Method for improving catalytic activity of alpha-glucan phosphorylase, mutant tpalphaGPM7, gene and application

Abstract

The present application relates to the field of enzyme engineering, and in particular to a method for improving the catalytic activity of alpha-glucan phosphorylase and a mutant Tp Alpha-glucan phosphorylase, genes and applications. In order to simultaneously meet the excellent thermal stability required for high-temperature operation and the high specific activity required for efficient catalysis of existing alpha-glucan phosphorylases, the present application uses site-directed mutagenesis technology to modify alpha-glucan phosphorylase from Thermotoga petrophila Thermus thermophilus HB27, and obtain a single-point mutant with improved catalytic activity Tp Alpha-glucan phosphorylase. The alpha-glucan phosphorylase mutant of the present application can be widely used in the production of artificial starch and other polysaccharides.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a method for improving the catalytic activity of α-glucan phosphorylase and a mutant thereof. Tp αGPM7, genes, and applications. Background Art

[0002] Traditional plant-based starch production relies heavily on photosynthetic carbon fixation, limited by low light energy conversion efficiency and complex metabolic regulation, making it difficult to break through production bottlenecks. In recent years, synthetic biology has made breakthroughs in synthesizing starch from straw, with alpha-glucan phosphorylase (αGP) being a key enzyme.

[0003] α-Glucan phosphorylase (αGP) is a key glycosyltransferase (classified as glycosyltransferase family 35) found widely in plants, animals, and microorganisms. This enzyme catalyzes the reversible phosphorolysis of α-1,4-glucan chains. In the forward reaction, in the presence of a primer (a short-chain α-1,4-glucan), the enzyme uses G-1-P to synthesize and extend the α-1,4-glucan chain through a glucosyl transfer reaction. In the reverse reaction, the glycosyl group is phosphorylated from the non-reducing end of the glucan chain to form glucose-1-phosphate (G-1-P). Notably, this catalytic process requires no additional energy input, providing an economical method for polysaccharide synthesis in industrial production.

[0004] In industrial bioconversion processes such as artificial starch synthesis, high-temperature (60°C) operation has significant advantages: it can significantly reduce the risk of microbial contamination, increase substrate solubility and reaction rate, and reduce system viscosity to facilitate mixing and mass transfer. Therefore, it is crucial to develop α-glucan phosphorylase αGP with high catalytic activity in a high-temperature environment (60°C). Some α-glucan phosphorylase αGPs derived from thermophilic microorganisms that have been analyzed generally have a wide operating temperature range (50-100°C) and good thermal stability, but their catalytic activity is generally low, resulting in insufficient catalytic efficiency, which limits the economic feasibility of industrial applications, such as the parent used in this patent. Therefore, the core challenge facing current industrial applications is that existing α-glucan phosphorylase αGPs are difficult to simultaneously meet the excellent thermal stability required for high-temperature operation and the high specific activity required for efficient catalysis.

[0005] In order to obtain α-glucan phosphorylase αGP that has both high catalytic activity and excellent stability at high temperatures to meet the needs of efficient and robust industrial biocatalysis, the use of protein engineering technology to perform protein engineering modification of existing α-glucan phosphorylase αGP has become a key means to achieve this goal. Summary of the Invention

[0006] In order to increase the Thermotoga petrophila α-glucan phosphorylase Tp The present invention was proposed and completed based on the catalytic activity of αGP at high temperature without reducing its thermal stability.

[0007] The object of the present invention is to provide an α-glucan phosphorylase mutant having improved catalytic activity at high temperatures.

[0008] Another object of the present invention is to provide a gene encoding the aforementioned α-glucan phosphorylase mutant.

[0009] Another object of the present invention is to provide a recombinant vector comprising the gene encoding the aforementioned α-glucan phosphorylase mutant.

[0010] Another object of the present invention is to provide a recombinant strain comprising the gene encoding the aforementioned α-glucan phosphorylase mutant.

[0011] Another object of the present invention is to provide the use of the above-mentioned α-glucan phosphorylase mutant.

[0012] Another object of the present invention is to provide a method for preparing α-glucan phosphorylase with enhanced catalytic activity at high temperatures.

