Electrochemical biosensor for ApoE allele analysis and preparation method and application thereof

Abstract

The invention is applicable to the technical field of biosensing and gene detection, and provides an electrochemical biosensor for ApoE allele analysis and a preparation method and application thereof, the electrochemical biosensor for ApoE allele analysis comprises: an electrode module; the probe module comprises two kinds of hairpin structure probes ReDNA-AQ and ReDNA-MB, and the two kinds of hairpin structure probes ReDNA-AQ and ReDNA-MB are used for being specifically combined with a T basic group and a C basic group of an ApoE allele respectively; the ReDNA-AQ is prepared by modifying ReDNA by virtue of anthraquinone-2-carboxylic acid; the ReDNA-MB is prepared by reducing the ReDNA modified by a sulfydryl group and methylene blue; the nucleotide sequence of the ReDNA is as shown in SEQ ID NO. 1 in a sequence table; and the signal amplification module is used for integrating RPA amplification and a CRISPR-Cas12a system, realizing amplification and non-specific cleavage of target DNA through a one-pot reaction, and releasing electrochemical signal molecules. The electrochemical biosensor provided by the invention can be used for carrying out ApoE genotyping research, and has important significance on prewarning of the illness risk of the Alzheimer's disease.

Description

Technical Field

[0001] The present invention belongs to the technical field of biosensors and gene detection, and in particular relates to an electrochemical biosensor for ApoE allele analysis, a preparation method thereof, and an application thereof. Background Art

[0002] Alzheimer's disease (AD) is the most common neurodegenerative disease, usually occurring in people over 65 years old. The incidence rate is showing an alarming upward trend, and it is prone to symptoms such as cognitive impairment, memory loss, spatial dysfunction, and mental disorders.

[0003] The risk of Alzheimer's disease (AD) is 60%-80% genetic. Over 40 genetic risk loci associated with Alzheimer's disease have been identified, with the ApoE allele being the most strongly associated with the disease. Studies have shown that when the ApoE gene mutates to form ApoE ε4, it impairs the degradation and deposition of amyloid beta in the brain, thereby impacting the development and progression of Alzheimer's disease. The ApoE ε4 allele is the strongest genetic risk factor for sporadic Alzheimer's disease, while the ApoE ε2 allele acts as a genetic protective factor. Having one copy of an ApoE allele (ε2 / ε4 or ε3 / ε4) increases the risk of AD by 3-4 times, while having two copies (ε4 / ε4) increases the risk by 8-12 times. In the biomedical field, genetic testing plays a crucial role in disease diagnosis, treatment planning, and disease risk prediction. Accurate and efficient testing technologies are particularly needed for ApoE genotyping, which is closely associated with neurodegenerative diseases such as Alzheimer's disease. However, traditional genetic testing technology has exposed many drawbacks that are difficult to overcome, such as: Traditional gene sequencing technology, with authorization announcement number CN103436131B, was once the mainstream genetic testing method. Its technical principles are based on complex biochemical reactions and high-precision instrument detection. It obtains gene sequence information by identifying and recording DNA bases one by one. The sample processing process requires multiple rounds of complex nucleic acid extraction and purification steps. Each step is not only tedious, but also prone to the introduction of impurities due to improper operation or environmental factors during actual operation, which can interfere with subsequent test results. The detection process is highly dependent on specialized sequencing instruments. These instruments are not only expensive and extremely complex to operate, requiring operators to have deep professional knowledge and extensive practical experience. Otherwise, it is difficult to ensure the accuracy and stability of the test. In addition, the entire process, from sample preparation to the final acquisition of complete and reliable gene sequence results, often takes days or even weeks. In clinical practice, for patients who urgently need a rapid diagnosis and treatment plan, such a long detection time seriously hinders timely intervention and treatment, causing patients to miss the optimal treatment opportunity. Furthermore, while this technology theoretically possesses the ability to accurately determine base sequences, in the complex real-world environment of clinical sample testing, factors such as the presence of various impurities in the sample, instrument errors during sequencing, and operational uncertainties can significantly reduce its accuracy in detecting low-abundance gene mutations. Traditional sequencing technology is particularly demanding when dealing with samples containing multiple impurities or with complex cellular components. Any deviation in sample pretreatment can severely interfere with the sequencing reaction, causing the sequencing results to deviate or even become uninterpretable, making it impossible to accurately identify gene loci. This poses a significant obstacle to modern medicine, which relies on precise genotyping to develop personalized medical plans. Conventional gene probe detection technology, published as CN112920469A, utilizes specific hybridization reactions between nucleic acid probes and target gene sequences. The presence and mutation status of the gene are determined by detecting the hybridization signal. This technology typically involves immobilizing the designed probe on a solid-phase carrier, then hybridizing with appropriately treated sample DNA. Finally, detection results are obtained using signal detection methods such as fluorescence and chemiluminescence. However, this technology suffers from significant efficiency issues in practical applications. The hybridization reaction itself requires a long incubation period under specific conditions to ensure sufficient binding of the probe to the target gene. The subsequent signal detection step is also time-consuming, making it difficult to meet the needs of rapid clinical testing. More critically, the probe's specificity is significantly limited. In complex sample environments, the probe is prone to nonspecific hybridization with non-target gene sequences, generating false-positive signals and significantly reducing the accuracy of the test results. When testing for the ApoE gene locus, due to the presence of several regions of similar sequence surrounding the locus, conventional gene probes are difficult to accurately distinguish. This can easily misidentify similar gene sequences as mutations at the target locus, severely impacting the accuracy of the patient's condition. Furthermore, when dealing with complex samples, other biological components in the sample, such as various proteins, polysaccharides, and other nucleic acids, can interfere with the specific hybridization process between the probe and the target gene, resulting in a weakened or abnormal hybridization signal, further reducing the reliability of the test. The inability to accurately identify gene loci makes it difficult to provide personalized medical services to patients based on accurate genotyping, making it difficult to meet the urgent clinical demand for precise diagnosis and personalized treatment. In summary, before the advent of the technology of the present invention, existing genetic testing technologies had significant deficiencies in key aspects such as detection efficiency, accuracy, adaptability to complex samples, and accurate identification of gene loci to assist personalized medicine. These limitations seriously restrict the timeliness and accuracy of clinical diagnosis, and also hinder the effective implementation of personalized medicine. Therefore, the development of a new genetic testing technology that can break through the above bottlenecks has become an important issue that needs to be urgently addressed in the biomedical field. It is against this technical background that the present invention came into being, and aims to provide an efficient, accurate and complex sample-suitable detection scheme for ApoE genotyping through innovative technical means, so as to meet the higher requirements of clinical practice and scientific research for genetic testing technology. Summary of the Invention

