Specific SNP site rapid detection system based on (RT) RPA-CRISPR / Cas12a and construction method and application thereof
By optimizing the CRISPR/Cas12a system, combining RPA amplification and fluorescence reporter probes, the time-consuming and labor-intensive and false positive problems of existing SNP detection methods are solved, and high-sensitivity and fast SNP site detection is achieved, which is suitable for portable detection of clinical samples.
Patent Information
- Application Number
- CN202510386926.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-08-12
AI Technical Summary
The existing SNP/SNV detection methods are time-consuming and labor-intensive, require professional equipment and operators, and have false positive interference, low sensitivity, and are difficult to widely use in clinical practice.
Optimize the CRISPR/Cas12a system, and design a portable fluorescence detection device by inserting suboptimal PAM sequences and mismatched bases after RPA amplification, combining fluorescence reporter probes to achieve rapid and accurate detection of SNP sites.
It realizes high-sensitivity SNP detection without special equipment, has a single copy level of sensitivity, short detection time, is suitable for clinical samples, and has a wide range of application prospects.
Smart Images

Figure CN120464786A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and specifically relates to a rapid detection system for specific SNP sites based on (RT)RPA-CRISPR / Cas12a, and a construction method and application thereof. Background Art
[0002] Single nucleotide polymorphisms (SNPs / SNVs) are base mutations in which one base is replaced by another. This is the most common type of base mutation in humans and the entire biological universe, accounting for over 90% of all human base mutations. SNPs / SNVs have profound impacts on humans and the biological universe. For example, human diseases can be caused by SNPs / SNVs, and pathogenic microorganisms can develop enhanced drug resistance, infectivity, and virulence due to the presence of SNPs / SNVs. Furthermore, the presence of SNPs / SNVs can lead to genetic changes that can be passed down to the next generation. Therefore, accurate detection of SNP / SNV sites is crucial.
[0003] Currently, commonly used SNP / SNV detection methods in clinical practice include Matrix-Assisted Laser Desorption / Ionization Time-of-Flight Mass Spectrometry (MALDI-TOFMS), TaqMan probe method, Sanger sequencing, high-resolution melting analysis (HRM), and KASP (Kompetitive Allele-Specific PCR) and SNaPshot methods based on specific recognition of the 3' end of PCR primers. Among them, Sanger sequencing is considered the gold standard for detecting SNP / SNV sites. However, these commonly used clinical detection methods are not only time-consuming and labor-intensive, but also require specialized equipment and operators, which limits their scope of application. Therefore, the development of more effective and convenient SNP detection methods is a major challenge currently faced.
[0004] Recent advances in the clustered regularly interspaced short palindromic repeats (CRISPR) / associated protein (Cas) system offer a promising new avenue for molecular diagnostics. Based on the CRISPR / Cas system, scientists have successfully developed a variety of sensitive, specific, and rapid detection platforms, such as SHERLOCK (Cas13a), DETECTR (Cas12a), and Cas14-DETECTR, for detecting various pathogens, including the novel coronavirus and HPV. Cas12a, also known as Cpf1, is an RNA-guided endonuclease with both cis- and trans-DNAase activity.
[0005] After targeting and recognizing double-stranded DNA (dsDNA) sequences complementary to the crRNA, Cas12a exhibits cis-cleavage activity, cleaving the dsDNA. Subsequently, activated Cas12a exhibits trans-cleavage activity, nonspecifically cleaving nearby non-target single-stranded DNA (ssDNA). Cis-cleavage of the dsDNA target by Cas12a is a prerequisite for activation of its non-specific trans-cleavage activity. This non-specific trans-cleavage activity, activated by cis-cleavage of the target gene, has been extensively evaluated and developed for nucleic acid diagnostics. By introducing a pathogen-specific target gene and a non-target ssDNA probe, CRISPR / Cas12a's cis-cleavage activity against the target gene and its trans-cleavage activity against the non-target ssDNA probe can be linked to enable rapid detection of specific pathogens. By introducing ssDNA labeled with a fluorophore and a quencher, or with a fluorophore and biotin, into the reaction system, CRISPR / Cas12a cleavage results can be visualized using fluorescence readouts or lateral flow strips.
[0006] To improve the sensitivity of CRISPR / Cas12a detection systems, it is often necessary to incorporate nucleic acid amplification techniques to increase target gene abundance. The isothermal amplification properties of recombinase polymerase amplification (RPA) technology reduce equipment requirements, opening up new avenues for breaking through laboratory boundaries. Furthermore, RPA is tolerant to background DNA and certain PCR inhibitors, such as hemoglobin, heparin, and urine, facilitating its clinical application.
