrich, USA) was added to adjust the pH to 10. Then, 0.2 mL of tetraethyl orthosilicate (TEOS, #131903, Sigma-Aldrich, USA) and 0.05 mL of 3-aminopropyltriethoxysilane (APTES, #A3648, Sigma-Aldrich, USA) were slowly added. The mixture was reacted at 40°C with magnetic stirring for 12 h. After the reaction, the mixture was centrifuged (5000 rpm, 10 min, 5810R centrifuge, Eppendorf, Germany), washed three times with deionized water and then with anhydrous ethanol (#E7023, Sigma-Aldrich, USA), and dried in vacuo for 12 hours to obtain MSN-NH2 powder. Based on the MSN-NH2 solution, 5 mL of MSN-NH2 solution was mixed with TPZ (#T8844, MedChemExpress, USA) to load TPZ into the mesoporous structure. The mixture was stirred and incubated for 12 hours, followed by centrifugation (5000 rpm, 10 min) to collect the TPZ-loaded mesoporous silica nanoparticles (SNs@TPZ).

[0040] Next, 5 mL of the SNs@TPZ solution was mixed with 5 mL of the Ag2S quantum dot solution and ultrasonically dispersed (VCX 750 sonicator, Sonics, USA) for 30 minutes. The mixture was then transferred to MES-NHS buffer (#M3671, Sigma-Aldrich, USA, pH = 6.5). Subsequently, 0.1 g of EDC·HCl (#03449, Sigma-Aldrich, USA) and 0.05 g of NHS (#130672, Sigma-Aldrich, USA) were added, and the mixture was stirred at room temperature for 12 hours to promote the coupling of Ag2S to the nanoparticle surface. After the reaction was complete, the product was collected by centrifugation (5000 rpm, 10 min), washed three times with deionized water, and dried under vacuum to obtain Ag2S-modified TPZ-loaded mesoporous silica nanoparticles (i.e., Ag2S-SNs@TPZ).

[0041] (2) Surface functionalization and modification To seal the pores of SNs@TPZ, 4-benzoylamine (4-PA, #131730, Sigma-Aldrich, USA) was first added to a mixed solution of EDC (#03450, Sigma-Aldrich, USA) and NHS (#130672, Sigma-Aldrich, USA). The pH was adjusted to 6.0 and the mixture was stirred at room temperature for 30 minutes. Then, a 2 mM 4-PA solution was added dropwise to the SNs@TPZ system (i.e., Ag2S-SNs@TPZ solution) to achieve a 4-PA:Ag2S-SNs@TPZ mass ratio of 1:0.5. Stirring was continued for 12 hours to form the pore-sealed SNAs@TPZ. To construct a controlled release system, the CRISPR-Cas9 ribonucleoprotein complex (RNP) was anchored to the SNACs@TPZ surface using the coupling effect of 4-PA. 1 nmol of Cas9 protein (160 μg) (#1081058, IDT, USA) and 1.5 nmol of sgRNA (30 μg) (GCAGGTACTGGGCCACATCGCGG, 1:3, IDT, USA) were incubated in Tris-HCl buffer (pH = 7.4) for 10 minutes to form an RNP complex. The complex was then slowly added dropwise to the SNACs-Azo nanoparticles and incubated overnight at 4°C. The RNP was stably immobilized on the nanoparticle surface through electrostatic adsorption or covalent coupling. To achieve hypoxia-responsive microenvironment and glutathione (GSH) release, the S-SNACs@TPZ@Cas-A nanoparticles constructed a GSH-responsive "switch" on the nanomaterial's outer layer by cross-linking β-CD with disulfide (SS).

[0042] Material characterization: The morphology and size distribution of the nanoparticles were observed using transmission electron microscopy (TEM, JEM-2100Plus, JEOL, Japan) and scanning electron microscopy (SEM, Gemini 460, Zeiss, Germany), and particle size statistics were analyzed using ImageJ software. Elemental mapping using scanning transmission electron microscopy (STEM) combined with energy-dispersive X-ray spectroscopy (EDS, Zeiss, Germany) was used to analyze the spatial distribution of elements on the particle surface and assess the uniformity of the modified layer.

[0043] Transmission electron microscopy (TEM) showed that SNACs were uniform spherical particles with a diameter of approximately 80 nm ( Figure 2A). TEM further revealed that SNACs@TPZ, SNACs@Cas-A, SNACs@TPZ@Cas-A, and S-SNACs@TPZ@Cas-A all maintained a spherical morphology. Before disulfide cross-linking, these particles had some burr-like structures on their surfaces. In S-SNACs@TPZ@Cas-A, disulfide cross-linking further smoothed and stabilized the surface structure, making the particles more compact ( Figure 1 B).

[0044] Thermogravimetric analysis (TGA) of the samples was performed using a TG 309 Libra® Classic thermogravimetric analyzer (Netzsch, Germany) in a nitrogen atmosphere (nitrogen flow rate of 50 mL / min). The heating range was from room temperature to 800°C at a heating rate of 10°C / min. The TG curves of the sample mass versus temperature were recorded, and the mass loss ratio and decomposition temperature were calculated to evaluate the thermal stability of the sample.