[0004] The purpose of the embodiments of the present invention is to provide an electrochemical biosensor for ApoE allele analysis, aiming to solve the problems raised in the background technology.

[0005] The embodiment of the present invention is implemented as follows: an electrochemical biosensor for ApoE allele analysis includes an electrode module and further includes: A probe module comprising two hairpin probes, ReDNA-AQ and ReDNA-MB, for specifically binding to the T and C bases of the ApoE allele, respectively; ReDNA-AQ is prepared by modifying ReDNA with anthraquinone-2-carboxylic acid; ReDNA-MB is prepared by modifying ReDNA with reduced sulfhydryl groups and methylene blue; the nucleotide sequence of ReDNA is shown in SEQ ID NO. 1. The signal amplification module is used to integrate RPA amplification and CRISPR-Cas12a systems, achieving target DNA amplification and non-specific cleavage through a one-pot reaction, releasing electrochemical signal molecules.

[0006] Preferably, the electrode module is a gold electrode modified by electrodeposited gold nanoparticles.

[0007] Preferably, the signal amplification module includes an RPA reaction system and a CRISPR-Cas12a non-specific cleavage reaction system.

[0008] Another object of the present invention is to provide a method for preparing the electrochemical biosensor for ApoE allele analysis, comprising the following steps: ReDNA-AQ and ReDNA-MB were dropped onto a gold electrode modified with electrodeposited gold nanoparticles to obtain ReDNA / AuNPs / Au; 6-Mercapto-1-hexanol solution was added dropwise to the ReDNA / AuNPs / Au surface for incubation to obtain MCH / ReDNA / AuNPs / Au; The RPA reaction system and the CRISPR-Cas12a nonspecific cleavage reaction system were dropped onto the MCH / ReDNA / AuNPs / Au surface for incubation to obtain the electrochemical biosensor for ApoE allele analysis.

[0009] Preferably, the preparation method of ReDNA-AQ comprises the following steps: Anthraquinone-2-carboxylic acid is dissolved in a buffer solution, and then 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide and N-hydroxysuccinimide are added to the above solution and stirred. Subsequently, ReDNA is added to the above solution to obtain ReDNA-AQ; ReDNA-AQ is heated and then slowly cooled for annealing to form a hairpin structure.

[0010] Preferably, the preparation method of ReDNA-MB comprises the following steps: The thiolated and methylene blue modified ReDNA is subjected to a reduction reaction with TCEP to obtain ReDNA-MB; the ReDNA-MB is heated and then slowly cooled for annealing to form a hairpin structure.

[0011] Preferably, the method for preparing the gold electrode modified with electrodeposited gold nanoparticles comprises the following steps: A potassium chloride solution is prepared using tetrachloroauric acid solution as a basic solution, and then gold nanoparticles are deposited on the surface of a gold electrode using an electrochemical deposition method to obtain a gold electrode modified with electrodeposited gold nanoparticles.

[0012] Preferably, the RPA reaction system includes a primer set and MgOAc; the CRISPR-Cas12a non-specific cleavage reaction system includes Cas12a, crRNA and ReDNA.

[0013] Another object of an embodiment of the present invention is to provide an electrochemical biosensor for ApoE allele analysis prepared by the above preparation method.

[0014] Another object of an embodiment of the present invention is to provide a use of the above-mentioned electrochemical biosensor for ApoE allele analysis in the preparation of a kit for typing the ApoE gene.