[0013] Another object of the present invention is to provide a method for improving the catalytic activity of α-glucan phosphorylase at high temperature.

[0014] The present invention is derived from Thermotoga petrophila α-glucan phosphorylase Tp αGP was mutated to obtain an α-glucan phosphorylase mutant with improved catalytic activity at high temperature, wherein the parent α-glucan phosphorylase Tp The amino acid sequence of αGP is shown in SEQ ID NO: 1.

[0015] SEQ ID NO: 1:

[0016] MLEKLPENLKELESLAYNLWWSWSRPAQRLWRMIDSEKWEEHRNPVKILREVSKERLEELSKDEDFIALYELTLERFTDYMEREDTWFNVNYPEWDEKIVYMCMEYGLTKALPIYSGGLGILAGDHLKSASDLGLPLIAVGLLYKHGYFTQQIDSDGRQIEIFPEYDIEELPMKPLRDEDGNQVIVEVPIDNDTVKARVFEVQVGRVKLYLLDTDFEENEDRFRKICDYLYNPEPDVRVSQEILLGIGGMKLLKTLKIKPGVIHLNEGHPAFSSLERIKSYMEEGYSFTEALEIVRQTTVFTTHTPVPAGHDRFPFDFVEKKLTKFFEGFESKELLMNLGKDEDGNFNMTYLALRTSSFINGVSKLHADVSRRMFKNVWKGVPVEEIPIEGITNGVHMGTWINREMRKLFDRYLGRVWREHTDLEGIWYGVDRIPDEELWEAHLNAKKRFIDYIRESIKRRNERLGINEPLPEISENVLIIGFARRFATYKRAVLLFSDLERLKRIVNNSERPVYIVYAGKAHPRDEGGKEFLRRIYEVSQMPDFKNKIIVLENYDIGMARLMVSGVDVWLNNPRRPMEASGTSGMKAAANGVLNASVYDGWWVEGYNGRNGWVIGDESVLPETEADDPKDAEALYELLENEIIPTYYENREKWIFMMKESIKSVAPKFSTTRMLKEYTEKFYIKGLVNREWLERRENVEKIGAWKERILKNWENVSIERIVLEDSKSVEVTVKLGDLTPNDVIVELVAGRGEGMEDLEVWKVIHIRRYRKENDLFVYTYTNGVLGHLGSPGWFYAVRVIPYHPRLPIKFLPEVPVVWKKVL。

[0017] 根据本发明的具体实施方式,将α-葡聚糖磷酸化酶 TpThe 669th amino acid of αGP was mutated from Phe to Ser, the 670th amino acid was mutated from Ser to Ala, the 774th amino acid was mutated from Asp to Glu, the 775th amino acid was mutated from Leu to Ser, the 776th amino acid was mutated from Phe to Ile, the 777th amino acid was mutated from Val to Arg, the 778th amino acid was mutated from Tyr to Leu, the 779th amino acid was mutated from Thr to His, and the 780th amino acid was mutated from Tyr to The amino acid at position 781 was mutated from Thr to His, the amino acid at position 782 was mutated from Asn to Gln, the amino acid at position 783 was mutated from Gly to Trp, and the amino acid at position 784 was mutated from Val to Cys, resulting in the mutant F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C, i.e., the mutant Tp αGPM7, the α-glucan phosphorylase mutant Tp The amino acid sequence of αGPM7 is shown in SEQ ID NO: 2.

[0018] As shown in SEQ ID NO: 2:

[0019] MLEKLPENLKELESLAYNLWWSWSRPAQRLWRMIDSEKWEEHRNPVKILREVSKERLEELSKDEDFIALYELTLERFTDYMEREDTWFNVNYPEWDEKIVYMCMEYGLTKALPIYSGGLGILAGDHLKSASDLGLPLIAVGLLYKHGYFTQQIDSDGRQIEIFPEYDIEELPMKPLRDEDGNQVIVEVPIDNDTVKARVFEVQVGRVKLYLLDTDFEENEDRFRKICDYLYNPEPDVRVSQEILLGIGGMKLLKTLKIKPGVIHLNEGHPAFSSLERIKSYMEEGYSFTEALEIVRQTTVFTTHTPVPAGHDRFPFDFVEKKLTKFFEGFESKELLMNLGKDEDGNFNMTYLALRTSSFINGVSKLHADVSRRMFKNVWKGVPVEEIPIEGITNGVHMGTWINREMRKLFDRYLGRVWREHTDLEGIWYGVDRIPDEELWEAHLNAKKRFIDYIRESIKRRNERLGINEPLPEISENVLIIGFARRFATYKRAVLLFSDLERLKRIVNNSERPVYIVYAGKAHPRDEGGKEFLRRIYEVSQMPDFKNKIIVLENYDIGMARLMVSGVDVWLNNPRRPMEASGTSGMKAAANGVLNASVYDGWWVEGYNGRNGWVIGDESVLPETEADDPKDAEALYELLENEIIPTYYENREKWIFMMKESIKSVAPKSATTRMLKEYTEKFYIKGLVNREWLERRENVEKIGAWKERILKNWENVSIERIVLEDSKSVEVTVKLGDLTPNDVIVELVAGRGEGMEDLEVWKVIHIRRYRKENESIRLHLHQWCLGHLGSPGWFYAVRVIPYHPRLPIKFLPEVPVVWKKVL。

[0020] 根据本发明的具体实施方式,α-葡聚糖磷酸化酶突变体 Tp αGPM7的编码基因序列如SEQ ID NO:3所示。

[0021] SEQ ID NO:3:

[0022]

[0023] According to the technical scheme of the present application, the amino acid sequence of the eleven-point mutant D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C( Tp αGPM3) is shown in SEQ ID NO: 4.

[0024] SEQ ID NO: 4:

[0025] .

[0026] The method for improving the catalytic activity of α-glucan phosphorylase at high temperature according to the present invention comprises the following steps:

[0027] α-glucan phosphorylase TpThirteen mutations were performed on αGP: the 669th amino acid mutated from Phe to Ser, the 670th amino acid mutated from Ser to Ala, the 774th amino acid mutated from Asp to Glu, the 775th amino acid mutated from Leu to Ser, the 776th amino acid mutated from Phe to Ile, the 777th amino acid mutated from Val to Arg, the 778th amino acid mutated from Tyr to Leu, the 779th amino acid mutated from Thr to His, the 780th amino acid mutated from Tyr to Leu, the 781st amino acid mutated from Thr to His, the 782th amino acid mutated from Asn to Gln, the 783rd amino acid mutated from Gly to Trp, and the 784th amino acid mutated from Val to Cys.

[0028] The present invention also provides a recombinant strain comprising a gene encoding the α-glucan phosphorylase mutant.

[0029] The present invention also provides a recombinant strain comprising the coding gene of the above-mentioned α-glucan phosphorylase mutant. Preferably, the starting strain of the recombinant bacteria is BL21(DE3)(pET-28a(+) Tp ).

[0030] According to a specific embodiment of the present invention, a method for preparing α-glucan phosphorylase with improved catalytic activity at high temperature is as follows:

[0031] (1) transforming a host cell with a recombinant vector containing a gene encoding an α-glucan phosphorylase mutant to obtain a recombinant strain;

[0032] (2) culturing the recombinant strain to induce the expression of α-glucan phosphorylase;

[0033] (3) Purify the expressed α-glucan phosphorylase.

[0034] Beneficial effects of the present invention:

[0035] The present invention respectively treats α-glucan phosphorylase -tpαgp αGP was subjected to eleven mutations D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C ( Tp αGPM3) and the double point mutation F669S / S670A ( Tp αGPM5), and then thirteen point mutations F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C were performed to obtain the mutant Tp αGPM7.

[0036] Tp αGP of the present application T m value is 101.82℃; the mutant enzyme D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C of the present application, Tp αGPM3 of the present application T m value is 102.80℃; the mutant enzyme F669S / S670A of the present application, Tp αGPM5 of the present application T m value is 103.83℃; the mutant enzyme F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C of the present application, Tp αGPM7 of the present application T m value is 98.15℃. Tp αGPM3 and Tp αGPM5 of the present application T m values are 0.98℃ and 2.01℃ higher than Tp αGP respectively, Tp αGPM7 of the present application T m value is only 3.67℃ lower than Tp αGP, and the loss of thermal stability is effectively controlled within 5%.