[0007] Given the limitations of currently used SNP detection methods, rapid nucleic acid diagnostic technologies are rapidly developing, including toehold-mediated strand displacement, LAMP, RCA, and CRISPR / Cas. In particular, with the discovery of more Cas protein subclasses and their unique cleavage properties, numerous CRISPR / Cas-based methods for precise and rapid SNP detection have been developed. For example, the NASBACC technique, based on the CRISPR / Cas9 system, targets the SNP to be detected within the PAM sequence, thereby disrupting crRNA recognition of the target sequence. Technologies such as SHERLOCK (SHERLOCKV2) and CARMEN, based on the CRISPR / Cas13 system, can type SNPs present in template DNA / RNA. The DETECTR technique, based on the CRISPR / Cas14a system, can also type SNPs present in template DNA / RNA. In the field of SNP site detection based on the CRISPR / Cas12a system, YongChen et al. suggested inserting an additional mismatched base on crRNA that does not match the wild-type gene to increase the sensitivity of SNP site recognition. However, the final test results showed that the wild-type gene can still produce fluorescence detection signals, and there is interference from false positives. Although the IMAS-RPA method previously developed by our research group can keep the fluorescence signal of the wild-type and the blank control at the same level, it has effectively eliminated the interference of false positives. However, the sensitivity of this method in detecting SNP sites is low, only 10 4 Therefore, in order to achieve absolute distinction between wild-type and mutant (SNP sites) and high sensitivity of detection, the SNP detection method based on the CRISPR / Cas12a system needs to be further optimized. Summary of the Invention
[0008] To address these issues, this study downloaded the complete genome sequences of approximately 240 novel coronavirus variants (Omicron) from the GISAID website (https: / / www.epicov.org) and compared these sequences with the complete genome sequence of the standard wild-type strain (NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1) using MEGA-X software. The comparison revealed a single base mutation from A to G at position 17898 in the ORF1ab gene fragment, resulting in the amino acid mutation I1566V (hereafter referred to as the single base mutation site). We constructed plasmids from surrounding gene fragments containing the target SNP, I1566V, and transformed the plasmids using competent bacteria (DH5α) for plasmid amplification.
[0009] We designed RPA front and back primers near the SNP to insert the PAM sequence. The RPA primers were designed with reference to the official design manual of the RPA reagent manufacturer, and all primers were designed using Primer5 software. The reporter we used was ssDNA, modified with a FAM fluorescent group at one end and a BHQ fluorescent quencher at the other end. When the FAM fluorescent group and the BHQ quencher are linked through ssDNA, the FAM is inhibited by BHQ and no fluorescent signal is generated. However, when the CRISPR-Cas12a complex is activated and produces trans-cleavage activity, the ssDNA is cut, and the inhibitory effect of BHQ on the FAM group disappears, allowing the FAM to generate a fluorescent signal.
[0010] We have thoroughly refined and optimized our SNP detection method based on the CRISPR / Cas12a system. First, we inserted a suboptimal PAM sequence (YTTN) into the product dsDNA via (RT)RPA amplification. This reduces the efficiency of crRNA in recognizing the PAM sequence and locally opening the dsDNA to form an R-loop. After a delay in forming the R-loop, the pre-inserted mismatch in the crRNA leads to a continuous double-base mismatch between the crRNA and the wild-type dsDNA (WT-dsDNA). This results in the WT-dsDNA being unable to activate CRISPR / Cas12a cleavage activity within a short period of time, while VT-dsDNA (variant-dsDNA) can still activate CRISPR / Cas12a cleavage and generate a strong fluorescent signal. This improvement significantly improves SNP identification, reaching single-copy sensitivity. To further reduce reliance on instrumentation, in addition to conventional microplate readers, we designed a portable 3D-printed device that allows for direct visual observation of fluorescence results. This means that the entire detection process does not require the use of special instruments and equipment, greatly expanding its scope of application and having broad clinical application prospects.
[0011] In summary, the present invention provides a rapid detection system for specific SNP sites based on (RT)RPA-CRISPR / Cas12a, as well as its construction method and application.
[0012] The purpose of the present invention can be achieved through the following technical solutions: A rapid detection system for specific SNP sites based on (RT)RPA-CRISPR / Cas12a, including an RPA primer pair based on the specific SNP site I1566V in the ORF1ab gene fragment of the new coronavirus omicron variant, a reverse transcription primer, Cas12a, crRNA, and a fluorescent reporter probe labeled with a fluorescent group and a quencher group.
[0013] Furthermore, the specific SNP site I1566V in the ORF1ab gene fragment of the new coronavirus omicron variant contains the following nucleotide sequence: CTAAATTCAAAACTGAAGGTTTATGTGTTGACGTACCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTACCCTAACATGTTTATCACCCGCGAAGAAGCTATAA.
[0014] Furthermore, the RPA primer pair for the specific SNP site I1566V in the ORF1ab gene segment of the novel coronavirus omicron variant is selected from one of the Primerpair No.1 primer pair, the Primerpair No.2 primer pair, and the Primerpair No.3 primer pair; In the Primerpair No.1 primer pair: Forward primer: CTAAATTCAAAACTGAAGGTTTATGTTTTGAC; Reverse primer: TTATAGCTTCTTCGCGGGTGATAAACATGTTA; In the Primerpair No.2 primer pair: Forward primer: CTAAATTCAAAACTGAAGGTTTATGTGTTGAC; Reverse primer: TTATAGCTTCTTCGCGGGTGATAAACATGTTA; In the Primerpair No.3 primer pair: Forward primer: CTAAATTCAAAACTGAAGGTTTATGTGATGAC; Reverse primer: TTATAGCTTCTTCGCGGGTGATAAACATGTTA.
[0015] Furthermore, the reverse transcription primer is: CCAACAGCTTCTCTAGTA.
