Humanized COL2A1 p.G204A mutation pathogenic model as well as construction method and application thereof
By introducing humanized COL2A1 p.G204A mutation in mice, the lack of COL2A1 p.G204A pathogenic model was solved using the CRISPR-Cas9 system, providing a platform for research and treatment strategies, and realizing the construction and treatment screening of humanized models.
Patent Information
- Application Number
- CN202510457956.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-08-15
AI Technical Summary
The existing technology lacks a COL2A1 p.G204A mutation pathogenic model that artificially introduces mice and other animals, resulting in unclear pathogenic mechanism of COL2A1 p.G204A mutation and cannot develop targeted treatment plans.
Using specific sgRNA and homologous recombination templates, the humanized COL2A1 p.G204A mutation was introduced in mice using the CRISPR-Cas9 system, and a pathogenic model of stable hereditary traits was constructed by replacing exon No. 9 of the mouse COL2A1 gene.
A platform for studying the pathogenic causes of COL2A1 p.G204A mutations and developing therapeutic strategies is provided, enabling screening of gene editing sites that can be used in humans for detection and treatment of human COL2A1 p.G204A mutations.
Smart Images

Figure CN120477135A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of bioengineering and biomedicine, and further relates to the construction and application of animal disease models, and specifically to a humanized gene mutation pathogenic model and its preparation and application. Background Art
[0002] Collagen is the most abundant protein in mammals, accounting for approximately 30% of the total protein content. Type II collagen is a fibrillar collagen found primarily in cartilage, vitreous humor, inner ear, and nucleus pulposus. The COL2A1 gene encodes the α-1 chain of type II procollagen. Type II procollagen consists of three identical α-1 chains. After intracellular assembly, it is secreted into the extracellular matrix (ECM). Mature type II collagen is formed by the removal of amino and carboxyl propeptides from the procollagen. This mature type II collagen then forms a covalently cross-linked fibrous network within the ECM, providing mechanical strength to tissues.
[0003] Mutations in the COL2A1 gene cause a variety of autosomal dominant disorders known as type II collagen diseases, with a global incidence exceeding 20.4–35.9 per 100,000 individuals. Currently, 21 diseases caused by COL2A1 mutations have been identified, including achondroplasia, cervical spondylosis, spondyloepiphyseal dysplasia, avascular necrosis of the femoral head, multiple myopia and deafness, and osteoarthritis. To date, over 400 COL2A1 mutations have been reported in public databases and published literature, with over a third of these mutations being pathogenic. However, the pathogenic mechanisms of most COL2A1 mutations remain unclear. However, due to the lack of animal models, the pathogenicity of the COL2A1 p.G204A mutation remains unclear, hindering the development of targeted treatment options.
[0004] The CRISPR-Cas9 system is currently the most commonly used mammalian gene editing technology. Its basic principle is that the Cas9 protein forms an RNP complex with a small guide RNA (sgRNA). The sgRNA acts as a guide, directing the complex to a specific location in the genome. The Cas9 protein then acts as an endonuclease, causing a double-strand break (DSB) in the genome. After a DSB occurs, the cell's endogenous DNA repair system repairs the break site, primarily through non-homologous end joining and homologous recombination. After Cas9 cleaves the genome, if a DNA fragment carrying homologous sequences on either side of the DSB is present in the cell nucleus, the cell's endogenous homologous recombination enzyme system integrates this DNA fragment into the DSB site, knocking in the exogenous gene. For the COL2A1 p.G204A mutation, the prior art does not disclose a suitable sgRNA for the COL2A1 p.G204 site, nor does it disclose a homologous recombination donor for introducing p.G204A. Therefore, there is no disease model in the prior art that artificially introduces the humanized COL2A1 p.G204A mutation into animals such as mice. Summary of the Invention
[0005] After extensive creative work, the inventors surprisingly discovered that, using a specific sgRNA and homologous recombination template, and utilizing the CRISPR-Cas9 system, they can artificially generate an experimental animal system with stable genetic traits and containing the humanized COL2A1 p.G204A mutation. This system can serve as a mutation-induced pathogenic model for studying the pathogenic mechanism of this mutation, developing treatment strategies, and conducting animal drug experiments. In one embodiment, in the humanized COL2A1 p.G204A mutation pathogenic model of the present invention, exon 9 (exon 9) of the type II procollagen α-1 chain (COL2A1) gene of the mouse is replaced with exon 9 of the human COL2A1 gene carrying the p.G204A mutation.