[0037] The α-glucan phosphorylase mutant of the present application and the mutant parent Tp αGP, the catalytic activity at 60℃ is significantly improved without affecting the thermal stability of the parent, Tp αGPM3 of the present application Tp αGP is increased by 149.78%, Tp αGPM3 of the present application Tp αGP is increased by 65.79%. Tp αGPM5 of the present application Tp αGP is increased by 66.25%, Tp αGPM5 of the present application Tp αGP is increased by 35.81%. Tp αGPM7 of the present application Tp αGP is increased by 354.04%, Tp αGPM7 of the present application TpThe αGP increased by 147.93%. Therefore, the α-glucan phosphorylase mutant provided by the present invention has achieved a good balance between activity and thermal stability, can be well applied to the production of artificially synthesized starch and other polysaccharides, and has broad application prospects.

[0038] The present invention provides applications of the aforementioned α-glucan phosphorylase mutant with enhanced catalytic activity, specifically in the production of artificially synthesized starch and other polysaccharides. The α-glucan phosphorylase mutant provided by the present invention can well meet the application requirements of artificially synthesized starch and other polysaccharide production, and has a very broad application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Tp The mutants and Figure 1 Comparison of bidirectional enzyme activity of αGP;

[0040] Tp The mutants and Figure 2 αGP T m Value comparison. DETAILED DESCRIPTION

[0041] Test materials and reagents

[0042] 1. Strains and vectors: The expression host is BL21 (DE3) Escherichia coli, and the expression plasmid vector is pET-28a (+).

[0043] 2. Enzymes: endonucleases, ligases.

[0044] 3. Culture medium:

[0045] (1) Escherichia coli culture medium LB (1% peptone, 0.5% yeast extract, 1% NaCl, natural pH);

[0046] Note: Molecular biology experimental methods not specifically described in the following examples were performed with reference to the specific methods listed in the book "Molecular Cloning Laboratory Manual" (3rd edition) by J. Sambrook, or in accordance with the kits and product instructions.

[0047] The present invention respectively treats α-glucan phosphorylase Tp αGP was subjected to eleven mutations D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C ( Tp αGPM3) and the double point mutation F669S / S670A ( TpαGPM5), and then thirteen point mutations F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C were performed to obtain the mutant Tp αGPM7.

[0048] Example 1. Preparation of recombinant strain BL21(DE3) (pET-28a(+)-tpαgp) containing mutant genes

[0049] Amplification of the parent α-glucan phosphorylase Tp αGP encoding gene Tp

[0050] Amplification by PCR tpαgp. Gene fragment. The vector pET-28a(+) was obtained by culturing the preserved bacteria in a bottle and extracting it. After the amplification was completed, the PCR product and the extracted plasmid were subjected to nucleic acid electrophoresis detection. tpαgp The band sizes of pET-28a(+) and pET-28a(+) were 2466 bp and 5335 bp respectively. tpαgp I and BamH After enzyme digestion, the PCR product and the enzyme digestion product were recovered and purified respectively.

[0051] will be recycled Xho The pET-28a(+) gene fragment was recombined and connected with the recombinase of the kit to construct the plasmid pET-28a(+)- tpαgp The recombinant product was then transformed into E. coli Trans1-T1 competent cells and plated on LB (containing 50 μg / mL Kanamycin) for screening. After sequencing was correct, the plasmid was transformed into BL21 (DE3) E. coli expression host to obtain the recombinant expression strain BL21 (DE3) (pET-28a (+) tpαgp ).