[0015] The present invention provides an electrochemical biosensor for ApoE allele analysis, which can be used for ApoE genotyping research. The electrochemical biosensor is subjected to two consecutive DPV tests in a KCl solution. The first test determines whether the 112th gene site is present as a T base alone, a C base alone, or both bases simultaneously; the second test detects whether the 158th gene site is present as a T base alone, a C base alone, or both bases simultaneously. The application of this electrochemical biosensor in ApoE genotyping is of great significance for the diagnosis and treatment of Alzheimer's disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the construction process of RPA-CRISPR-electrochemical biosensor; (A) RPA-CRISPR one-pot design; (B) Construction of RPA-CRISPR-electrochemical biosensor (a: Au; b: AuNPs / Au; c: ReDNA / AuNPs / Au; d: MCH / ReDNA / AuNPs / Au; e: RPA-Cas / MCH / ReDNA / AuNPs / Au).

[0017] Figure 2 Diagram of the electrochemical detection process for two sets of gold electrodes connected in series; (A) Analysis of the detection situation at site 112; (B) Analysis of the detection situation at site 158.

[0018] Figure 3 Figure 3. Results of ApoE genotyping using an electrochemical biosensor; (A) Low-risk genotype: TT / CC (ε2ε4); (B) Normal genotype: TT / TC (ε2ε3); Error bars represent the standard deviation of three independent experiments.

[0019] Figure 4 Figure 3. ApoE genotyping results using an electrochemical biosensor; (C) Normal genotype: TC / TC (ε3ε3); (D) Low-risk genotype: TC / CC (ε3ε4); error bars represent the standard deviation of three independent experiments.

[0020] Figure 5 Figure 3. Results of ApoE genotyping using an electrochemical biosensor; (E) High-risk homozygous genotype: CC / CC (ε4ε4); (F) Normal genotype: TT / TT (ε2ε2); error bars represent the standard deviation of three independent experiments.

[0021] Figure 6 Figure 2 shows the specific detection results of the electrochemical biosensor; (A) and (B) are triple-base mutations, (C) and (D) are double-base mutations, (E) and (F) are single-base mutations, (G) and (H) are common human normal mixed solutions, and (I) is a comparison chart of the results of these samples; the error bars represent the standard deviation of three independent experiments.

[0022] Figure 7 This is the test result of one of the real human samples.

[0023] Figure 8 This is the detection result diagram of another real human sample.

[0024] Figure 9 This is the detection result diagram of another real human sample. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0026] In the present embodiment, an RPA-CRISPR-electrochemical biosensor was used to conduct ApoE genotyping research. The sensor was subjected to two consecutive DPV tests in a 0.1 mol / L KCl solution. The first test determined whether the 112th gene site was present as a T base alone, a C base alone, or both. The second test detected whether the 158th site was present as a T base alone, a C base alone, or both. The results are as follows: The current signals at the characteristic peaks of ReDNA-AQ and ReDNA-MB decreased in both tests, that is, both T and C were present, and the genotype was identified as low-risk TT / CC (ε2ε4); the current signal at the characteristic peak of ReDNA-AQ (used to detect T base) decreased in the first group test, and the current signals at the characteristic peaks of ReDNA-AQ (used to detect T base) and ReDNA-MB (used to detect C base) decreased in the second group test, and the genotype was identified as normal TT / TC (ε2ε3); in the first group test, only the current signal at the characteristic peak of ReDNA-AQ (used to detect T base) decreased, and in the second group test, only the current signal at the characteristic peak of ReDNA-MB (used to detect C base) decreased significantly, and the genotype was identified as TC / TC (ε3ε3), which is also a normal genotype. Genotype; the first group detected a decrease in the current signal at the characteristic peaks of ReDNA-AQ (for detecting T bases) and ReDNA-MB (for detecting C bases), and the second group detected a significant decrease only at the characteristic peak of ReDNA-MB (for detecting C bases), and the genotype was identified as a low-risk genotype TC / CC (ε3ε4) containing one ε4; when both groups detected a significant decrease in the current signal only at the characteristic peak of ReDNA-MB (for detecting C bases), the gene was identified as a high-risk homozygous genotype CC / CC (ε4ε4) with a significantly increased risk; when both groups detected a significant decrease only at the characteristic peak of ReDNA-AQ (for detecting T bases), the genotype was identified as TT / TT (ε2ε2), which contains two ε2 homozygotes, which is a normal genotype with a protective effect.

[0027] It should be noted that the nucleotide sequences used in the examples of this invention were designed and aligned using Primer5 software with reference to the NCBI online primer design tool (primer-blast, http: / / www.ncbi.nlm.nih.gov / tools / primer-blast) and the NCBI-Basic Local Alignment Search Tool. These sequences were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and Heilongjiang Jiansu Gene Technology Co., Ltd.

[0028] Specifically, in one embodiment of the present invention, there is provided an electrochemical biosensor for ApoE allele analysis comprising an electrode module, a probe module, and a signal amplification module; Among them, the electrode module is a gold electrode modified with electrodeposited gold nanoparticles; The probe module includes two hairpin probes, ReDNA-AQ and ReDNA-MB, which are used to specifically bind to the T base and C base of the ApoE allele, respectively. The ReDNA-AQ is prepared by modifying ReDNA with anthraquinone-2-carboxylic acid; the ReDNA-MB is prepared by reducing the sulfhydryl group and modifying ReDNA with methylene blue. The nucleotide sequence of the ReDNA is shown in the sequence listing SEQ ID NO. 1, specifically: SH-(CH2)6-TCAGCGTTCCTTTACCATTTTTTTAACTTATTTGGTTTTTTTTTT-NH2C6; The signal amplification module is used to integrate RPA amplification and CRISPR-Cas12a systems, achieving amplification and nonspecific cleavage of target DNA through a one-pot reaction, releasing electrochemical signal molecules; specifically, the signal amplification module includes an RPA reaction system and a CRISPR-Cas12a nonspecific cleavage reaction system.