[0006] Preferably, the humanized COL2A1 p.G204A mutation pathogenic model of the present invention further comprises human COL2A1-exon 9 upstream and downstream DNA sequences.
[0007] Preferably, in the humanized COL2A1 p.G204A mutation pathogenic model of the present invention, the upstream DNA sequence of human COL2A1-exon 9 is 77 bp, and the downstream DNA sequence is 59 bp.
[0008] Preferably, in the humanized COL2A1 p.G204A mutation pathogenic model of the present invention, the homologous recombination template used to introduce the p.G204A mutation is:
[0009] Left homologous arm: ggaagtgattctaccactgtcgcaagggcacactcccaaaacgttgtcagatccctttggcaattctg accaacgctgctcggctagtccctgataaccagagactaggtagaactccgagcaattaggaatgacaccagggcctctcagccccctaacacggctctgttgctttgcagaacttcgcggctcagatggctggagggtatgacgagaaggctggtggtgcccagatgggagtcatgcaagggcccatggtaggattccagttctgtgctgaccggacgggaggagggcacctttcgcaaagccagagacccagcaacctctgccttcgccgatgatttagggcatctcatttccatcagctatgggaaacctctcatttaaccctggggagtttggtttttaatggtgatggatgccagtctggatgacgctctagtgtgtctaggaggaagggggacggagtgatgcacaga gccgatgtattagggggctggttgccactgctcttggaaggagaactgaagaatgcagacagcagcgactgttcttcagcatccaccaggcttccagcaggaaatctcaccctgcagcgatggcttggcacatgctaaatgaaattcagactttagtaaacatggccgccatccaggagggagcaaggccagcgtctcggtccaaatggggcctataaataaagatagatggttgagtggggagtgggaaagaagagggagcagccgctggagtccctttgcccctccccctcctgctcccttactatcttcttgtc
[0010] Human COL2A1-exon 9: taacttcttgtcctttgcccgggctgttggctgggagaagatggcaagtaaaccc ctcattttctgttccgatgcaggcccccatgggacctcgaggacctccaggccctgcaggtgctcctgtaagtatctgcaattc tttttgcctccatcgtgtcgcagatgattcccaagcactatg
[0011] Right homology arm: cggcacagcttggaggtcaacatggcgtccttatttccccttttagggccctcaaggatttcaagg caatcctggtgaacctggcgagcctggtgtctctgtgagtaccacaggctaccctctcccaggaggctctggggacaatcttctacccaagctaccgtctgctcccaggctctgccagccctttcccacaatgggagtgccttacccacggggcacaacggcagagaatcaatatggcagga actccatcgggacacttccccttaggggtcgccagcctgcgcagtcccctcctcccaccatgatctgctttacagttttgttacctttttgtctctcttccttgtagagtaactagcttccaaagcgaccgcctcgagttgtgtttcccttccaaccaggtcttgaattctctatttgta gggtcccatgggtccccgaggtcctcctggccctgctggaaaacctggtgacgacgtgagtagacccaagaagccccagacccagagagaggatgtgctggggcttggggtagagagacgtcctgaggaaccaggctagccagtcctaaattccagctatctaccacccacatatcctttatt tgcatctcagcttgccagatccctggggatccctttagatcccaagaaggagagtaattaaaaacatcattaacttcgggaagagaaatgagaaaggagagagccagccgggatgggaggactcaaagcacagcggtatagagtagaaaaacaaagcaagagtcggtcaacaaacaggctac
[0012] In one embodiment, the method for preparing a humanized COL2A1 p.G204A mutation pathogenic model of the present invention comprises the following steps:
[0013] (1) Provide sgRNA and Cas9-mRNA for mouse COL2A1-exon 9 excision;
[0014] (2) Provide the DNA sequences upstream and downstream of the left Cas9 cleavage site of mouse COL2A1-exon 9 as the left homology arm and right homology arm, and provide the human COL2A1-exon 9 DNA sequence carrying the p.G204A mutation as the replacement insertion sequence;
[0015] (3) The left and right homology arms and the replacement insertion sequence were integrated together as a homologous recombination template for mouse model construction and as a donor;
[0016] (4) injecting the sgRNA, Cas9-mRNA, and donor obtained in the previous step into a mouse fertilized egg to obtain the F0 generation developed from the fertilized egg;
[0017] (5) Crossbreeding F0 generation mice with wild mice to obtain F1 generation;
[0018] (6) F1 generation heterozygous knock-in female mice were caged together with heterozygous knock-in male mice and self-bred to obtain the F2 generation.