[0016] Furthermore, the nucleotide sequence of the crRNA is: 5'-UAAUUUCUACUAAGUGUAGAUACGAACCUGGCAUACCUA-3'.
[0017] Furthermore, the nucleotide sequence of the fluorescent reporter probe labeled with a fluorescent group and a quenching group is: 5'- / 6-FAM / CCGGAAAAAAAAAAAACCGG / BHQ1 / -3'.
[0018] Furthermore, the specific SNP site I1566V in the ORF1ab gene fragment of the novel coronavirus omicron variant is the RPA amplicon or RPA amplification product.
[0019] As a further embodiment of the present invention, a method for constructing a rapid detection system for specific SNP sites based on (RT)RPA-CRISPR / Cas12a comprises the following steps: S1. The full genome sequences of 240 novel coronavirus variants, Omicron, were downloaded from the GISAID website; S2. Use Mega-X software to perform sequence alignment and filter the DNA sequence in the previous step to obtain specific SNP sites in the ORF1ab gene fragment of the new coronavirus omicron variant; S3. Using Mega-X software, align the specific SNP site of the novel coronavirus variant strain Omicron obtained in the previous step with the full gene sequence of the standard wild-type strain to confirm that the site is unique to the Omicron strain and that the nearby sequence is conserved. Gene fragments surrounding the SNP-I1566V to be tested are intercepted for plasmid construction, and plasmid transformation is performed using competent bacteria DH5α. A specific RPA primer pair is designed. S4. Design RPA primer pairs using Primer5 software and verify the specificity of the RPA primer pairs using NCBI's Primer-BLAST software to obtain theoretical RPA primer pairs; S5. Using recombinase polymerase amplification reaction, screen the theoretical RPA primer pairs obtained in the previous step to obtain primer pairs Primerpair No.1, Primerpair No.2, and Primerpair No.3; S6. Perform RPA amplification reactions using primer pairs Primerpair No. 1, Primerpair No. 2, and Primerpair No. 3, respectively, to obtain three RPA amplicons with different PAM sequences, thereby obtaining surrounding gene fragments including the target gene SNP-I1566V, i.e., RPA amplicons; S7. Design crRNA that recognizes the 18 bp target sequence near the PAM site of the RPA amplicon; S8. Use BLAST program to check the specificity of crRNA sequence and obtain specific crRNA sequence.
[0020] As a further solution of the present invention, an application of a rapid detection system for specific SNP sites based on (RT)RPA-CRISPR / Cas12a is used to prepare a detection kit for detecting specific SNP sites of the new coronavirus variant Omicron.
[0021] Furthermore, the detection kit is used to detect the specific SNP sites of the new coronavirus variant Omicron, and the detection method includes the following steps: RNA is extracted from the patient's clinical specimens and reverse transcribed. The specific SNP sites of the new coronavirus variant Omicron are then amplified by RPA using cDNA and specific RPA primers to increase the abundance of the target gene. The Cas12a / crRNA binary complex is then used to perform specific cis-cleavage on the specific SNP sites of the new coronavirus variant Omicron, activating the trans-cleavage activity of the Cas12 system and cutting off the FAM-BHQ-labeled ssDNA probe. The results can be interpreted by a 3D-printed portable device with a microplate reader or by observing the fluorescence results with the naked eye.
[0022] Beneficial effects of the present invention: The detection system provided by the present invention does not require special equipment. By optimizing conditions such as the type of PAM sequence, probe concentration, and reagent ratio, the sensitivity of the RPA+CRISPR / Cas12a method for detecting SNP sites in double-stranded DNA (plasmid) can reach the single-copy level. The specificity of RT-RPA+CRISPR / Cas12a for detecting clinical samples is 100%, and it can quickly and accurately detect specific SNP sites of the new coronavirus variant Omicron within 2 hours. In an evaluation experiment involving 32 clinical samples, due to the limitations of laboratory conditions, the samples needed to be transported in transit and repeatedly frozen and thawed, resulting in degradation of SARS-COV-2 RNA. Even under these conditions, the detection system of the present invention still had a concordance rate of 96% with traditional qPCR.
[0023] The detection system of the present invention has the advantages of being rapid, portable, low-cost, requiring no special equipment, and highly operable. It has great application potential for self-testing and immediate diagnosis, and is of great significance for developing countries that lack medical equipment to carry out single nucleotide polymorphism (SNP) site detection that may have a significant impact on the occurrence, development, and medication of diseases. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The present invention will be further described below with reference to the accompanying drawings.
[0025] Figure 1 Schematic diagram of the RPA-CRISPR / Cas12a fluorescence detection system.
[0026] Figure 2 This is the construction of the RPA-CRISPR / Cas12a fluorescence detection system. A is the crRNA sequence design diagram; B is the VT / WT real-time fluorescence dynamic curve of two different PAM sequences; C is the real-time fluorescence dynamic curve of VT / WT under different reporter concentration gradients; D is the instantaneous fluorescence value and Discrimination Factor (DF) (fluorescence value of VT divided by that of WT) of different reporter concentrations when the detection time is 60 min; E is the real-time fluorescence quantitative results of CRISPR / Cas12a systems with different ratios; F is the instantaneous fluorescence value and Discrimination Factor (DF) of the CRISPR / Cas12a system with different ratios when the detection time is 60 minutes (the fluorescence value of VT divided by that of WT); G is the sensitivity detection curve of SNP detection by RPA+CRISPR / Cas12a method.