[0029] In a preferred embodiment of the present invention, a method for preparing ReDNA-AQ is provided, as follows: 2 mg of anthraquinone-2-carboxylic acid (AQ) was dissolved in 20 ml of phosphate-buffered saline (PBS). 250 μL of 10 mmol / L 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC) and 250 μL of 5 mmol / L N-hydroxysuccinimide (NHS) were then added to the solution and stirred at room temperature for 15 minutes to activate the carboxylic acid groups of AQ. After activation, 500 μL of ReDNA was added to the activated AQ solution and stirred at room temperature for 2 hours to generate the ReDNA-AQ probe. The prepared probe was stored at 4°C until use. The prepared ReDNA-AQ probe was heated at 95°C for 5 minutes and then slowly cooled to room temperature to anneal and form a hairpin structure.

[0030] In a preferred embodiment of the present invention, a method for reducing ReDNA-MB is provided, as follows: (1) The synthesized sulfhydryl and methylene blue modified ReDNA (sequence: HS-SH C6-TCAGCGTTCCTTTACCATTTTTTTAACTTATTTGGTTTTTTTTTT-MB) is transported and distributed in the form of dry powder. The dry powder is attached to the tube wall in the form of a very light dry film. Use a centrifuge at 5000 rpm. After centrifugation for 1 minute, add the corresponding amount of DEPC water, dilute to the target concentration, shake and mix on a vortex oscillator, and then centrifuge instantly. After standing at 4°C for 16 hours, store at 4°C (for short-term frequent use) or -20°C (for long-term use) for later use.

[0031] (2) Take 5 μL of 1 mmol / L TCEP and mix it with 20 μL of thio- and methylene blue-modified ReDNA solution (concentration is 10 μmol / L), and carry out reduction reaction at room temperature for 30 minutes to obtain ReDNA-MB probe; the prepared ReDNA-MB probe is heated at 95°C for 5 minutes, and then slowly cooled to room temperature to anneal it to form a hairpin structure.

[0032] In a preferred embodiment of the present invention, a recombinase polymerase amplification (RPA) reaction system is provided. Specifically, the RPA reaction system is prepared according to the instructions of a commercially available RPA kit. A 50 μL RPA reaction system comprises the following: 2.4 μL of RPA upstream primer (10 μmol / L); 2.4 μL of RPA downstream primer (10 μmol / L); 29.5 μL of Primer Free Rehydration Buffer; 2 μL of DNA template; 2.5 μL of MgOAc (280 mmol / L); and 11.2 μL of water. After the reaction is completed, agarose gel electrophoresis is performed immediately to observe the electrophoresis results. Among them, the RPA upstream primers include F1-RPA (the nucleotide sequence is shown in SEQ ID NO. 2 in the sequence listing, specifically: AGCCGGGCCTGCGCCGCCTGCAGCTCCTTGGA) and F2-RPA (the nucleotide sequence is shown in SEQ ID NO. 4 in the sequence listing, specifically: TCGGCATCGCGGAGGAGCCGCTTACGCAGC), and the corresponding RPA downstream primers include R1-RPA (the nucleotide sequence is shown in SEQ ID NO. 3 in the sequence listing, specifically: CAGGCCATGCTCGGCCAGAGCACCGAGGAGCT) and R2-RPA (the nucleotide sequence is shown in SEQ ID NO. 5 in the sequence listing, specifically: CGCCGAGCGCGGCCTCAGCGCCATCCGCGA); In order to achieve ideal analytical performance, the embodiment of the present invention sequentially adds the reagents to a 0.2 mL PCR tube and reacts at 35°C, 37°C, 39°C, 41°C, and 43°C for 20 minutes. Immediately after the reaction, agarose gel electrophoresis is performed to observe the electrophoresis results. Then, under the optimal temperature conditions, the reaction is carried out for 10 minutes, 20 minutes, 30 minutes, 40 minutes, and 50 minutes, respectively, strictly controlling the reaction time. Immediately after the reaction, agarose gel electrophoresis is performed to observe the electrophoresis results.

[0033] In a preferred embodiment of the present invention, a CRISPR-Cas12a non-specific cleavage reaction system and an RPA-CRISPR-Cas12a one-pot reaction system are provided; specifically as follows: (1) Using the FnCas12a (Cpf1) kit from Tolo Biotechnology Co., Ltd., perform CRISPR-Cas12a nonspecific cleavage according to the instructions. The CRISPR-Cas12a nonspecific cleavage reaction system is as follows: 2 µL DNA template; 2 µL 10×Cas12a Buffer; 0.2 µL Cas12a; 0.2 µL crRNA; 0.2 µL ReDNA; and 15.4 µL water. After the reaction, perform agarose gel electrophoresis immediately to observe the electrophoresis results.