[0019] Preferably, the sgRNA used in the present invention is selected from one or more of the group consisting of the following sequences:
[0020] COL2A1-exon 9-left-sg1:5'aataaagatagatggttgag tgg3'
[0021] COL2A1-exon 9-left-sg2:5'ataaagatagatggttgagt ggg3'
[0022] COL2A1-exon 9-left-sg3:5'taaagatagatggttgagtg ggg3'
[0023] COL2A1-exon 9-left-sg4: 5'gaggggcaaagggactccag cgg3'
[0024] COL2A1-exon 9-left-sg5:5'ctaggattccatcttagaag agg3'
[0025] COL2A1-exon 9-left-sg6:5'agaaaaaacgagacgcttac tgg3'
[0026] COL2A1-exon 9-right-sg1:5'gcatctacagcgcccccaag agg3'
[0027] COL2A1-exon 9-right-sg2:5'gatgctcatcatccacatga cgg3'
[0028] COL2A1-exon 9-right-sg3:5'caagctgtgccgccgtcatg tgg3'
[0029] COL2A1-exon 9-right-sg4: 5'gctcatcatccacatgacgg cgg3'
[0030] COL2A1-exon 9-right-sg5:5'atgacggcggcacagcttgg agg3'
[0031] COL2A1-exon 9-right-sg6:5'gcacagcttggaggtcaaca tgg3'
[0032] Among them, further preferred sgRNAs include:
[0033] (1)Mouse-COL2A1-exon 9-Left-sgRNA:5'ctaggattccatcttagaag agg3'
[0034] (2)Mouse-COL2A1-exon 9-Right-sgRNA:5'gatgctcatcatccacatga cgg3'
[0035] Preferably, in step (3), the human COL2A1-exon 9 DNA sequence includes 77 bp upstream and 59 bp downstream DNA sequences of exon 9, and these DNA sequences can cover the corresponding Cas9 cutting site in the mouse genome.
[0036] Preferably, in step (4), the In Fusion cloning method is used to integrate the left and right homology arms and the replacement insertion sequence together.
[0037] Preferably, in step (5), fertilized eggs obtained by hybridization of C57BL6 mice and DBA mice are used.
[0038] Preferably, in step (6), the parents of the F1 generation are F0 generation and wild-type C57BL6 mice.
[0039] Preferably, in step (5) and step (6), genotype detection is performed on F0 and F1 generation newborn mice to screen out individuals carrying the COL2A1 p.G204A mutation.
[0040] Preferably, the preparation method of the present invention further comprises:
[0041] (8) Genetic identification was performed on the F2 generation mice, and heterozygous knock-in mice and homozygous knock-in mice were raised separately.
[0042] In one embodiment, the present invention also relates to uses of a humanized COL2A1 p.G204A mutation pathogenic model, including uses for preparing a kit for detecting the human COL2A1 p.G204A mutation, uses for preparing or screening drugs for preventing or treating the human COL2A1 p.G204A mutation, and uses for testing the effectiveness and / or efficacy of drugs for preventing or treating the human COL2A1 p.G204A mutation.
[0043] Beneficial effects
[0044] The present invention designed and constructed a humanized COL2A1 p.G204A mouse model. p.G204 is located in exon 9 of the human and mouse COL2A1 genes. Exon 9 encodes the same amino acid sequence in both human and mouse COL2A1 genes. Substituting the human COL2A1 exon 9 sequence carrying the p.G204A mutation for exon 9 of the mouse COL2A1 gene does not introduce additional amino acid mutations, as the protein sequence encoded by exon 9 of the human and mouse COL2A1 genes is identical. This substitution of the human exon allows for screening of gene editing sites applicable to humans during the development of gene editing therapeutic strategies for COL2A1 p.G204A. This mouse model can be used not only to study the pathogenicity of the COL2A1 p.G204A mutation but also to develop gene therapy strategies for this mutation, including detection kits and preventive and / or therapeutic drugs. BRIEF DESCRIPTION OF THE DRAWINGS
[0045] Figure 1 This is a schematic diagram of the knock-in principle of the human COL2A1-exon 9 gene of the present invention;
[0046] Figure 2 This is a diagram of the sgRNA screening results of the present invention;
[0047] Figure 3 Schematic diagram of the construction of the homologous recombination template (donor) of the present invention;
[0048] Figure 4 Schematic diagram of the mouse genotype identification method of the present invention;
[0049] Figure 5 This is the nucleic acid electrophoresis diagram for the mouse genotype identification of the present invention. DETAILED DESCRIPTION
[0050] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.