[0027] Figure 3 It is the instantaneous fluorescence value and Discrimination Factor (DF) (fluorescence value of VT divided by WT) of different reporter concentrations when the detection time is 30 minutes.
[0028] Figure 4 This is the construction of the RT-RPA-CRISPR / Cas12a fluorescence detection system. A is a flow chart of the fluorescence signal detection process using the RT-RPA-CRISPR / Cas12a fluorescence detection system, using both quantitative (microplate reader) and qualitative (visual inspection) methods. B is the structure and principle diagram of the visual inspection device; C is a comparison of the test results of 32 clinical samples using four methods: first-generation sequencing, RT-qPCR, RT-RPA-CRISPR / Cas12a fluorescence detection system microplate reader quantification, and RT-RPA-CRISPR / Cas12a fluorescence detection system 3D printing device visual inspection; D is the fluorescence value of clinical sample-specific detection by the RT-RPA-CRISPR / Cas12a fluorescence detection system for 60 minutes.
[0029] Figure 5 The results of RT-RPA reaction condition optimization are shown in the figure: A is the transient fluorescence value of two candidate reverse transcriptases, RevertAid and ProtoScript II, after 60 minutes of RT-RPA+CRISPR / Cas12a detection; B is the instantaneous fluorescence value of RT-RPA+CRISPR / Cas12a detection before and after optimization of reverse transcription time and RPA amplification conditions, with a reaction time of 60 minutes.
[0030] Figure 6This is the relationship between the fluorescence intensity measured by the RT-RPA+CRISPR / Cas12a method and the CT value of the RT-qPCR method.
[0031] Figure 7 This is the clinical sample detection result of the visual inspection method using the 3D printing device of the RT-RPA+CRISPR / Cas12a fluorescence detection system.
[0032] Figure 8 This is the real-time fluorescence dynamic curve of VT / WT when the PAM sequence is YTN. DETAILED DESCRIPTION
[0033] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0034] First, the instruments, consumables, and reagents used in the following examples are as follows: Example 1
[0035] Method for constructing a rapid detection system for specific SNP sites based on (RT)RPA-CRISPR / Cas12a: 1.1 Selection of SNPs to be tested: We downloaded the complete genome sequences of 240 novel coronavirus variants (Omicron) from the GISAID website (https: / / www.epicov.org) and compared these sequences with the complete genome sequence of the standard wild-type strain (NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1) using MEGA-X software. The comparison revealed a single base mutation from A to G at position 17898 of the ORF1ab gene fragment, resulting in the amino acid mutation I1566V (hereinafter referred to as the single base mutation site). We constructed plasmids from surrounding gene fragments containing the target SNP-I1566V and transformed them with competent bacteria DH5α for plasmid amplification.
[0036] 1.2 Design and synthesis of RPA primers: Step 1: RPA primer pair design: We designed RPA forward and backward primers near the SNP to facilitate insertion of the PAM sequence. RPA primers were designed according to the official design manual, and all primers (RPA) were designed using Primer5 software. Specific RPA primer sequences are shown in Table 1 below. RPA primers were synthesized by Qingke Biotechnology.
[0037] Table 1 RPA primer pair sequences for amplifying the I1566V gene
[0038] Step 2: Nucleic acid preparation: The strain described in step 1.1 was extracted using the TIANamp bacterial DNA extraction kit according to the manufacturer's instructions. VT-dsDNA containing the omicron variant-specific mutation site and WT-dsDNA without the omicron variant-specific mutation site were obtained. DNA concentration was measured using a NanoDrop 2000 microphotometer (Thermo, United States). The extracted DNA was stored at -20°C until use.
[0039] Step 3: RPA primer pair screening: To construct a specific and stable recombinase polymerase amplification (RPA) reaction, candidate primers were screened. Using the DNA extracted in the second step, TwistDx's recombinase polymerase amplification technology was used to amplify VT-dsDNA and WT-dsDNA using the three RPA primer pairs listed in Table 1. The primer pairs were then verified by agarose gel electrophoresis and CRISPR / Cas12a fluorescence detection.
[0040] a. Agarose gel electrophoresis: Prepare the gel to a final concentration of 2%. Add 5 μL of RPA amplification product and run the gel at 100 V for 60 minutes. Develop the gel after completion.
[0041] b.CRISPR / Cas12a fluorescence detection: See the RPA-Cas12a fluorescence detection section of Example 2.
[0042] Step 4: RPA reaction system: The RPA reaction was performed using the TwistDx commercial recombinase polymerase amplification kit according to the manufacturer's instructions at 37°C for 30 minutes (Table 2 below).
[0043] Table 2 RPA reaction system
[0044] The RPA amplicon (also called RPA product) was prepared using the TwistDx commercial recombinase polymerase amplification kit according to the reaction conditions in Table 2 above. The nucleotide sequence of the amplicon (5'-3') was as follows: CTAAATTCAAAACTGAAGGTTTATGTGTTGACGTACCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTACCCTAACATGTTTATCACCCGCGAAGAAGCTATAA. This nucleotide sequence is used as the target sequence of the detection system of the present invention and is recorded as SEQ ID NO 10.