[0045] Nitrogen adsorption-desorption isotherms ( Figure 2 B) shows that both SNACs and S-SNACs@TPZ@Cas-A particles exhibit typical type IV isotherm characteristics, indicating that the materials have a mesoporous structure. Compared with SNACs, the adsorption capacity of S-SNACs@TPZ@Cas-A is significantly reduced, indicating that the loading of drugs TPZ and Cas-AMFR and the disulfide cross-linking and blocking effectively reduce the specific surface area of the pores ( Figure 2 C), and the pore size of S-SNACs@TPZ@Cas-A particles was significantly reduced ( Figure 2 D), indicating that the multifunctional nanoplatform successfully achieved pore closure, which facilitated the stable encapsulation of drugs and GSH-responsive release.

[0046] Nitrogen adsorption-desorption characterization was performed using an ASAP 2460 Surface Area and Pore Size Analyzer (Mike Instruments, USA, https: / / mic.cnpowder.com.cn / ). Samples were pretreated by vacuum drying at 120°C for 12 hours, and the nitrogen adsorption test temperature was 77 K. Adsorption-desorption isotherms were recorded, and specific surface area (BET method), total pore volume, and pore size distribution (BJH method) were calculated. The distribution of micropores (<2 nm), mesopores (2-50 nm), and macropores (>50 nm) was analyzed, providing basic data for material performance research. Zeta potential analysis ( Figure 1 D) showed that the Zeta potential of all nanoparticles remained above +20 mV, indicating that the nanoparticles had strong surface charge and good dispersion stability in aqueous solution. In addition, FTIR spectroscopy analysis ( Figure 1E) shows that S-SNACs@TPZ@Cas-A simultaneously exhibits characteristic absorption peaks of -N=N- (TPZ), -CO-NH2 (Cas-AMFR) and -SS- (disulfide bond), verifying the successful realization of multifunctional modification of TPZ loading, Cas-AMFR coupling and disulfide bond cross-linking. High-magnification TEM and elemental mapping showed significant signals of silver, silicon, nitrogen and sulfur elements in each group of nanomaterials. The increase in sulfur content further confirmed that the disulfide bond modification in S-SNACs@TPZ@Cas-A ( Figure 2 E). UV-Vis absorption spectroscopy results also showed the step-by-step loading of TPZ and Cas-AMFR ( Figure 1 F). Thermogravimetric analysis (TGA) ( Figure 1 G) Results show that within the 200-400°C range, the mass losses of SNACs@TPZ and SNACs@Cas-A were higher than those of SNACs, indicating successful loading of TPZ and Cas9. SNACs@TPZ@Cas-A further increased the mass loss, while S-SNACs@TPZ@Cas-A exhibited the highest thermal weight loss due to disulfide crosslinking, demonstrating the effectiveness of drug loading and surface modification.

[0047] Implementation Example 1: In vitro stability assessment of nanoparticles To evaluate the stability of S-SNACs@TPZ@Cas-A nanoparticles in different physiological environments, they were suspended in PBS (pH 7.4, Gibco, USA), Dulbecco's Modified Eagle's Medium (DMEM, Gibco, USA), and DMEM supplemented with 10% fetal bovine serum (FBS, Gibco, USA) to a final nanoparticle concentration of 1 mg / mL. The samples were incubated at 37°C in a ThermoFisher, USA, and collected daily for 7 days. The nanoparticle size was measured using dynamic light scattering (DLS, Malvern ZetasizerNano ZS, Malvern Panalytical, UK) to assess size changes.

[0048] DLS results showed that the average hydrodynamic particle size of S-SNACs@TPZ@Cas-A was 102.34±0.35nm, slightly larger than that of SNACs@Cas-A and SNACs@TPZ ( Figure 1 C).

[0049] Implementation effect example 2: load and release control To investigate the controlled release properties of TPZ from the nanoparticles, the environmentally responsive dissociation behavior of the nanomaterial's outer layer and the release kinetics of TPZ were evaluated. Experiments were conducted in three groups: GSH (10 mM GSH, #G4251, Sigma-Aldrich, USA), NTR (10 μg / mL NTR, #N9284, Sigma-Aldrich, USA), and GSH + NTR (10 mM GSH + 10 μg / mL NTR). S-SNACs@TPZ@Cas-A were dispersed in PBS and incubated at 37°C in a shaking incubator (100 rpm). Samples were collected periodically and centrifuged (12,000 rpm, 10 min). The supernatant was then collected to measure the amount of TPZ released. TPZ concentration was determined using an ultraviolet spectrophotometer (λ = 470 nm, UV-2600i, Shimadzu, Japan). Cumulative release percentage versus time was plotted, and the release rate constant was calculated to characterize the controlled release properties of TPZ from the nanocarriers.