[0051] Example 1
[0052] This example exemplifies the method for obtaining the sgRNA of the present invention.
[0053] (1) Design and screening of mouse COL2A1 gene exon 9 knockout sgRNA
[0054] The mouse COL2A1 gene sequence (Gene ID: 12824) was downloaded from the NCBI database. Six sgRNAs (PAM: 5'NGG3') were designed targeting introns 8 and 9 of the mouse COL2A1 gene. The sgRNAs designed for intron 8 are designated COL2A1-exon 9-left-sg1-6, and the sgRNAs designed for intron 9 are designated COL2A1-exon9-right-sg1-6. The synthesized sgRNA sequences were ligated into the px459 plasmid using the T4 ligation method to construct the U6-sgRNA and CMV-Cas9 expression plasmids. Mouse Hapa1-6 cells were seeded in 24-well plates and transfected with 500 ng of the U6-sgRNA and CMV-Cas9 plasmids per well 24 hours after plating. The medium was changed 24 hours after transfection, and the cells were drug-selected (2 μg / ml puromycin) 48 hours later. After 72 hours, the cells were harvested and digested. The collected cells were subjected to T7 enzyme digestion assay to identify the Cas9-sgRNA gene editing efficiency. The results are as follows: Figure 2 As shown, the COL2A1-exon 9-right-sg5 with the highest efficiency was renamed as Mouse-COL2A1-exon 9-Left-sgRNA, and COL2A1-exon 9-right-sg2 was renamed as Mouse-COL2A1-exon 9-Right-sgRNA for the next experiment.
[0055] The sgRNA sequences are as follows:
[0056] COL2A1-exon 9-left-sg1:5'aataaagatagatggttgag tgg3'
[0057] COL2A1-exon 9-left-sg2:5'ataaagatagatggttgagt ggg3'
[0058] COL2A1-exon 9-left-sg3:5'taaagatagatggttgagtg ggg3'
[0059] COL2A1-exon 9-left-sg4: 5'gaggggcaaagggactccag cgg3'
[0060] COL2A1-exon 9-left-sg5:5'ctaggattccatcttagaag agg3'
[0061] COL2A1-exon 9-left-sg6:5'agaaaaaacgagacgcttac tgg3'
[0062] COL2A1-exon 9-right-sg1:5'gcatctacagcgcccccaag agg3'
[0063] COL2A1-exon 9-right-sg2:5'gatgctcatcatccacatga cgg3'
[0064] COL2A1-exon 9-right-sg3:5'caagctgtgccgccgtcatg tgg3'
[0065] COL2A1-exon 9-right-sg4: 5'gctcatcatccacatgacgg cgg3'
[0066] COL2A1-exon 9-right-sg5:5'atgacggcggcacagcttgg agg3'
[0067] COL2A1-exon 9-right-sg6:5'gcacagcttggaggtcaaca tgg3'
[0068] (2) Obtaining purified sgRNA and Cas9-mRNA through in vitro transcription reaction
[0069] Using the Mouse-COL2A1-exon 9-Left-sgRNA plasmid and the Mouse-COL2A1-exon9-Right-sgRNA plasmid as templates, PCR was performed to amplify the entire sgRNA using primers containing a T7 promoter sequence. The PCR system included 25 μL of PCR enzyme, 1 μL of plasmid template, 2 μL of each 10 μM primer, and 20 μL of water. The PCR reaction procedure was as follows: 94°C for 5 min; (94°C for 10 s; 50°C for 10 s; and 68°C for 10 s). x 35 ; 68°C, 7 min; 16°C, ∞. The amplified product (dsDNA) was used as a template for in vitro transcription using a T7 in vitro transcription kit. The in vitro transcription system included 1 μg of dsDNA template, 2 μL of T7 RNA polymerase, 2 μL each of CTP / GTP / ATP / UTP, 2 μL of Transcription Buffer, and water to 20 μL. In vitro transcription reaction: 37°C, 2 h. Oligo Clean & Concentrator was used. TM The sgRNA was purified and recovered using a kit.