[0045] as follows Figure 1 As shown, we first inserted a PAM sequence into the front / back primers, and then inserted a PAM sequence that can be recognized by CRISPR / Cas12a near the SNP to be detected through RPA. To reduce the impact of mismatched bases on the RPA amplification efficiency, we increased the distance between the mismatched base and the 3' end of the primer and designed the 3' end of the primer to be close to the SNP. After RPA is completed, we added the product dsDNA to the CRISPR / Cas12a system to proceed to the next step of detection. To increase the specificity of CRISPR / Cas12a in recognizing base mismatches, we inserted an additional mismatched base into the crRNA, so that VT-dsDNA forms a single base mismatch with crRNA, while WT-dsDNA forms a continuous double base mismatch with crRNA. By further optimizing the CRISPR / Cas12a reaction conditions, we found that even when there was a single-base mismatch between VT-dsDNA and crRNA, CRISPR / Cas12a's cleavage activity was still activated, generating a strong fluorescent signal. However, when there were continuous double-base mismatches between WT-dsDNA and crRNA, CRISPR / Cas12a's cleavage activity was barely activated, generating little or only a very weak fluorescent signal. This allowed us to effectively identify SNP sites. Finally, we used both qualitative (visual inspection) and quantitative (microplate reader) methods to detect the fluorescent signal.
[0046] 1.3 crRNA and ssDNA reporter gene design: When designing crRNAs, we followed the following principles: 1. The SNP site was located in the crRNA seed region: This increases CRISPR-Cas12a's sensitivity to base mismatches. 2. Selecting crRNA length: Within a certain range, CRISPR / Cas12a cleavage efficiency is positively correlated with crRNA length, while CRISPR-Cas12a's sensitivity to base mismatches is negatively correlated. Therefore, it is necessary to select an appropriate length to balance these two relationships. 3. Inserting an additional mismatched base immediately adjacent to the SNP binding site on the crRNA: To further increase CRISPR-Cas12a's sensitivity to base mismatches, we selected cognate mismatches (purine-purine or pyrimidine-pyrimidine) to increase repulsive hydrogen bonds. 4. Blast verification on the NCBI website: Candidate crRNAs that met the above requirements were blast verified on the NCBI website (www.ncbi.nlm.nih.gov) to ensure that the crRNA base sequence maintains high species specificity even when modified by mismatched bases. We used the characteristic amino acid mutation I1566V (A→G) of the novel coronavirus variant Omicron as the research object, designed a crRNA with an 18nt spacer length including SNP-I1566V, and added an additional mismatch base (A) at the site adjacent to the SNP binding site. Ultimately, VT and crRNA formed a homopurine base mismatch AA at position 4 (PAM sequence is position 0, crRNA-3' end is positive), while the wild-type strain and crRNA formed a continuous double base mismatch GT and AA at positions 3 and 4 ( Figure 2 a). Specific sequences are shown in Table 3 below.
[0047] Table 3 crRNA sequence (5'-3')
[0048] The reporter we used is ssDNA, modified with a FAM fluorescent group at one end and a BHQ fluorescent quencher at the other. When the FAM fluorescent group and the BHQ quencher are linked via ssDNA, the FAM is inhibited by BHQ and no fluorescent signal is generated. However, when the CRISPR-Cas12a complex is activated and produces trans-cleavage activity, the ssDNA is cut, and the inhibitory effect of BHQ on the FAM group disappears, allowing the FAM to generate a fluorescent signal. The specific sequences are shown in Table 4 below.
[0049] Table 4 ssDNA reporter gene sequences
[0050] The above completed the construction of the RPA-CRISPR / Cas12a detection system of the present invention, and obtained the main components of the RPA-CRISPR / Cas12a detection system, including the detection target gene sequence (RPA product), RPA primer pair, crRNA sequence and reporter probe. Example 2
[0051] RPA-CRISPR / Cas12a fluorescence detection system: In our study, we set up a 20 μL CRISPR reaction system (see Table 5 below) and then incubated the reaction system at 37°C. To monitor the reaction results, we used a Tecan Infinite 200 Pro fluorescence quantitative microplate reader with the following parameters: ambient temperature of 37°C, excitation wavelength of 492 nm, and emission wavelength of 522 nm.
[0052] Table 5 RPA-CRISPR / Cas12a fluorescence detection system
[0053] *Fluorescent ssDNA reporter is the ssDNA fluorescent reporter gene sequence shown in Table 4 above: 5'- / 6-FAM / CCGGAAAAAAAAAAAAACCGG / BHQ1 / -3'.
[0054] The RPA-CRISPR / Cas12a fluorescence detection system is a CRISPR-CAS12a-based detection system for the novel coronavirus omicron variant I1566V gene, using a fluorescent reporter probe (ssDNA) labeled with a fluorescent group and a quencher. The nucleotide sequence of the fluorescent reporter probe is: 5'- / 6-FAM / CCGGAAAAAAAAAAAAACCGG / BHQ1 / -3'.