[0050] To investigate the release and cellular uptake of Cas9-AMFR from S-SNACs@TPZ@Cas-A nanoparticles under different microenvironmental conditions, Cas9-AMFR was first labeled with FITC. FITC-labeled Cas9-AMFR was then loaded onto the surface of the S-SNACs@TPZ@Cas-A nanoparticles and incubated overnight at 4°C to form a stable complex. Cells were seeded onto sterile glass slides and cultured to 50–70% confluence. Cells were then cultured under normoxic and hypoxic conditions for 24 hours and treated with 10 mM GSH for 4 hours. Cells were then washed three times with PBS and fixed with 4% paraformaldehyde for 15 minutes. Following fixation, the cells were washed three times with PBS and then three times with PBS. The membranes were permeabilized with 0.1% Triton X-100 for 10 minutes and blocked with 1% BSA in PBS for 30 minutes. Next, Phalloidin-iFluor 594 (ab176757, 1:1000, Abcam, UK) was added to label F-Actin and incubated at room temperature in the dark for 1 hour. Subsequently, the sections were washed three times with PBS and stained for nuclei with DAPI (#8961, 1:1000, Cell Signaling, USA) for 10 minutes. After mounting, the release and cellular uptake of Cas9-AMFR were observed using a fluorescence microscope (Zeiss, Germany).

[0051] The S-SNACs@TPZ@Cas-A nanosystem achieves a synergistic protective effect through a cascade release mechanism of "tumor microenvironment response + intracellular hypoxia triggering". In the reducing microenvironment of tumor tissue, high concentrations of glutathione (GSH) induce the cleavage of disulfide bonds in the nanoparticles, first achieving the rapid release of Cas9-AMFR. The released Cas9-AMFR can be taken up by tumor cells and transported into the cell nucleus for targeted regulation of related gene expression. Subsequently, the residual TPZ-loaded nanoparticles are taken up by tumor cells and, under the persistent hypoxic environment in the cell, activate endogenous nitroreductase (NTR), specifically recognize and cleave the azo group linked to 4-PA, and further release the hypoxia-activated anti-tumor drug teniprazine (TPZ), thereby inducing a cytotoxic reaction, effectively improving the tumor hypoxic microenvironment and enhancing the therapeutic effect ( Figure 3 A).

[0052] To investigate the release and cellular uptake of Cas9-AMFR from S-SNACs@TPZ@Cas-A nanoparticles under different microenvironmental conditions, Cas9-AMFR was first labeled with FITC. FITC-labeled Cas9-AMFR was then loaded onto the surface of the S-SNACs@TPZ@Cas-A nanoparticles and incubated overnight at 4°C to form a stable complex. Cells were seeded onto sterile glass slides and cultured to 50–70% confluence. Cells were then cultured under normoxic and hypoxic conditions for 24 hours and treated with 10 mM GSH for 4 hours. Cells were then washed three times with PBS and fixed with 4% paraformaldehyde for 15 minutes. Following fixation, the cells were washed three times with PBS and then three times with PBS. The membranes were permeabilized with 0.1% Triton X-100 for 10 minutes and blocked with 1% BSA in PBS for 30 minutes. Next, Phalloidin-iFluor594 (ab176757, 1:1000, Abcam, UK) was added to label F-Actin and incubated at room temperature in the dark for 1 hour. Subsequently, the sections were washed three times with PBS and stained with DAPI (#8961, 1:1000, Cell Signaling, USA) for 10 minutes. After sealing, the release and cellular uptake of Cas9-AMFR were observed using a fluorescence microscope (Zeiss, Germany). In the experiment, when the nanoparticles were treated with GSH, the disulfide bonds between β-CD and disulfide were effectively broken, resulting in significant dissociation of the nanoparticles ( Figure 3 B).

[0053] To evaluate the Cas9 RNP loading capacity of S-SNACs@TPZ@Cas-A nanoparticles, different concentrations of S-SNACs@TPZ@Cas-A nanoparticles (0, 0.02, 0.05, 0.2, 0.6, 1, and 2 mg / mL) were prepared. Protein samples were denatured (95°C, 5 min) with 5× SDS-PAGE sample buffer (#NP0007, Thermo Fisher Scientific, USA), electrophoresed on 10% SDS-PAGE gels (#4561036, Bio-Rad, USA) (120 V, 60 min), and stained with Coomassie Brilliant Blue R-250 (#20278, Sigma-Aldrich, USA). After destaining, the Cas9 RNP loading efficiency of S-SNACs@TPZ@Cas-A was analyzed using the Bio-Rad ChemiDoc XRS+ imaging system. SDS-PAGE analysis further confirmed that S-SNACs@TPZ@Cas-A could effectively load Cas9 RNP with increasing concentration ( Figure 3 C).

[0054] The effect of S-SNACs@TPZ@Cas-A on AMFR gene knockout was verified in an osteosarcoma cell model. The results showed that after GSH and hypoxia treatment, the expression of AMFR in S-SNACs@TPZ@Cas-A-treated cells was significantly reduced, while there was no significant change under normoxic conditions ( Figure 3 D). In addition, FITC was used to label Cas9-AMFR, and fluorescence microscopy results showed that under hypoxia and GSH treatment conditions, Cas9-AMFR was successfully released and entered the cell ( Figure 3 E).