[0034] (2) Prepare 20 μL of RPA reaction system according to the above method, mix gently and centrifuge, and place the mixture at the bottom of the centrifuge tube; then add the above 20 μL of CRISPR-Cas12a nonspecific cleavage reaction system to the lid of the centrifuge tube before sealing. Place the test tube in a metal bath at 39°C and incubate for 30 minutes. Then combine the CRISPR-Cas12a nonspecific cleavage reaction system on the lid with the short-time amplification RPA reaction system to obtain the RPA-CRISPR one-pot reaction system. After the reaction is completed, perform agarose gel electrophoresis immediately to observe the electrophoresis results.

[0035] In a preferred embodiment of the present invention, a method for preparing and characterizing a gold electrode modified with electrodeposited gold nanoparticles (AuNPs / Au) is provided, as follows: (1) Electrode cleaning: Apply a small amount of 0.3 μm aluminum oxide (Al2O3) powder on the suede, then add a small amount of deionized water and stir evenly; hold the Au electrode vertically and make the Au electrode "8" shape on the suede and polish it for 2-3 minutes; then apply 0.05 μm Al2O3 powder on the suede and polish the Au electrode again according to the above steps for 2-3 minutes; rinse the electrode surface with deionized water, and then ultrasonically clean it in deionized water and anhydrous ethanol for 2 minutes each; dry it and set aside.

[0036] (2) Electrodeposition of gold nanoparticles: 0.1 g of tetrachloroauric acid (HAuCl4) powder was dissolved in 10 mL of deionized water to prepare a 1% HAuCl4 aqueous solution. A 0.1 mol / L potassium chloride (KCl) solution was prepared using this HAuCl4 aqueous solution as the base solution. Gold nanoparticles (AuNPs) were then deposited on the surface of the Au electrode by electrochemical deposition to obtain AuNPs / Au. Electrodeposition was performed in a 1% HAuCl4 solution at a deposition potential of -0.8 V and a deposition time of 100 s.

[0037] (3) Characterization of AuNPs / Au: AuNPs / Au was prepared using an electron microscope gold electrode according to the above method. The morphology and height of the AuNPs / Au surface were observed using an atomic force microscope (AFM).

[0038] like Figure 1 As shown, in a preferred embodiment of the present invention, a method for constructing an RPA-CRISPR-electrochemical biosensor is provided, which specifically includes the following steps: (1) Preparation of AuNPs / Au: Prepared by electrodeposition method, as above.

[0039] (2) Preparation of ReDNA / AuNPs / Au: 8 μL of the above-mentioned ReDNA-AQ and ReDNA-MB were added dropwise to the electrode surface and incubated at 4°C for 16 h to obtain ReDNA / AuNPs / Au.

[0040] (3) Preparation of MCH / ReDNA / AuNPs / Au: The original tube of 6-mercapto-1-hexanol (MCH) has a relative molecular mass of 98% and was diluted to a concentration of 1000:1. 6 μL of MCH solution was added dropwise to the surface of ReDNA / AuNPs / Au and incubated at room temperature for 30 min to obtain MCH / ReDNA / AuNPs / Au.

[0041] (4) Preparation of RPA-Cas / MCH / ReDNA / AuNPs / Au: The RPA-CRISPR one-pot reaction system was prepared according to the above method. 10 μL was added dropwise to the surface of MCH / ReDNA / AuNPs / Au and incubated at 25°C for 30 min to obtain the RPA-CRISPR-electrochemical biosensor (RPA-Cas / MCH / ReDNA / AuNPs / Au).

[0042] It should be noted that the sequences of the four ApoE mutation sites involved in the embodiments of the present invention include DNA-1, DNA-2, DNA-3, and DNA-4, which can be used as standards for detecting targets; their nucleotide sequences are shown in the sequence listing SEQ ID NO.6-9, respectively.

[0043] In addition, the crRNAs involved in the RPA-CRISPR one-pot reaction system include crRNA-1, crRNA-2, crRNA-3, and crRNA-4, and their nucleotide sequences are shown in the sequence listing SEQ ID NO.10-13, respectively.

[0044] like Figure 2 As shown, in a preferred embodiment of the present invention, an electrochemical detection procedure is provided, which is as follows: the current signals of ReDNA-MB and ReDNA-AQ are detected by two sets of electrochemical detection systems CV and DPV, which are composed of two gold electrodes connected in series. Figure 2 The CV parameters were scan rate 0.1 V / s, scan number 2, sampling interval 0.001 V, equilibrium time 2 seconds, and sensitivity 1×10 -4 The experimental parameters of A / V DPV were amplitude 0.05 V, pulse width 0.05 s, sampling period 0.0167 s, pulse period 0.5 s, equilibrium time 2 s, and sensitivity 1×10 -4 A / V, DPV experiment was performed at -0.8 V ~ 0 V.