[0070] Using the px458 plasmid as a template, the Cas9 coding sequence was amplified by PCR using primers containing the T7 promoter sequence. The PCR system included 25 μL of PCR enzyme, 1 μL of plasmid template, 2 μL of each 10 μM primer, and 20 μL of water. PCR reaction procedure: 94°C for 5 minutes; (94°C for 10 seconds; 60°C for 10 seconds; 68°C for 3 minutes) x 35 ; 68°C, 7 min; 16°C, ∞. The amplified product (dsDNA) was used as a template for in vitro transcription using a T7 in vitro transcription kit. The in vitro transcription system included 1 μg of dsDNA template, 2 μL of T7 RNA polymerase, 2 μL of GAG, 2 μL each of CTP / GTP / ATP / N1-Me-Pseudo UTP, 2 μL of Transcription Buffer, and water to 20 μL. In vitro transcription reaction: 37°C, 4 h. Use Oligo Clean & Concentrator TM The kit was used to purify and recover Cas9-mRNA.
[0071] The primer sequences are as follows:
[0072] T7-Mouse-COL2A1-exon 9-Left-sgRNA-F: 5'taatacgactcactatagggctaggattcca
[0073] tcttagaag3'
[0074] T7-Mouse-COL2A1-exon 9-Left-sgRNA-R: 5'aaaaaagcaccgactcg3'
[0075] T7-Mouse-COL2A1-exon 9-Right-sgRNA-F:5'taatacgactcactataggggatgctcatcatccacatga3'
[0076] T7-Mouse-COL2A1-exon 9-Right-sgRNA-R: 5'aaaaaagcaccgactcg3'
[0077] T7-px458-Cas9-F:5'taatacgactcactatagggccaccatg3'
[0078] T7-px458-Cas9-R: 5'gaggctgatcagcgagctctagttag3'
[0079] Example 2
[0080] This example exemplifies the construction of a homologous recombination template (donor) for gene knock-in.
[0081] The tails of wild-type C57BL / 6 mice were excised and lysed with tissue lysis buffer. The tails were used as mouse genomic templates. PCR amplification was performed to amplify approximately 800 bp of DNA sequence upstream of the Cas9 cleavage site on the left side of COL2A1-exon 9 (primers: Mouse-COL2A1-exon 9-Left arm-F and Mouse-COL2A1-exon 9-Left arm-R) and approximately 800 bp of DNA sequence downstream of the Cas9 cleavage site on the right side of COL2A1-exon 9 (primers: Mouse-COL2A1-exon 9-Right arm-F and Mouse-COL2A1-exon 9-Right arm-R). These sequences served as the left and right homology arms of the homologous recombination template. The PCR system consisted of 25 μL of PCR enzyme, 2 μL of genomic template, 1 μL of each 10 μM primer, and 22 μL of water. PCR reaction program: 94°C, 5 min; (94°C, 10 s; 58°C, 10 s; 68°C, 30 s) x35 ; 68°C, 7 min; 16°C, ∞. The left and right homology arm DNA fragments were purified by gel recovery experiment.
[0082] 293T cells (Punosai CL-0005) were lysed with cell lysate and used as a human genome template. Two rounds of PCR reactions were performed to amplify the human COL2A1-exon 9 DNA sequence carrying the COL2A1 p.G204A mutation (including the 77bp upstream and 59bp downstream DNA sequences of exon 9, covering the corresponding Cas9 cutting site in the mouse genome to prevent Cas9 from cutting the donor). In the first round of PCR, the upstream fragment of the human COL2A1-exon 9 sequence was amplified using primers F1 (Human-COL2A1-exon 9-F1) and R1 (Human-COL2A1-exon 9-R1) with a point mutation, and the downstream fragment of the human COL2A1-exon 9 sequence was amplified using primers F2 (Human-COL2A1-exon 9-F2) and R2 (Human-COL2A1-exon 9-R2) with a point mutation. In the second round of PCR (overlap-PCR), 2 μL of the first-round PCR product was used as a template, and the complete human COL2A1-exon 9 DNA sequence carrying the COL2A1 p.G204A mutation was amplified using primers F1 (Human-COL2A1-exon 9-F1) and R2 (Human-COL2A1-exon 9-R2). First-round PCR reaction system: 10 μL PCR enzyme, 1 μL genomic template, 2 μL each of 10 μM primers, 7 μL water. PCR reaction program: 94°C, 5 min; (94°C, 10 s; 58°C, 10 s; 68°C, 15 s) x35 ; 68°C, 7 min; 16°C, ∞. Second-round PCR reaction system: 25 μL of PCR enzyme, 2 μL each of upstream and downstream products from the first round of PCR, 2 μL each of 10 μM primers, 17 μL of water. PCR reaction procedure: 94°C, 5 min; (94°C, 10 s; 58°C, 10 s; 68°C, 30 s) x35 The second-round PCR product was purified by gel recovery.