[0055] When further analyzing the release efficiency of TPZ, it was found that the addition of GSH or NTR alone was not enough to effectively trigger the release of TPZ. Only when GSH and NTR were present at the same time could the two molecular locks of "disulfide bond cleavage" and "azo bond cleavage" be cracked in sequence to achieve efficient release of TPZ ( Figure 3 F), which fully demonstrates the high sensitivity of the nanosystem to the hypoxic microenvironment. In addition, the nanoparticles maintained good stability in vitro for 7 days ( Figure 3 G).

[0056] In summary, S-SNACs@TPZ@Cas-A achieved efficient gene editing and drug synergistic therapeutic effects in a hypoxic microenvironment through GSH-induced Cas9-AMFR release and NTR-mediated selective release of TPZ.

[0057] Implementation Example 3: S-SNACs@TPZ@Cas-A exhibits NIR II optical properties and biomedical imaging potential To evaluate the biodistribution and tumor-targeting ability of S-SNACs@TPZ@Cas-A nanoparticles, near-infrared II (NIR II) fluorescence imaging experiments were performed in a mouse model. BALB / c nude mice were randomly divided into groups and injected with S-SNACs@TPZ@Cas-A via the tail vein. Whole-body fluorescence signals were recorded using an NIR II fluorescence imaging system (NIRvana 640, Teledyne Princeton Instruments, USA) at 0.5, 4, 12, and 24 hours after injection. During imaging, NIR II fluorescence signals were collected using an 808 nm laser (power density 0.3 W / cm²) with a 1000-1700 nm longpass filter. Fluorescence intensity was quantified using ImageJ (v1.53c, NIH, USA) software to measure regional fluorescence intensity.

[0058] To further analyze the distribution of S-SNACs@TPZ@Cas-A in major organs and tumor tissues, mice were euthanized 24 hours after nanoparticle injection, and the heart, liver, spleen, lung, kidney, tumor, muscle, bone, intestine, and brain tissues were quickly dissected. Fluorescence distribution in these tissues was recorded using a NIR II fluorescence imaging system. Fluorescence signals from all tissues were imaged using the same laser power and exposure time to ensure data comparability.

[0059] Due to the addition of Ag2S, S-SNACs@TPZ@Cas-A has a significant NIR II emission spectrum ( Figure 4 A), a comprehensive analysis of the performance of S-SNACs@TPZ@Cas-A nanoparticles in NIR II imaging was conducted. In a mouse model, NIR II fluorescence imaging technology was used to observe that S-SNACs@TPZ@Cas-A showed a gradually increasing fluorescence signal at the tumor site at different time points after injection (0.5h, 4h, 12h, 24h), reaching the highest intensity at 24h ( Figure 4 B). Fluorescence intensity quantification analysis showed that the fluorescence intensity of S-SNACs@TPZ@Cas-A at 24h was significantly higher than that at 0.5h, 4h, and 12h ( Figure 4 C). In addition, to further compare the tumor targeting imaging capabilities of different nanoparticles, the tumor fluorescence signals of three nanoparticles, SNACs@TPZ, SNACs@Cas-A, and SNACs@TPZ@Cas-A, were detected (Appendix Figure 5AD). The results showed that the tumor fluorescence intensity of these three nanoparticles was lower than that of S-SNACs@TPZ@Cas-A. It is speculated that this may be because the introduction of SS bonds makes the nanoparticle structure more compact, thereby improving the local tumor aggregation and drug release efficiency. In the in vitro organ imaging experiment, S-SNACs@TPZ@Cas-A showed strong NIR II fluorescence signals in the liver, spleen, kidney and tumor tissues, while the fluorescence signals in the heart, muscle, bone, intestine and brain were weaker ( Figure 4 DE). In summary, S-SNACs@TPZ@Cas-A exhibited excellent tumor targeting and signal enhancement effects via NIRII imaging.