[0055] In our experimental design (e.g. Figure 2As shown in Figure 1A), we designed the 3' end of the front primer to be adjacent to SNP-I1566V and inserted three different PAM sequences (TTTN, YTTN, YTN) into the front primer (using RPA primers Primerpair No.1, No.2, and No.3, respectively). After RPA amplification, dsDNA products containing different PAM sequences were formed near SNP-I1566V. These amplified products were then added to the CRISPR / Cas12a system for detection, with the RPA product of the wild-type plasmid (WT-dsDNA) as a negative control and enzyme-free water as a blank control. From the real-time fluorescence quantitative reaction curve (as shown in Figure 1B), the dsDNA products containing different PAM sequences were formed near SNP-I1566V. Figure 2 (As shown in Figure B) It can be seen that when the PAM sequence inserted in the front primer is TTTN, the fluorescence curve of VT-TTTN is steep, the fluorescence rise is large, and the reaction speed is fast. Although the rise of the WT-TTTN reaction curve is slightly flatter than that of VT-TTTN, there is still an obvious fluorescence signal generated, which makes it difficult to distinguish the two at various time points. When the PAM sequence inserted in the front primer is YTTN, although the reaction curve of VT-YTTN slows down significantly and the fluorescence rise is greatly reduced, the WT-YTTN reaction curve is horizontal, almost coinciding with the blank control. This shows that within the time range we monitored, the cutting activity of CRISPR / Cas12a was hardly activated by WT-YTTN. When the PAM sequence inserted in the front primer is YTN (as shown in Figure B), the fluorescence curve of VT-YTTN is slightly flatter than that of VT-TTTN, but there is still a clear fluorescence signal generated, which makes it difficult to distinguish the two at various time points. Figure 8 Even with increasing reporter concentrations, the VT-YTN reaction curve overlapped with the blank control, with no sign of increased fluorescence signal. This indicates that CRISPR / Cas12a cleavage activity had not yet been activated within the timeframe we monitored. Based on these experimental results, we selected YTTN as the PAM sequence for subsequent experiments.
[0056] In order to enhance the end-point fluorescence signal intensity and expand the difference between VT and WT, we chose the strategy of increasing the reporter concentration. Figure 2 As shown in Figure C, the real-time fluorescence dynamic curve of VT / WT was recorded under different reporter concentration gradients. We selected the fluorescence values at 30 minutes and 60 minutes to calculate the Discrimination Factor (DF) (the fluorescence value of VT divided by the fluorescence value of WT). When the reporter concentration was 10uM, the DF value reached the maximum, indicating that the difference between VT and WT was maximized (as shown in Figure 4). Figure 2 D and Figure 3 Therefore, we finally chose 10uM as the reporter concentration.
[0057] In order to optimize the ratio of the CRISPR / Cas12a reaction system, we mixed crRNA and Cas12a enzyme in different ratios, and then added VT-RPA / WT-RPA products to the CRISPR / Cas12a system with different ratios for detection. Figure 2 Figure E shows that when the ratio of crRNA to Cas12a is 1.2:1, the fluorescence curve of VT is the steepest and the fluorescence intensity at each time point is the highest, which indicates that the CRISPR / Cas12a system has the strongest cutting activity under this ratio. The fluorescence value at the 60th minute was used to calculate DF. It was found that when the ratio of crRNA to Cas12a was 1.2, DF was close to DF when the ratio was 1 (as shown in Figure 5E). Figure 2 Therefore, the ratio of crRNA to Cas12a was determined to be 1.2:1 based on comprehensive considerations. Example 3
[0058] RT-RPA-CRISPR / Cas12a fluorescence detection system / portable visual fluorescence detection system: Based on the RPA-CRISPR / Cas12a fluorescence detection system in Example 2, we continued to develop an RT-RPA-CRISPR / Cas12a fluorescence detection system with RNA as the detection object. In our study, we constructed a 20μL RT-RPA amplification system (see Table 6 below), placed the reaction system in an environment of 37°C for incubation for 30 minutes, and then added the RT-RPA product to a 20μL CRISPR reaction system (see Table 7). Then, we placed the reaction system in an environment of 37°C for incubation. In terms of result observation, we not only used the traditional fluorescence quantitative detection device (enzyme reader), but also designed a portable visual inspection device (such as Figure 4 B). This makes the entire rapid testing process simple to operate, the results easy to interpret, and the test results match those of the microplate reader. In short, this new portable fluorescent visual detection tool can effectively replace professional microplate readers, enabling the (RT)RPA+CRISPR / Cas12a method to perform rapid and accurate SNP detection in clinical and field settings, making it more suitable for point-of-care (POCT) scenarios.
[0059] Table 6 RT-RPA amplification system
[0060] *The reverse transcription primer is SEQ ID NO5 shown in Table 1 above: 5′-CCAACAGCTTCTCTAGTA-3′.
[0061] Table 7 RT-RPA-CRISPR / Cas12a fluorescence detection system
[0062] *Fluorescent ssDNA reporter is the ssDNA fluorescent reporter gene sequence shown in Table 4 above: 5'- / 6-FAM / CCGGAAAAAAAAAAAAACCGG / BHQ1 / -3'.