[0083] The gel-recovered products were then used to construct a "left homology arm-human COL2A1-exon 9-right homology arm" fragment using Overlap-PCR. The Overlap-PCR system consisted of 50 ng of the left homology arm, 50 ng of the right homology arm, 50 ng of the human COL2A1-exon 9 DNA fragment, 25 μL of PCR enzyme, 2 μL each of 10 μM primers (Mouse-COL2A1-exon 9-Left arm-F and Mouse-COL2A1-exon9-Right arm-R), and water to a final volume of 50 μL. PCR program: 94°C, 5 min; (94°C, 10 s; 58°C, 10 s; 68°C, 1 min) x35 ; 68°C, 7 min; 16°C, ∞. The PCR product was purified by gel recovery, and the double-stranded DNA was used as the homologous recombination donor for gene knock-in.
[0084] The primer sequences are as follows:
[0085] Mouse-COL2A1-exon 9-Left arm-F:5'ggaagtgattctaccactgtcgc3'
[0086] Mouse-COL2A1-exon 9-Left arm-R:5'gacaagaagatagtaagggagcaggag3'
[0087] Mouse-COL2A1-exon 9-Right arm-F:5'cggcacagcttggaggtc3'
[0088] Mouse-COL2A1-exon 9-Right arm-R:5'gtagcctgtttgttgaccgactc3'
[0089] Human-COL2A1-exon 9-F1:5'tactatcttcttgtctaacttcttgtcctttgcccggg3'
[0090] Human-COL2A1-exon 9-R1:5'gggcctgcatcggaacag3'
[0091] Human-COL2A1-exon 9-F2:5'ctgttccgatgcaggccc3'
[0092] Human-COL2A1-exon 9-R2: 5'ctccaagctgtgccgcatagtgcttgggaatcatctgcg3'
[0093] Example 3
[0094] This example exemplifies the process of generating F0 generation mice.
[0095] 1 pg each of the sgRNA, Cas9-mRNA, and donor obtained in the above steps were mixed and injected into fertilized eggs of a cross between C57BL6 mice and DBA mice. The fertilized eggs were then injected into the uterus of surrogate mothers. Twenty fertilized eggs were injected into each mother, and the mice born were designated as F0 generation.
[0096] One week after birth, F0 mice were genotyped. The toes of the mice were clipped and lysed with tissue lysis buffer. The genomic template was used for PCR with two primer pairs to amplify the COL2A1-exon 9 target fragment. The first primer pair (Mouse-COL2A1-E9-F and Mouse-COL2A1-E9-R) binds to introns 8 and 9 of the mouse COL2A1 gene, respectively. The second primer pair (Human-COL2A1-E9-F and Human-COL2A1-E9-R) binds to the human COL2A1 sequence. Only mice with successful knock-in of the human COL2A1-exon 9 sequence showed amplified bands. The PCR reaction system consisted of 25 μL of PCR enzyme, 1 μL of genomic template, 2 μL of each 10 μM primer, and 20 μL of water. The PCR reaction protocol was: 94°C for 5 min; (94°C for 10 s; 58°C for 10 s; and 68°C for 15 s). x35 ; 68°C, 7 min; 16°C, ∞. To determine whether the knock-in type is heterozygous or homozygous, it is necessary to recover the PCR product amplified by the first pair of primers (Mouse-COL2A1-E9-F and Mouse-COL2A1-E9-R) from a gel. The target fragment is ligated into the T vector via TA cloning, transformed into competent E. coli, and a single colony is selected. Sanger sequencing is performed using universal primers M13-F / R to determine whether the mouse genotype is heterozygous or homozygous.
[0097] The primer sequences are as follows:
[0098] Mouse-COL2A1-E9-F:5'agccgatgtattaggggc3'
[0099] Mouse-COL2A1-E9-R:5'acggtagcttgggtagaagat3'
[0100] Human-COL2A1-E9-F:5'taacttcttgtcctttgcccggg3'
[0101] Human-COL2A1-E9-R: 5'catagtgcttgggaatcatctgcg3'
[0102] Example 4
[0103] This example exemplifies the process of generating F1 and F2 generation mice.