[0045] like Figure 2 As shown, in a preferred embodiment of the present invention, a method for preparing and detecting clinical samples is provided, which is as follows: (1) Extraction of DNA from oral epithelial cells: First rinse your mouth with clean water, then hold a cotton swab in your mouth and wipe your cheeks repeatedly for 15-20 times (rotate the cotton swab from time to time), dissolve the cotton swab with the extract in 200 μL of PBS, centrifuge at 12,000 rpm for 3 minutes, discard the supernatant, add 200 μL of buffer GA, and shake until completely suspended; add 4 μL of RNase A (100 mg / mL) solution, shake for 15 seconds, and let it stand at room temperature for 5 minutes to remove RNA; add 20 μL of proteinase K and mix well; then add 200 μL of buffer GB, mix thoroughly by inverting, and let it stand at 70°C for 10 minutes; add 200 μL of anhydrous ethanol and shake thoroughly for 15 seconds; add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12,000 rpm for 3 minutes, discard the waste liquid, and place the adsorption column CB3 in a collection tube; add 500 μL of RNase A (100 mg / mL) solution to the adsorption column CB3. μL buffer GD, centrifuge at 12,000 rpm for 3 minutes, discard the waste liquid, and place the adsorption column CB3 in a collection tube; add 600 μL rinse solution PW to the adsorption column CB3, centrifuge at 12,000 rpm for 3 minutes, discard the waste liquid, and place the adsorption column CB3 in a collection tube (repeat this operation twice); empty for 2 minutes and let it stand at room temperature for 5 minutes; transfer the adsorption column CB3 to a clean centrifuge tube, add 25 μL elution buffer TE to the middle part of the adsorption membrane, let it stand at room temperature for 2 minutes, centrifuge at 12,000 rpm for 2 minutes, and collect the solution in a centrifuge tube; use an ultra-micro spectrophotometer to measure its concentration.

[0046] (2) PCR amplification: Measure the DNA concentration of each sample in turn and balance the DNA concentration of each sample. PCR amplification was performed using the PerfectStart Green qPCR SuperMix kit according to the instructions. The reaction system was as follows: 4 µL DNA template; 1 µL PCR upstream primer (10 µmol / L); 1 µL PCR downstream primer (10 µmol / L); 10 µL 2× PerfectStart Green qPCR SuperMix; and 4 µL water. The upstream PCR primer was F1-PCR (nucleotide sequence shown in the sequence listing as SEQ ID NO. 14, specifically: CGCGGACATGGAGGACGT), and the downstream PCR primer was R1-PCR (nucleotide sequence shown in the sequence listing as SEQ ID NO. 15, specifically: GCCTGGTACACTGCCAGG).

[0047] The reaction program was set as follows: 94°C for 30 seconds; 94°C for 5 seconds; 55°C for 15 seconds; and 72°C for 10 seconds. Steps 2 to 4 were repeated for 45 cycles. The PCR products obtained were verified by agarose gel electrophoresis, and the remaining products were stored in a -20°C refrigerator for sequencing.

[0048] (3) The ApoE genotype DPV was verified using the RPA-CRISPR-electrochemical biosensor constructed above and the sequencing results were compared.

[0049] In a preferred embodiment of the present invention, a method for ApoE genotyping is provided, as follows: Two electrochemical tests were performed to classify ApoE. The first test was to determine whether the 112th locus was present as a T base, a C base, or both; the second test was to determine whether the 158th locus was present as a T base, a C base, or both. Figure 3-Figure 5 As shown, Figure 3 In (A), a indicates the low-risk genotype is TT / CC (ε2ε4); Figure 3 Figures b and c in (A) show the detection of site 112. As can be seen from the figure, the current signal at the characteristic peak of ReDNA-AQ (for detecting T base) and ReDNA-MB (for detecting C base) is reduced, indicating that there is a mutation in the human diploid chromosome, that is, both T and C exist; Figure 3 Figures d and e in (A) show the detection of site 158. The characteristic peaks of ReDNA-AQ and ReDNA-MB also showed a decrease in current signal, indicating that human diploid chromosomes have a mutation at this position, that is, T and C coexist. Figure 3 (B) a shows the genotype is TT / TC (ε2ε3), which is the normal type; Figure 3 (B) b and c show that the current signal at the characteristic peak of ReDNA-AQ decreases, while the current information at the characteristic peak of ReDNA-MB does not decrease significantly, which is consistent with the blank, indicating that only T exists at this site; Figure 3 (B) shows the decrease in the current signal at the characteristic peak of ReDNA-AQ and ReDNA-MB in d and e, indicating that both T and C exist at this site 158. Figure 4 In (C), a indicates the genotype TC / TC (ε3ε3), which is also the normal genotype; Figure 4 (C) b and c show that the current signal at the characteristic peak of ReDNA-AQ decreases, while the current information at the characteristic peak of ReDNA-MB decreases little, which is consistent with the blank, indicating that only T exists; similarly, in Figure 4 In (C) d and e, the current signal is significantly reduced only at the characteristic peak of ReDNA-MB, indicating that only C exists at this position. Figure 4 In (D), a indicates that the genotype is TC / CC (ε3ε4), which contains an ε4, which is a low-risk genotype; Figure 4 (D) b and c show that the current signal at the characteristic peaks of ReDNA-AQ and ReDNA-MB decreases, indicating the presence of T and C; Figure 4 (D) d and e show that the current signal is significantly reduced only at the characteristic peak of ReDNA-MB, indicating that only C exists at this position; Figure 5 (E) a shows that the genotype CC / CC (ε4ε4) contains two ε4s, indicating that this is a high-risk homozygous genotype with a significantly increased risk; Figure 5 (E) b and c show that the current signal is significantly reduced only at the characteristic peak of ReDNA-MB, indicating that only C exists at this position; Figure 5 (E) d and e also show that the current signal is significantly reduced only at the characteristic peak of ReDNA-MB, indicating that only C exists at this position. Figure 5 In (F), a indicates that the genotype is TT / TT (ε2ε2), which contains two ε2 homozygotes, and is a normal genotype with protective effects; Figure 5 (F) b and c show that the current signal is significantly reduced only at the characteristic peak of ReDNA-AQ, indicating that only T exists at this position; Figure 5 (F) d and e also show that the current signal is significantly reduced only at the characteristic peak of ReDNA-AQ, indicating that only T exists at this position.