[0060] Implementation Example 4: S-SNACs@TPZ@Cas-A inhibits FAM134B ubiquitination, blocks endoplasmic reticulum autophagy, and effectively inhibits osteosarcoma progression The live / dead status of cells was assessed using the Live / Dead™ Cell Imaging Kit (R37601, ThermoFisher Scientific, USA). Before the experiment, cells were cultured to an appropriate density according to the experimental design. Before staining, the culture medium was removed and the cells were washed twice with PBS. Subsequently, the working solution was prepared according to the kit instructions, in which Calcein AM (2 µM) was used to label live cells and Ethidium homodimer-1 (EthD-1, 4 µM) was used to label dead cells. The working solution was added to the culture dish or well plate and incubated in the dark at room temperature for 30 min. After incubation, the cells were gently washed once with PBS and then observed and images were collected under a laser confocal microscope (Zeiss, Germany). Live cells stained with Calcein AM showed green fluorescence, while dead cells stained with EthD-1 showed red fluorescence. Cell proliferation was assayed using the Click-iT™ Plus EdU Alexa Fluor™ 594 Imaging Kit (C10639, Thermo Fisher Scientific, USA). Prior to the experiment, cells were seeded on slides or in 6-well plates and cultured to the desired density under appropriate conditions. For EdU labeling, 10 µM EdU was added to the culture medium and incubated for 2 h to allow for sufficient EdU incorporation into the proliferating cells. Subsequently, cells were washed twice with PBS and fixed in 4% paraformaldehyde (PFA) for 15 min at room temperature. Following fixation, the membrane was permeabilized with 0.5% Triton X-100 for 10 min to increase the permeability of the Click-iT™ reaction system. The Click-iT™ reaction working solution was prepared according to the kit instructions and incubated at room temperature in the dark for 30 min to allow the fluorescent probe to specifically bind to the EdU-incorporated DNA. Following staining, cells were washed three times with PBS. Finally, DAPI (1:1000, #8961, Cell Signaling) was added to stain the nuclei and incubated in the dark for 10 min. After staining, the cells were washed with PBS and observed and images were collected under a laser confocal microscope (Zeiss, Germany). EdU-positive cells showed red fluorescence (Alexa Fluor™ 594), and DAPI-stained cell nuclei showed blue fluorescence.

[0061] To evaluate the delivery efficiency of S-SNACs@TPZ@Cas-A, FITC-labeled Cas9 was used and its distribution in osteosarcoma cells was analyzed by CLSM. The results showed that in the H+S-SNACs@TPZ@Cas-A group, the FITC signal was significantly enhanced and mainly distributed in the cytoplasm, while there was no signal under normoxic conditions, indicating that the material has a higher delivery efficiency in a hypoxic environment ( Figure 6 A). Further detection of the ubiquitination level of FAM134B, Co-IP experiments (immunoprecipitation experiments using Co-IP kit (P2179S, Beyotime, China)) showed that FAM134B ubiquitination was significantly increased under hypoxic conditions, while the ubiquitination level of FAM134B was significantly reduced after S-SNACs@TPZ@Cas-A treatment ( Figure 6 B). At the same time, the binding ability of FAM134B to LC3 was significantly enhanced under hypoxic conditions, while it was significantly weakened after S-SNACs@TPZ@Cas-A treatment, suggesting that it blocked FAM134B-mediated endoplasmic reticulum autophagy by inhibiting its ubiquitination ( Figure 6 C). Immunofluorescence co-localization experiments further verified this result, and the co-localization signal of FAM134B and LC3 in the H+S-SNACs@TPZ@Cas-A group was significantly reduced ( Figure 6 D). When detecting the endoplasmic reticulum autophagy flux, Western blot showed that hypoxia significantly increased the LC3-II / I ratio and decreased the P62 level, while S-SNACs@TPZ@Cas-A treatment reversed this change ( Figure 6 E). The results of the mRFP-GFP-LC3 fluorescence reporter system showed that the number of red and yellow fluorescent spots in the H+S-SNACs@TPZ@Cas-A group was significantly reduced, further indicating that the material significantly inhibited endoplasmic reticulum autophagy under hypoxic conditions ( Figure 6 F).

[0062] In functional experiments, H represents: In hypoxia (low oxygen microenvironment) experiments, a tumor hypoxia model (O2 concentration <1%) is constructed through physical / chemical methods (such as hypoxic incubator or CoCl2 simulation).

[0063] S stands for: S-SNACs@TPZ@Cas-A nanoparticles; that is, a GSH-responsive multifunctional nanoplatform loaded with TPZ drug and CRISPR-Cas9 (targeting the AMFR gene).

[0064] H+S: treatment with S-SNACs@TPZ@Cas-A under hypoxic conditions; The dosage was 50–200 μg / mL (based on the mass of SNACs@TPZ). EdU detection results showed that S-SNACs@TPZ@Cas-A had no significant inhibitory effect on cell proliferation under normoxic conditions, but under hypoxic conditions, cell viability decreased significantly ( Figure 7 At the same time, live-dead cell staining was used to further verify the cell status. The green fluorescence signal (live cells) in the H+S-SNACs@TPZ@Cas-A group was significantly reduced, while the red fluorescence signal (dead cells) was significantly enhanced, further supporting the anti-tumor effect of the material under hypoxic conditions ( Figure 7 B). Flow cytometry results further showed that the H+S-SNACs@TPZ@Cas-A group significantly increased the early and late apoptosis rates of cells, further confirming the enhanced anti-tumor effect of the material under hypoxic conditions ( Figure 7 C). In summary, it was verified in vitro that S-SNACs@TPZ@Cas-A inhibited the ubiquitination of FAM134B by knocking out AMFR, thereby weakening the binding ability of FAM134B to LC3 and significantly reducing the endoplasmic reticulum autophagy flux.