[0052] Design mutation primers and use plasmid pET-28a(+)- -tpαgp As a template, the mutant amino acid was introduced by a point mutation kit, and the PCR product containing the mutant amino acid was used tpαgp The template was removed by digestion treatment, and the digested PCR product was transformed into Escherichia coli Tans1-T1 competent cells and sequenced to obtain Escherichia coli pET-28a(+)- Dpn -D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C, pET-28a(+)-tpαgp -F669S / S670A, pET-28a(+) tpαgp -F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C. The primers used are shown below:

[0053] tpαgp aGPM3-F (SEQ ID NO: 5) CACTTACACCAATGGTGTCTGGGTCATCTGGGTAGTCCG,

[0054] Tp aGPM3-R (SEQ ID NO: 6) CACCATTGGTGTAAGTGTAAACGAATAGATTCATTTTCTTTGCGATAACGACGAA;

[0055] Tp aGPM5-F (SEQ ID NO: 7) ACCGAAAAGCGCAACCACCCGCATGCTGAAAGA,

[0056] Tp aGPM5-R (SEQ ID NO: 8) GTGGTTGCGCTTTTCGGTGCCACGCTTTTGATG.

[0057] The specific operation is as follows.

[0058] Firstly, the primer Tp aGPM3-F and Tp aGPM3-R are used to construct the mutant plasmid pET-28a(+) Tp -D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C, the primer tpαgp aGPM5-F and Tp aGPM5-R are used to construct the mutant plasmid pET-28a(+) Tp -F669S / S670A; after being sequenced correctly, the pET-28a(+) tpαgp -D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C is used as a template, and the primer tpαgp aGPM5-F and Tp aGPM5-R are used to construct the mutant plasmid pET-28a(+).Tp -F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C.

[0059] The recombinant plasmid pET-28a(+)- tpαgp -D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C, pET-28a(+)- tpαgp -F669S / S670A, pET-28a(+)- tpαgp -F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C were transformed into BL21(DE3) Escherichia coli expression host and induced for expression to obtain the recombinant expression strain BL21(DE3)(pET-28a(+)- tpαgp -D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C, BL21(DE3)(pET-28a(+)- tpαgp -F669S / S670A, BL21(DE3)(pET-28a(+)- tpαgp -F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C).

[0060] Example 2: Obtaining α-glucan phosphorylases TpαGPM3, TpαGPM5, and TpαGPM7

[0061] In the present application, the α-glucan phosphorylase tpαgp αGPM3 is α-glucan phosphorylase Tp αGP and high catalytic activity mutant enzyme protein D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C ( Tp αGPM3); the α-glucan phosphorylase Tp αGPM5 is F669S / S670A; the α-glucan phosphorylase TpαGPM7 is F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C ( Tp αGPM7).

[0062] The obtained recombinant expression strain BL21 (DE3) (pET-28a (+)- Tp -D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C, BL21(DE3)(pET-28a(+)- tpαgp -F669S / S670A, BL21(DE3)(pET-28a(+)- tpαgp -F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C) were inoculated into 40 mL LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured overnight in a shaking incubator at 37°C and 200 rpm.

[0063] On the second day, 4 mL of seed solution was taken from 40 mL of LB liquid medium and inoculated into 400 mL of LB liquid medium containing a final concentration of 50 μg / mL Kanamycin, and cultured in a shaker at 37°C and 200 rpm.

[0064] When the bacterial solution OD 600 When the p-value was 0.6-0.8, IPTG was added at a final concentration of 0.1 mM and cultured in a shaker at 16°C and 200 rpm for 18 h to induce expression.

[0065] After induction, the fermentation broth was centrifuged at 6000 rpm for 10 min at 4°C to collect the cells, and the supernatant was removed. The cell pellet was resuspended in cell lysis buffer (20 mM Tris-HCl, 0.5 M NaCl, 10 mM imidazole, pH 7.4), centrifuged at 6000 rpm for 10 min, and the supernatant was removed.

[0066] The buffer used for purification is as follows:

[0067] (1) Cell lysis buffer and binding buffer: 20 mM Tris-HCl, 0.5 M NaCl, 10 mM imidazole, pH 7.4, named NTA10.

[0068] (2) Elution Buffer: Contains imidazole at final concentrations of 20 mM, 40 mM, 60 mM, 80 mM, 100 mM, 200 mM, 400 mM, and 500 mM. The remaining components are the same as those in the binding buffer and are named NTA20, NTA20, NTA60, NTA80, NTA100, NTA200, NTA400, and NTA500, respectively.