[0063] We first compared two candidate reverse transcriptases, RevertAid and ProtoScriptII. We performed RT-RPA+CRISPR / Cas12a assays using two Omicron clinical samples and compared the fluorescence values at 60 minutes. Figure 5 As shown in Figure A, ProtoScript II performed better than RevertAid, so we chose ProtoScript II as our reverse transcriptase. Next, we further optimized the RT-RPA reaction conditions: 1. Extending the reverse transcription time to 30 minutes; 2. Performing the RPA reaction on a shaker at 38°C and 300 rpm. After these optimization steps, the fluorescence intensity of the two Omicron clinical samples increased by 5.02-fold and 2.30-fold, respectively, compared to the pre-optimization period (see Figure 2). Figure 5 (shown in B). Example 4
[0064] Detection limit of RPA-CRISPR / Cas12a system: After optimizing the CRISPR / Cas12a reaction conditions, we tested the sensitivity of the RPA+CRISPR / Cas12a method for SNP detection. 2 Dilute to 10 0 Then, we performed RPA amplification on the plasmids of each concentration gradient (using Primerpair No.2), and added the amplified products into the CRISPR / Cas12a system for detection. Figure 2 As shown in G, the sensitivity of the RPA+CRISPR / Cas12a method in detecting SNP sites can reach the single copy level. Example 5
[0065] Clinical validation of the RT-RPA-CRISPR / Cas12a detection system: In this study, we followed the flow chart (e.g. Figure 4First, we collected 32 samples from the clinic that were verified as SARS-COV-2 positive by RT-qPCR. The CT values of these samples ranged from 13 to 37 (as shown in Figure 1). Figure 6 Then, we used RT-RPA+CRISPR / Cas12a method to detect these positive samples. Enzyme-free water was used as blank control, and 10 9 copies / μL of WT plasmid as a negative control (10 9 copies / μL is the maximum load of SARS-COV-2 virus infecting the human body).
[0066] When the CRISPR / Cas12a reaction reached the 60th minute, we used both quantitative (microplate reader) and qualitative (visual inspection) methods to detect the generated fluorescent signal (the structure and principle of the visual inspection device are shown in Figure 4 The results of the microplate reader test showed that among the 32 clinical samples, 8 clinical samples had fluorescence values lower than the negative control and were judged as negative, while the fluorescence values of the remaining 24 clinical samples were higher than the negative control and were judged as positive. The results of the visual inspection method showed that the fluorescence brightness of 24 clinical samples was stronger than the negative control and were judged as positive samples containing the tested SNP-I1566V, while the fluorescence values of the remaining 8 clinical samples were lower than the negative control and were judged as negative ( Figure 4 Middle C and Figure 7 ).
[0067] For the RT-RPA products of these 32 clinical samples, we performed secondary high-fidelity amplification (Primerpair No. 4) by PCR, and then performed first-generation sequencing on the PCR products. The sequencing results showed (e.g. Figure 4 As shown in Figure 3C, 6 samples could not be detected due to low product concentrations, 1 sample did not contain the I1566V mutation (WT), and 25 samples contained the I1566V mutation (VT).
[0068] Based on the above experimental results, the quantitative and qualitative detection methods of RT-RPA+CRISPR / Cas12a all judged six invalid samples and one WT sample as negative. Of the remaining 25 positive samples, one was also judged as negative. Therefore, the true positive rate of both detection methods was 96.0%.
[0069] To verify the specificity of the RT-RPA+CRISPR / Cas12a method, we collected various respiratory pathogen samples that had been verified as positive by qPCR or NGS methods, including influenza A virus (IAV), influenza B virus (IBV), respiratory syncytial virus (RSV), adenovirus (ADV), Mycoplasma pneumoniae (MP), human rhinovirus (HRV), Torquetenovirus (TTV), Epstein-Barr virus (EBV), herpes simplex virus I (HSVI), Chlamydia psittaci (C.psittaci) and HCoV-OC43. The positive samples of the above pathogens and the omicron samples positive for SNP-I1566V were detected by the (RT)RPA+CRISPR / Cas12a method. The results showed that only the omicron-positive samples containing I1566V produced obvious fluorescent signals, indicating that the method has a high specificity for the detection of SNP sites, with a specificity of 100% ( Figure 4 Middle D).
[0070] In summary, we have successfully optimized a method for SNP detection based on the CRISPR / Cas12a platform combined with constant temperature amplification (RT) RPA. This method has made SNP identification more effective, with sensitivity as high as the single-copy level. We have also designed a portable fluorescence visual inspection device that can directly observe the fluorescence results with the naked eye, making the entire detection process more convenient. In addition, this CRISPR / Cas12a-based rapid detection method can be further developed into a platform that can simultaneously perform species identification and SNP detection. If the portable fluorescence visual inspection device is designed as a multi-channel miniaturized device, multiple targets can be detected simultaneously, thus achieving high-throughput POCT. We believe that based on the above method, a variety of rapid diagnostic platforms can be derived, showing broader application prospects in the field of clinical diagnosis in the future.
[0071] It should be noted that, in this document, terms such as "include", "comprises" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or elements that are inherent to such process, method, article or apparatus.
[0072] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
Claims
1. A rapid detection system for specific SNP sites based on (RT)RPA-CRISPR / Cas12a, characterized in that: It includes an RPA primer pair based on the specific SNP site I1566V in the ORF1ab gene fragment of the new coronavirus omicron variant, a reverse transcription primer, Cas12a, crRNA, and a fluorescent reporter probe labeled with a fluorescent group and a quenching group.