[0065] Implementation Example 5: Establishment and Grouping of Osteosarcoma-Bearing Mice and Lung Metastasis Model To evaluate the anti-tumor effect of S-SNACs@TPZ@Cas-A: ① 4-5 week old male BALB / c mice (male BALB / c mice, 4-6 weeks old, strain code 211, Beijing Weitong Lihua Experimental Animal Co., Ltd.) were selected and 1×10 6 K7M2-luc osteosarcoma cells were isolated. Tumor volume was measured using a vernier caliper (C112, Mitutoyo, Japan) and calculated using the formula: volume (mm³) = long diameter × short diameter² / 2. When tumor volume reached approximately 100 mm³, the cells were randomly divided into the following treatment groups (n = 5): PBS group (G1), SNACs@TPZ group (G2), SNACs@Cas-A group (G3), SNACs@TPZ@Cas-A group (G4), and S-SNACs@TPZ@Cas-A group (G5). The nanomaterials were injected via the tail vein at a dose of 200 mg / kg, with treatments administered every two days for a total of five injections. All mouse experiments followed protocols approved by the Animal Ethics Committee.

[0066] ② First, in vivo experiments were conducted in nude mice (4-6 weeks old, strain code 401, Beijing Weitonglihua Laboratory Animal Co., Ltd.). 143B human osteosarcoma cells were used. After cell digestion, 1×10 6 Cells were inoculated subcutaneously on the right side of the back of nude mice with 100 μL of PBS. When tumors grew to approximately 100 mm³, the mice were randomly divided into five groups (n=6) and treated with the following treatments: PBS (G1), SNACs@TPZ (G2), SNACs@Cas-A (G3), SNACs@TPZ@Cas-A (G4), and S-SNACs@TPZ@Cas-A (G5). All nanoparticles were injected via the tail vein (200 mg / kg) every two days for a total of five injections over a 21-day experimental period. All mouse experiments followed protocols approved by the Animal Ethics Committee.

[0067] ③ For the lung metastasis model, 4-5 week-old male BALB / c nude mice were selected and injected with 2×10 5 A lung metastasis model was established using 143B osteosarcoma cells. Six mice were randomly assigned to the same treatment group (n = 6) and treated with the same dose and frequency of tail vein injection. All mouse experiments followed protocols approved by the Animal Ethics Committee.

[0068] ④ To assess tumor cell apoptosis, tumor tissue sections were stained with TUNEL using a TUNEL apoptosis detection kit (C1086, Beyotime Biotechnology, China). Following the manufacturer's instructions, sections were treated with proteinase K (P4850, Sigma-Aldrich, USA) and then the labeling mixture was added. The sections were incubated in the dark for 1 hour. Signals were detected using a fluorescence microscope (Zeiss Axio Observer 7, Germany). Positive cells displayed green fluorescence. Five high-power fields were randomly selected, and the proportion of positive cells was calculated.

[0069] During treatment, tumor volume was recorded and calculated on days 7, 10, 14, 18, and 21 (V = long diameter × short diameter² / 2). Mouse body weight was recorded every two days using an electronic balance. Tumor volume growth and body weight changes were used to assess treatment efficacy and biosafety.

[0070] After treatment, tumor tissues were collected from mice and fixed in 10% neutral buffered formaldehyde (HT5011, Sigma-Aldrich, USA). Dehydrated with graded alcohol, embedded in paraffin, and sectioned at a thickness of 5 µm. Sections were stained with hematoxylin and eosin (H&E, C0105, Beyotime Biotechnology, China), and histopathological changes in tumor tissue, including cell density, mitotic figures, and necrotic area, were observed using a light microscope (Nikon EclipseCi-L, Japan).

[0071] K7M2-luc cells were inoculated into the tibia of Balb / c mice to establish an orthotopic osteosarcoma mouse model ( Figure 10 A). In vivo fluorescence imaging system (IVIS) was used to monitor tumor growth at different time points (7 days, 12 days, 17 days, and 21 days) ( Figure 10 B). The results showed that the G5 group showed the lowest bioluminescent signal at all time points, indicating that the nanoparticles have a strong anti-tumor effect. The G4 group also showed a certain inhibitory effect, but its signal intensity was higher than that of the G5 group, while the signal intensity of the G1 and G2 groups was higher, indicating that the effect of TPZ treatment alone was limited. Further tumor images ( Figure 10 C) and statistical analysis of tumor weight ( Figure 10 D) shows that the tumor volume and weight after S-SNACs@TPZ@Cas-A treatment were smaller and lower, which was also different from the G4 group, indicating that S-SNACs@TPZ@Cas-A has a better effect in inhibiting the growth of osteosarcoma. Next, H&E staining, Ki67 staining and AMFR expression detection were performed on the tumor tissue ( Figure 10E). H&E staining revealed increased necrotic areas, loosely arranged cells, and pronounced nuclear condensation and fragmentation in the G5 group's tumor tissue, suggesting that S-SNACs@TPZ@Cas-A can induce tumor cell apoptosis. Ki67 immunohistochemistry analysis revealed a decreased Ki67 positivity rate in the G5 group's tumor tissue, indicating a modest inhibition of cell proliferation compared to the G1, G2, and G3 groups. Furthermore, AMFR expression was assessed, revealing a decreased proportion of AMFR-positive cells in the G5 group, indicating that the nanosystem effectively inhibits AMFR expression in vivo.