[0050] In a preferred embodiment of the present invention, a detection method for the specificity of the above-mentioned RPA-CRISPR-electrochemical biosensor is provided, as follows: Specificity is another important factor in evaluating sensor performance. To evaluate the specificity of the construction strategy, the present invention tested four different types of samples, including the common human normal type ε3ε3 (TC / TC) and its single nucleotide mutation (SNM), double nucleotide mutation (DNM), and triple nucleotide mutation (TNM). In the mixed solution, the concentration of the common human normal type was 10 times higher than that of the mutant, while other conditions remained unchanged. The results are as follows: Figure 6 As shown, the single-base mutation, double-base mutation, triple-base mutation of the normal human genotype ε3ε3 (TC / TC) and the mixed solution of four DNAs were detected in 0.1 mol / L KCl solution by RPA-CRISPR-electrochemical biosensor. The specific changes are as follows: Figure 6 (A) and (B) are three-base mutations. Figure 6 (C) and (D) are double base mutations. Figure 6 The (E) and (F) single base mutations show that the current signal change values obtained by these three base mutations are relatively low, which is almost the same as the blank control. Figure 6 As can be seen from (G) and (H), the common human normal mixed solution obtained a higher DPV signal change value compared with the mutant sequence. Figure 6 (I) is a comparison chart of the results of these samples, and the results show that the electrochemical biosensor can perform genotyping of the ApoE gene with high specificity.

[0051] Among them, the standard sequences for detection specificity in the embodiment of the present invention include DNA-1 (single base mutation), DNA-3 (single base mutation), DNA-1 (double base mutation), DNA-3 (double base mutation), DNA-1 (triple base mutation) and DNA-3 (triple base mutation), and their nucleotide sequences are shown in the sequence listing SEQ ID NO.16-21, respectively.

[0052] In a preferred embodiment of the present invention, a method for detecting clinical samples is provided, as follows: The basic purpose of developing a non-invasive RPA-CRISPR-electrochemical biosensor is to directly analyze the heterozygous or homozygous form of a specific allele in a human sample. The embodiment of the present invention uses DNA obtained from clinical samples to study the practicality of electrochemical biosensors. First, oral epithelial cell DNA is extracted and divided into two parts, one for PCR amplification and next generation sequencing, and the other for RPA-CRISPR-electrochemical biosensor simultaneous detection and comparison of the results. The results are as follows. Figure 7-Figure 9 As shown, the present invention tested three human samples respectively, and the genotypes of all of them were found to be normal ApoE ε3ε3 (TC / TC) through sequencing. At the same time, electrochemical biosensor DPV detection was performed. Figure 7-Figure 9 Figures c and d show that the current signal at the characteristic peak of ReDNA-AQ decreases, while the current signal at the characteristic peak of ReDNA-MB does not decrease significantly, which is consistent with the blank, indicating that only T exists; similarly, Figure 7-Figure 9 In Figures e and f, the current signal significantly decreases only at the characteristic peak of ReDNA-MB, indicating the presence of only C at this position. The same detection results were obtained, indicating that the genotype is the normal ApoE genotype ε3ε3 (TC / TC). Therefore, these results demonstrate that the RPA-CRISPR-electrochemical biosensor developed in this embodiment of the present invention has great potential for clinical applications, as follows: 1. Improving detection efficiency and accuracy: Time is a critical factor in clinical diagnosis. This technological integration innovation integrates RPA amplification with the CRISPR-Cas12a system, achieving a one-pot reaction that amplifies target DNA, performs nonspecific cleavage, and releases electrochemical signal molecules. Compared to traditional detection methods, this eliminates the need for cumbersome step-by-step procedures, significantly shortening the detection cycle. For example, in the diagnosis and treatment of Alzheimer's disease, immediate detection is crucial. Traditional ApoE gene detection methods, such as sequencing, have cumbersome procedures and require significant time from sample processing to results. This invention's technological integration innovation significantly shortens detection time, rapidly providing doctors with test results and enabling timely diagnosis and treatment for patients. Furthermore, this integrated design reduces errors caused by step-by-step procedures, improves detection accuracy, and lays a solid foundation for subsequent precision medicine.

[0053] 2. Adaptable to complex sample testing needs: Sample complexity is a common challenge in medical testing. Human samples often contain a variety of impurities and interfering substances, which can affect the accuracy of test results. The technological integration innovations of this invention give the sensor stronger anti-interference capabilities, enabling accurate detection of ApoE alleles in complex biological samples. Even in the presence of other substances in the sample, this technology, through its unique reaction mechanism, accurately identifies and amplifies the target DNA, minimizing the impact of impurities, thereby obtaining reliable test results and providing a more accurate basis for clinical diagnosis.