[0069] (3) Buffer used for gel filtration chromatography: 20 mM Tris-HCl, pH 7.4.

[0070] The purification steps are as follows:

[0071] (1) Preparation of crude enzyme solution: Resuspend the bacteria in cell lysis buffer and stir evenly. After confirming that there are no lumps in the bacterial solution, place the bacterial solution in an ice-water bath for ultrasonic disruption. The ultrasonic disruption parameters are set as follows: power 30%, ultrasonic time 4 s, interval time 3 s, and total treatment time 45 min. After ultrasonic disruption, the disrupted bacterial solution is subjected to high-speed centrifugation at 4 °C, the centrifugation parameters are 12000 rpm, and the centrifugation time is 30 min. After centrifugation, the supernatant is taken for SDS-PAGE analysis to determine the expression and distribution of the target protein.

[0072] (2) Heat treatment: First, the enzyme solution that has been confirmed to contain the target protein by SDS-PAGE protein electrophoresis is placed in a water bath preheated to 90°C and maintained at this temperature for 20 minutes. The treated enzyme solution is then transferred to a centrifuge precooled to 4°C and centrifuged at 12,000 rpm for 15 minutes. After centrifugation, the supernatant is collected and analyzed again by SDS-PAGE to evaluate the purification effect of the target protein.

[0073] (3) Nickel affinity chromatography: After heat treatment, the enzyme solution was filtered using a 0.22 μm filter membrane to remove particles that were not completely centrifuged and prevent them from contaminating the chromatography column. Subsequently, the 20% ethanol in the nickel affinity chromatography column was rinsed with deionized water, and the nickel column was equilibrated with binding buffer. 10 mL of the filtered crude enzyme solution was added to the equilibrated nickel column, and gradient elution was performed using elution buffers with different imidazole concentrations. The eluates from each gradient were collected for subsequent SDS-PAGE protein electrophoresis analysis. After elution, the nickel column was washed with deionized water, 0.5 M NaOH, and deionized water in turn. Finally, the nickel column was sealed with 20% ethanol and stored in a refrigerator at 4 °C.

[0074] (4) Gel filtration chromatography: After SDS-PAGE protein electrophoresis, the enzyme solution containing the target protein and reaching the required purity for the experiment was centrifuged at 12,000 rpm for 15 min and filtered using a 0.22 μm filter membrane. The 20% ethanol in the sealed desalting column was rinsed with deionized water, and then the desalting column was equilibrated with 20 mM Tris-HCl buffer at pH 7.4. 1 mL of the treated enzyme solution was added to the equilibrated desalting column, and the target protein was eluted with 1.5 mL of buffer to complete the replacement of the target protein buffer environment. Finally, the target protein was quantified using a protein quantification kit.

[0075] Example 3: Determination of bidirectional enzyme activity of the mutant and parent TpαGP of the present application

[0076] 3.1 Mutants and parent strains of this application tpαgp αGP forward enzyme activity assay

[0077] Definition of αGP forward reaction enzyme activity unit: 1 U is defined as the amount of enzyme required to catalyze the production of 1 μmol of phosphate per minute using G-1-P as substrate in the presence of α-1,4-glucan primer, and the unit is U / mg.

[0078] A 200 μL reaction solution contained maltodextrin (final concentration: 9 g / L), 12.5 mM G-1-P, 0.1 M sodium acetate (pH 5.5), and the appropriate amount of αGP. The reaction was initiated by the addition of αGP and incubated at 60°C for 10 min. The reaction was terminated by the addition of 800 μL of molybdate reagent (15 mM ammonium molybdate, 100 mM zinc acetate, pH 5.0), followed by the addition of 200 μL of ascorbic acid reagent (10% wt / vol, pH 5.0). The mixture was incubated at 30°C for 20 min, and the absorbance at 850 nm was measured to record the reaction mixture response. All reactions were performed in triplicate to ensure data accuracy and reliability.