[0072] Flow cytometry analysis of the tumor immune microenvironment revealed Figure 10 FH), the proportion of CD8+ T cell infiltration in tumor tissues in the G5 group was significantly higher than in the other groups, suggesting that it enhances the anti-tumor response of cytotoxic T lymphocytes. Concurrently, the infiltration levels of CD4+ T cells and DCs in the G5 group were also significantly increased, suggesting that the nanosystem may synergistically activate anti-tumor immunity by regulating T cell subset function and enhancing antigen presentation efficiency.

[0073] Osteosarcoma has a high risk of lung metastasis, so the metastasis in the lung tissues of nude mice in each group was further evaluated ( Figure 10 I). H&E staining revealed a high number of metastatic nodules in the lung tissues of mice in groups G1 and G2. These nodules decreased in groups G3 and G4, and significantly decreased in the G5 group. Statistical analysis showed that the number of lung metastases in the G5 group was lower than in the other groups, suggesting that S-SNACs@TPZ@Cas-A may have a certain ability to inhibit distal metastasis of osteosarcoma.

[0074] In summary, S-SNACs@TPZ@Cas-A exhibited good anti-tumor effects in the osteosarcoma model by inhibiting osteosarcoma growth, reducing lung metastasis, and enhancing anti-tumor immune responses.

[0075] To evaluate the therapeutic effect of S-SNACs@TPZ@Cas-A in osteosarcoma, 143B cells were injected into the flank of nude mice to establish an osteosarcoma tumor-bearing mouse model, and the mice were treated according to the following groups: PBS group (G1), SNACs@TPZ group (G2), SNACs@Cas-A group (G3), SNACs@TPZ@Cas-A group (G4), and S-SNACs@TPZ@Cas-A group (G5) ( Figure 8 A). Growth curves were drawn by measuring tumor volume to evaluate the effects of different nanomaterials on tumor growth ( Figure 8B). The results showed that the tumor growth rate in group G5 was the slowest, followed by group G4, while the tumor growth rates in groups G1 and G2 were faster, suggesting that S-SNACs@TPZ@Cas-A had the strongest inhibitory effect on tumors. SNACs@TPZ@Cas-A also showed a certain tumor inhibition effect, but it was lower than that of S-SNACs@TPZ@Cas-A. Further observation of tumor appearance ( Figure 8 C) and tumor weight determination ( Figure 8 D) It was further confirmed that the tumor volume and weight of the G5 group were smaller and lower, which was still different from that of the G4 group, indicating that S-SNACs@TPZ@Cas-A still showed a good anti-tumor effect in the nude mouse subcutaneous transplanted tumor model. In addition, the changes in the weight of the mice showed that the weight of the mice in each group remained stable ( Figure 8 E) showed that the different treatment groups did not induce obvious systemic toxic reactions during the experiment.

[0076] To explore the anti-tumor mechanism of S-SNACs@TPZ@Cas-A, H&E staining and TUNEL staining were performed on tumor tissues. H&E staining showed that the tumor tissue structure in the G5 group was loose, the necrotic area increased, and the nuclear condensation and nuclear fragmentation were more obvious, suggesting that the nanosystem may induce tumor cell death ( Figure 8 F). TUNEL staining results showed that the proportion of TUNEL-positive cells in the G5 group was higher, suggesting that S-SNACs@TPZ@Cas-A may induce tumor cell apoptosis ( Figure 8 G).

[0077] Implementation Example 6: Biosafety Assessment Healthy BALB / c mice were injected via the tail vein with S-SNACs@TPZ@Cas-A (10 mg / kg) or an equal volume of PBS as a control. Following injection, the mice's general behavior, food and water intake, and appearance were closely observed. Seven days after treatment, the mice were anesthetized and sacrificed via intraperitoneal injection of sodium pentobarbital. Major organs (heart, liver, spleen, lungs, and kidneys) were rapidly dissected and analyzed for pathological changes using H&E staining.

[0078] Venous blood was collected from mice, and hematological parameters, including white blood cell count (WBC), red blood cell count (RBC), and hemoglobin (Hb), were measured using a Sysmex XS-800i automated hematology analyzer (Sysmex, Japan). Serum was separated and alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatinine (CREA), and urea levels were measured using a biochemical analyzer (Beckman Coulter AU5800, USA) to assess liver and kidney function.