[0054] 3. Accurate identification of gene loci: Different alleles of the ApoE gene are closely related to the risk of Alzheimer's disease. Accurate identification of these allele loci is crucial for the diagnosis and prediction of the disease. The two hairpin structure probes, ReDNA-AQ and ReDNA-MB, designed by the present invention specifically bind to the T base and C base at the 112th and 158th gene loci of the ApoE allele, respectively. This precise design can accurately detect subtle differences in gene loci, and even single-base mutations can be accurately identified. In the detection of ApoE genes of different genotypes, the probe can specifically bind to the corresponding base, and the change in the electrochemical signal intuitively reflects the type of gene, providing doctors with accurate information to judge the patient's risk of disease.

[0055] 4. Assisting personalized medicine: With the development of medical technology, personalized medicine is gaining increasing attention. Different patients have different ApoE genotypes, and their disease risks and treatment options also vary. The unique probe design of the present invention can accurately perform ApoE genotyping, allowing doctors to develop personalized treatment plans based on the patient's specific genotype. For patients with high-risk genotypes, enhanced monitoring and early intervention can be implemented; for patients with low-risk genotypes, a relatively conservative treatment strategy can be adopted. This personalized medical approach can improve treatment efficacy, reduce unnecessary waste of medical resources, and improve patients' quality of life.

[0056] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. An electrochemical biosensor for ApoE allele analysis, comprising an electrode module, characterized in that: Also includes: A probe module comprising two hairpin probes, ReDNA-AQ and ReDNA-MB, for specifically binding to the T and C bases of the ApoE allele, respectively; ReDNA-AQ is prepared by modifying ReDNA with anthraquinone-2-carboxylic acid; ReDNA-MB is prepared by modifying ReDNA with reduced thiol groups and methylene blue; the nucleotide sequence of ReDNA is shown in SEQ ID NO.

1. The signal amplification module is used to integrate RPA amplification and CRISPR-Cas12a systems to achieve target DNA amplification and non-specific cleavage through a one-pot reaction, releasing electrochemical signal molecules; The electrochemical biosensor is used to analyze the homozygous or heterozygous type of ApoE alleles. Specifically, the electrochemical biosensor is subjected to two consecutive DPV tests in a KCl solution. The first test is to determine whether the 112th gene site exists as a T base alone, a C base alone, or both bases exist at the same time; the second test is to detect whether the 158th site exists as a T base alone, a C base alone, or both bases exist at the same time.

2. The electrochemical biosensor for ApoE allele analysis according to claim 1, wherein The electrode module is a gold electrode modified by electro-deposited gold nanoparticles.

3. The electrochemical biosensor for ApoE allele analysis according to claim 1, wherein The signal amplification module includes an RPA reaction system and a CRISPR-Cas12a nonspecific cleavage reaction system.

4. A method for preparing an electrochemical biosensor for ApoE allele analysis according to any one of claims 1 to 3, characterized in that: The following steps are involved: ReDNA-AQ and ReDNA-MB were dropped onto a gold electrode modified with electrodeposited gold nanoparticles to obtain ReDNA / AuNPs / Au; 6-Mercapto-1-hexanol solution was added dropwise to the ReDNA / AuNPs / Au surface for incubation to obtain MCH / ReDNA / AuNPs / Au; The RPA reaction system and the CRISPR-Cas12a nonspecific cleavage reaction system were dropped onto the MCH / ReDNA / AuNPs / Au surface for incubation to obtain the electrochemical biosensor for ApoE allele analysis.

5. The method for preparing an electrochemical biosensor for ApoE allele analysis according to claim 4, wherein: The preparation method of ReDNA-AQ comprises the following steps: Anthraquinone-2-carboxylic acid is dissolved in a buffer solution, and then 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide and N-hydroxysuccinimide are added to the above solution and stirred. Subsequently, ReDNA is added to the above solution to obtain ReDNA-AQ; ReDNA-AQ is heated and then slowly cooled for annealing to form a hairpin structure.

6. The method for preparing an electrochemical biosensor for ApoE allele analysis according to claim 4, wherein: The preparation method of ReDNA-MB comprises the following steps: The thiol- and methylene blue-modified ReDNA is subjected to a reduction reaction with TCEP to obtain ReDNA-MB; the ReDNA-MB is heated and then slowly cooled for annealing to form a hairpin structure.

7. The method for preparing an electrochemical biosensor for ApoE allele analysis according to claim 4, wherein: The preparation method of the gold electrode modified by electro-deposited gold nanoparticles comprises the following steps: A potassium chloride solution is prepared using tetrachloroauric acid solution as a basic solution, and then gold nanoparticles are deposited on the surface of a gold electrode using an electrochemical deposition method to obtain a gold electrode modified with electrodeposited gold nanoparticles.

8. The method for preparing an electrochemical biosensor for ApoE allele analysis according to claim 4, wherein: The RPA reaction system includes a primer set and MgOAc; the CRISPR-Cas12a nonspecific cleavage reaction system includes Cas12a, crRNA and ReDNA.

9. An electrochemical biosensor for ApoE allele analysis prepared by the method according to any one of claims 4 to 8.

10. Use of the electrochemical biosensor for ApoE allele analysis according to any one of claims 1 to 3 and 9 in preparing a kit for ApoE gene typing.

Images