[0079] 3.2 Mutants and parent strains of this application Tp Determination of αGP reverse enzyme activity

[0080] αGP reverse reaction enzyme activity unit definition: 1 U is defined as the amount of enzyme required to catalyze the production of 1 μmol of G-1-P per minute using α-1,4-glucan and phosphate as substrates. The unit is U / mg. For the quantitative detection of G-1-P, a cascade of PGM and G6PDH (glucose-6-phosphate dehydrogenase) is used to convert G-1-P into NADH (reduced nicotinamide adenine dinucleotide). The formation of NADH causes a change in absorbance at 340 nm, and G-1-P production is indirectly measured spectrophotometrically.

[0081] The detection process consists of two steps. The first step is an enzymatic reaction to generate the target product, G-1-P. A 200 μL reaction solution contains a final concentration of 20 mM phosphate, 9 g / L maltodextrin, 5 mM MgCl2, and an appropriate amount of αGP. The reaction is initiated by the addition of αGP and incubated at 60°C for 10 minutes. The reaction is stopped by the addition of HClO4 and the pH is neutralized with KOH.

[0082] In the second step, PGM catalyzes the conversion of G-1-P to G-6-P, and then G6PDH uses NAD⁺ as a cofactor to oxidize G-6-P to 6-phosphogluconolactone and generate NADH. The 200 μL reaction solution contains 5 mM MgCl2, 6 mM NAD + , 2 U / mL PGM, 2 U / mL G6DPH and an appropriate amount of the first step reaction product, the reaction was started by adding G6DPH, and the reaction kinetics were monitored at a wavelength of 340 nm. 340 The reaction was terminated when the reaction reached a stable state and no longer changed. All reactions were measured in triplicate to ensure data accuracy and reliability.

[0083] 3.3 Mutants and parent strains of this application Tp αGP T m Value determination

[0084] The present invention uses differential calorimetry (DSC) to determine the mutant and parent Tp αGP T m value to evaluate its thermal stability. The specific steps are as follows:

[0085] (1) Buffer exchange: The purified enzyme solution was exchanged into a HEPES buffer solution with a pH of 7.4 and 50 mM, which was the same as the reference buffer solution, through a desalting column.

[0086] (2) Unify the sample concentration: Load the replaced enzyme solution into a 10 kDa ultrafiltration tube and concentrate it at 4500 rpm and 4°C to adjust the concentration of the sample to be tested to approximately 0.5 mg / mL.

[0087] (3) Sample degassing and loading: Before the measurement, the sample and reference buffer solution were degassed using a MicroCal ThermoVac for 5 minutes to remove dissolved gases and avoid their influence on the measurement results. Subsequently, 400 μL of protein sample and reference buffer solution were added to a 96-well plate, respectively. The temperature range was set to 30-120 °C, and the heating rate was 120 °C / h. Each sample was scanned three times to ensure the reliability of the data.

[0088] (4) Data analysis: Origin 2022 was used to process the DSC scan results and calculate the sample’s T m value.

[0089] like Tp As shown, the purified Figure 1 αGP and mutants were subjected to enzymatic reaction at pH 7.4 and 60°C to determine their enzymatic activities.

[0090] in, Tp The forward enzyme activity of αGP is 12.68 U / mg, and the reverse enzyme activity is 7.77 U / mg; the mutant enzyme D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C ( Tp αGPM3) has a forward enzyme activity of 31.67 U / mg and a reverse enzyme activity of 12.88 U / mg; the mutant enzyme F669S / S670A ( Tp αGPM5) has a forward enzyme activity of 21.08 U / mg and a reverse enzyme activity of 10.55 U / mg; the mutant enzyme F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C ( Tp The forward enzyme activity of αGPM7 was 57.57 U / mg, and the reverse enzyme activity was 19.26 U / mg. Tp The forward enzyme activity of αGPM3 is Tp αGP increased by 149.78%, Tp The reverse enzyme activity of αGPM3 is Tp αGP increased by 65.79%. Tp The forward enzyme activity of αGPM5 is Tp αGP increased by 66.25%, Tp The reverse enzyme activity of αGPM5 is Tp αGP increased by 35.81%. Tp The forward enzyme activity of αGPM7 is Tp αGP increased by 354.04%, Tp The reverse enzyme activity of αGPM7 is Tp αGP increased by 147.93%.