[0079] In addition, to evaluate the biosafety of S-SNACs@TPZ@Cas-A nanomaterials, healthy Balb / c mice were treated with different concentrations of S-SNACs@TPZ@Cas-A or an equal volume of saline via intravenous injection, and various biological parameters were measured. The results showed that after the mice were treated with different concentrations of S-SNACs@TPZ@Cas-A, the weights of the main organs (heart, liver, spleen, lungs, and kidneys) did not show significant differences compared with the saline control group ( Figure 9 A). In addition, hematological parameters (white blood cell count, red blood cell count, and hemoglobin level) showed no significant abnormalities ( Figure 9 B), further indicating that the nanomaterials had no significant effect on the systemic circulatory system of mice. At the same time, typical biomarkers related to liver and kidney function, including alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatinine (CREA) and urea, were detected. The results showed that there was no significant difference in these indicators between the S-SNACs@TPZ@Cas-A group and the normal saline control group ( Figure 9 C). H&E staining of heart, liver, spleen, lung, and kidney tissue sections revealed no inflammation, necrosis, congestion, or abnormal vascular morphology ( Figure 9 D). These data indicate that S-SNACs@TPZ@Cas-A has good biocompatibility and does not cause obvious toxicity or adverse reactions after intravenous injection.

[0080] In summary, S-SNACs@TPZ@Cas-A significantly inhibited osteosarcoma cell proliferation and induced apoptosis by inhibiting FAM134B ubiquitination and blocking endoplasmic reticulum autophagy. In in vivo experiments, the nanosystem effectively inhibited tumor growth and reduced tumor cell survival, demonstrating excellent anti-tumor efficacy. Furthermore, mouse body weight, hematological parameters, and histological analysis of major organs showed no significant toxicity, indicating good biosafety. These results demonstrate that S-SNACs@TPZ@Cas-A has promising potential for application in osteosarcoma treatment.

[0081] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for preparing S-SNACs@TPZ@Cas-A nanoparticles, characterized in that: The steps are: (1) The pH of the CTAB aqueous solution was adjusted to alkaline, and then TEOS and APTES were added. After stirring, the reaction was centrifuged, washed, and dried to obtain MSN-NH2. The MSN-NH2 solution was then mixed with TPZ, stirred, incubated, and centrifuged to obtain TPZ-loaded mesoporous silica nanoparticles, which were recorded as SNs@TPZ. (2) The SNs@TPZ solution was mixed with the Ag2S quantum dot solution, and then ultrasonically dispersed and transferred to MES-NHS buffer. EDC·HCl and NHS were then added. After stirring at room temperature, the mixture was centrifuged, washed, and dried to obtain Ag2S-modified TPZ-loaded mesoporous silica nanoparticles, which were designated as Ag2S-SNs@TPZ. (3) 4-PA was added to the mixed solution of EDC and NHS, the pH was adjusted to acidic, and the mixture was stirred at room temperature to obtain a 4-PA solution. The 4-PA solution was added dropwise to the Ag2S-SNs@TPZ prepared in step (2), and the reaction was stirred to obtain SNAs@TPZ with closed pores, which was recorded as SNACs@TPZ. (4) The Cas9 protein was incubated with the sgRNA (SEQ ID No. 1) in Tris-HCl buffer to form an RNP complex solution. The RNP complex solution was then added dropwise to the SNACs@TPZ solution and incubated at 4°C overnight to obtain S-SNACs@TPZ@Cas-A nanoparticles.

2. The method for preparing S-SNACs@TPZ@Cas-A nanoparticles according to claim 1, characterized in that: In the step (1), 2 mL of TEOS and 0.5 mL of APTES are added to each g of CTAB; the mass ratio of MSN-NH2 to TPZ in the MSN-NH2 solution is 1:0.05-0.2; and the concentration of the MSN-NH2 solution is 0.1-1 mg / mL.

3. The method for preparing S-SNACs@TPZ@Cas-A nanoparticles according to claim 2, characterized in that: In step (2), the mass ratio of SNs@TPZ, Ag2S quantum dots, EDC·HCl and NHS is 1:0.05:0.05:0.

05.

4. The method for preparing S-SNACs@TPZ@Cas-A nanoparticles according to claim 3, characterized in that: In step (3), the concentration of 4-PA in the 4-PA solution is 1-5 mM; the volume ratio of EDC to NHS is 1:1; and the mass ratio of 4-PA to Ag2S-SNs@TPZ is 1:0.1-0.

5.

5. The method for preparing S-SNACs@TPZ@Cas-A nanoparticles according to claim 3, characterized in that: In step (4), the molar ratio of Cas9 protein to sgRNA is 1:1-1.5; the molar ratio of RNP complex to SNACs@TPZ is 1:0.1-0.5; and the concentration of SNACs@TPZ solution is 0.1-2 mg / mL.

6. S-SNACs@TPZ@Cas-A nanoparticles prepared by the method according to any one of claims 1 to 5.

7. The S-SNACs@TPZ@Cas-A nanoparticle according to claim 6, characterized in that: The loading amount of the RNP complex on the S-SNACs@TPZ@Cas-A nanoparticles is 0.02-2 mg / mL.

8. Use of the S-SNACs@TPZ@Cas-A nanoparticles according to claim 6 or 7 in the preparation of anti-tumor drugs.

9. The use according to claim 8, characterized in that: The anti-tumor drug is based on a synergistic strategy of gene editing and hypoxia targeted therapy.

Images