2. A specific SNP site rapid detection system based on (RT)RPA-CRISPR / Cas12a according to claim 1, characterized in that: The specific SNP site I1566V in the ORF1ab gene fragment of the new coronavirus omicron variant contains the following nucleotide sequence: CTAAATTCAAAACTGAAGGTTTATGTGTTGACGTACCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTACCCTAACATGTTTATCACCCGCGAAGAAGCTATAA.
3. A specific SNP site rapid detection system based on (RT)RPA-CRISPR / Cas12a according to claim 1, characterized in that: The RPA primer pair for the specific SNP site I1566V in the ORF1ab gene segment of the novel coronavirus omicron variant is selected from one of the Primerpair No.1 primer pair, the Primerpair No.2 primer pair, and the Primerpair No.3 primer pair; In the Primerpair No.1 primer pair: Forward primer: CTAAATTCAAAACTGAAGGTTTATGTTTTGAC; Reverse primer: TTATAGCTTCTTCGCGGGTGATAAACATGTTA; In the Primerpair No.2 primer pair: Forward primer: CTAAATTCAAAACTGAAGGTTTATGTGTTGAC; Reverse primer: TTATAGCTTCTTCGCGGGTGATAAACATGTTA; The Primerpair No.3 primer pair: Forward primer: CTAAATTCAAAACTGAAGGTTTATGTGATGAC; Reverse primer: TTATAGCTTCTTCGCGGGTGATAAACATGTTA.
4. A specific SNP site rapid detection system based on (RT)RPA-CRISPR / Cas12a according to claim 1, characterized in that, The reverse transcription primer: CCAACAGCTTCTCTAGTA.
5. A specific SNP site rapid detection system based on (RT)RPA-CRISPR / Cas12a according to claim 1, characterized in that: The nucleotide sequence of the crRNA: 5'-UAAUUUCUACUAAGUGUAGAUACGAACCUGGCAUACCUA-3'.
6. A specific SNP site rapid detection system based on (RT)RPA-CRISPR / Cas12a according to claim 1, characterized in that, The nucleotide sequence of the fluorescent reporter probe labeled with a fluorescent group and a quenching group is: 5'- / 6-FAM / CCGGAAAAAAAAAAAAACCGG / BHQ1 / -3'.
7. A specific SNP site rapid detection system based on (RT)RPA-CRISPR / Cas12a according to claim 1, characterized in that: The specific SNP site I1566V in the ORF1ab gene fragment of the novel coronavirus omicron variant is the RPA amplicon or RPA amplification product.
8. A method for constructing a specific SNP site rapid detection system based on (RT)RPA-CRISPR / Cas12a according to any one of claims 1 to 7, characterized in that: The following steps are involved: S1. The full genome sequences of 240 novel coronavirus variants, Omicron, were downloaded from the GISAID website; S2. Use Mega-X software to perform sequence alignment and filter the DNA sequence in the previous step to obtain specific SNP sites in the ORF1ab gene fragment of the new coronavirus omicron variant; S3. Using Mega-X software, align the specific SNP site of the novel coronavirus variant strain Omicron obtained in the previous step with the full gene sequence of the standard wild-type strain to confirm that the site is unique to the Omicron strain and that the nearby sequence is conserved. Gene fragments surrounding the SNP-I1566V to be tested are intercepted for plasmid construction, and plasmid transformation is performed using competent bacteria DH5α. A specific RPA primer pair is designed. S4. Design RPA primer pairs using Primer5 software and verify the specificity of the RPA primer pairs using NCBI's Primer-BLAST software to obtain theoretical RPA primer pairs; S5. Using recombinase polymerase amplification reaction, screen the theoretical RPA primer pairs obtained in the previous step to obtain primer pairs Primerpair No.1, Primerpair No.2, and Primerpair No.3; S6. Perform RPA amplification reactions using primer pairs Primerpair No. 1, Primerpair No. 2, and Primerpair No. 3, respectively, to obtain three RPA amplicons with different PAM sequences, thereby obtaining surrounding gene fragments including the target gene SNP-I1566V, i.e., RPA amplicons; S7. Design crRNA that recognizes the 18 bp target sequence near the PAM site of the RPA amplicon; S8. Use BLAST program to check the specificity of crRNA sequence and obtain specific crRNA sequence.
9. The use of a specific SNP site rapid detection system based on (RT)RPA-CRISPR / Cas12a according to claim 1, characterized in that: Used to prepare a detection kit for detecting specific SNP sites of the new coronavirus variant Omicron.
10. The use of a specific SNP site rapid detection system based on (RT)RPA-CRISPR / Cas12a according to claim 9, characterized in that: The detection kit is used to detect the specific SNP sites of the new coronavirus variant Omicron, and the detection method includes the following steps: RNA is extracted from the patient's clinical specimens and reverse transcribed. The specific SNP sites of the new coronavirus variant Omicron are then amplified by RPA using cDNA and specific RPA primers to increase the abundance of the target gene. The Cas12a / crRNA binary complex is then used to perform specific cis-cleavage on the specific SNP sites of the new coronavirus variant Omicron, activating the trans-cleavage activity of the Cas12 system and cutting off the FAM-BHQ-labeled ssDNA probe. The results can be interpreted by a 3D-printed portable device with a microplate reader or by observing the fluorescence results with the naked eye.