[0091] like Tp As shown, Figure 2 αGP T mThe value is 101.82℃; the mutant enzyme D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C of the present application ( Tp αGPM3) T m The value is 102.80℃; the mutant enzyme F669S / S670A ( Tp αGPM5) T m The value is 103.83℃; the mutant enzyme F669S / S670A / D774E / L775S / F776I / V777R / Y778L / T779H / Y780L / T781H / N782Q / G783W / V784C ( Tp αGPM7) T m The value is 98.15℃. Tp αGPM3 and Tp αGPM5 T m The values ​​are respectively Tp αGP was 0.98℃ and 2.01℃ higher, Tp αGPM7 T m Value Ratio Tp The αGP only dropped by 3.67 °C, and the loss of thermal stability was effectively controlled within 5%.

[0092] The α-glucan phosphorylase mutant of the present invention and the mutant parent Tp Compared with αGP, the catalytic activity at 60℃ was significantly improved without affecting the thermal stability of the parent. Tp The forward enzyme activity of αGPM3 is Tp αGP increased by 149.78%, Tp The reverse enzyme activity of αGPM3 is Tp αGP increased by 65.79%. Tp The forward enzyme activity of αGPM5 is Tp αGP increased by 66.25%, Tp The reverse enzyme activity of αGPM5 is Tp αGP increased by 35.81%. Tp The forward enzyme activity of αGPM7 is Tp αGP increased by 354.04%, Tp The reverse enzyme activity of αGPM7 is Tp Tp αGP increased by 147.93%.

[0093] The above embodiments are only used to understand the technical solutions of the present application and do not limit the scope of protection of the present application.

Claims

1. A mutant of α-glucan phosphorylase with improved catalytic activity at high temperature, characterized in that The amino acid sequence of the mutant is shown in SEQ ID NO: 2 or SEQ ID NO:

4.

2. An α-glucan phosphorylase gene, characterized in that The gene encodes an α-glucan phosphorylase having an amino acid sequence as shown in SEQ ID NO: 2 or SEQ ID NO:

4.

3. A recombinant vector comprising the α-glucan phosphorylase gene according to claim 2.

4. A recombinant strain comprising the α-glucan phosphorylase gene according to claim 2.

5. A method for improving the catalytic activity of α-glucan phosphorylase at high temperature, characterized in that: The method comprises the steps of mutating the α-glucan phosphorylase shown in SEQ ID NO: 1 as follows: the amino acid at position 774 mutates from Asp to Glu, the amino acid at position 775 mutates from Leu to Ser, the amino acid at position 776 mutates from Phe to Ile, the amino acid at position 777 mutates from Val to Arg, the amino acid at position 778 mutates from Tyr to Leu, the amino acid at position 779 mutates from Thr to His, the amino acid at position 780 mutates from Tyr to Leu, the amino acid at position 781 mutates from Thr to His, the amino acid at position 782 mutates from Asn to Gln, the amino acid at position 783 mutates from Gly to Trp, and the amino acid at position 784 mutates from Val to Cys; or The 669th amino acid mutated from Phe to Ser, the 670th amino acid mutated from Ser to Ala, the 774th amino acid mutated from Asp to Glu, the 775th amino acid mutated from Leu to Ser, the 776th amino acid mutated from Phe to Ile, the 777th amino acid mutated from Val to Arg, the 778th amino acid mutated from Tyr to Leu, the 779th amino acid mutated from Thr to His, the 780th amino acid mutated from Tyr to Leu, the 781st amino acid mutated from Thr to His, the 782nd amino acid mutated from Asn to Gln, the 783rd amino acid mutated from Gly to Trp, and the 784th amino acid mutated from Val to Cys.

6. Use of the α-glucan phosphorylase mutant with improved catalytic activity at high temperature according to claim 1 in artificial synthesis of starch.

7. A method for preparing α-glucan phosphorylase, characterized in that: The method comprises the following steps: (1) using a recombinant vector comprising the α-glucan phosphorylase gene according to claim 2 to transform a host cell to obtain a recombinant strain; (2) culturing the recombinant strain and inducing the expression of α-glucan phosphorylase; (3) Purify the expressed α-glucan phosphorylase.

Images