[0104] (1) Backcrossing of F0 mice with C57BL6 mice
[0105] Female F0 mice carrying the COL2A1 p.G204A mutation were backcrossed with wild-type male C57BL6 mice 8 weeks after birth, and male F0 mice carrying the COL2A1 p.G204A mutation were backcrossed with wild-type female C57BL6 mice 8 weeks after birth. The mice born from the F0 generation were designated as the F1 generation;
[0106] (2) Self-fertilization of F1 mice
[0107] The F1 generation of mice was genetically identified according to the above genotyping process. Female mice carrying the COL2A1 p.G204A mutation were co-bred with male mice carrying the COL2A1 p.G204A mutation and self-crossed. The mice born from the F1 generation were designated as the F2 generation.
[0108] (3) Genetic identification and cage separation of F2 generation mice
[0109] The F2 generation mice were genetically identified according to the above genotyping process. The F2 generation mice carrying the COL2A1 p.G204A mutation were designated as the humanized COL2A1 p.G204A mouse disease model. The heterozygous knock-in mice and homozygous knock-in mice were raised separately to facilitate subsequent analysis of the effects of heterozygous and homozygous mutations on the progression of the disease in mice.
[0110] Example 5
[0111] This example exemplifies the use of the disease model of the present invention.
[0112] The disease model presented herein can be used to study the pathogenic mechanisms of the COL2A1 p.G204A mutation. Although clinical studies have reported symptoms and family histories in patients carrying the COL2A1 p.G204A mutation, the pathogenic mechanism of this point mutation remains unclear. Directly studying the pathogenic mechanism in humans is unethical. Using a humanized COL2A1 p.G204A mutation model as a surrogate for humans, techniques such as RNA sequencing, protein structure analysis, and proteomics analysis can be used to investigate the causes of COL2A1 p.G204A-induced disease in these populations.
[0113] Given the emergence of various gene editing technologies, the disease model of the present invention can also be used to study gene therapy strategies for treating COL2A1p.G204A. For genetic diseases caused by single-base mutations, base editing and primer editing tools can effectively correct base mutations, thereby providing therapeutic effects. Because the disease model of the present invention is a humanized disease model containing the human COL2A1-exon 9 sequence, it can be used to screen for gene editing sites applicable to humans.
[0114] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications or substitutions that can be easily conceived by a person skilled in the art within the technical scope disclosed in the present invention should be included in the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be based on the scope of protection of the claims.
Claims
1. A humanized collagen gene mutation pathogenic model, characterized in that: Gene editing technology was used to cut the mouse type II procollagen α-1 chain (COL2A1) gene, and the human COL2A1 pathogenic mutation gene was replaced into the mouse genome through homologous recombination repair technology to generate a humanized animal model carrying human genes.
2. The model according to claim 1, characterized in that In this model, exon 9 of the type II procollagen α-1 chain (COL2A1) gene of mice is replaced with exon 9 of the human COL2A1 gene having the p.G204A mutation.
3. The model according to claim 1 or 2, characterized in that The model includes human COL2A1-exon 9 upstream and downstream DNA sequences.
4. The model according to any one of claims 1 to 3, characterized in that In the model, the upstream DNA sequence of exon 9 is 77 bp, and the downstream DNA sequence is 59 bp.
5. The model according to any one of claims 1 to 4, characterized in that The homologous recombination template construction structure used in the homologous recombination repair technology includes a left homologous arm-human gene fragment-right homologous arm structure, and the human gene fragment includes a base replacement sequence of a pathogenic mutation, and the pathogenic mutation preferably includes a p.G204A mutation.
6. The model according to claim 5, characterized in that The homologous recombination template for introducing the p.G204A mutation comprises: Left homologous arm: ggaagtgattctaccactgtcgcaagggcacactcccaaaacgttgtcagatccctttggcaattctg accaacgctgctcggctagtccctgataaccagagactaggtagaactccgagcaattaggaatgacaccagggcctctcagccccctaacacggctctgttgctttgcagaacttcgcggctcagatggctggagggtatgacgagaaggctggtggtgcccagatgggagtcatgcaagggcccatggtaggattccagttctgtgctgaccggacgggaggagggcacctttcgcaaagccagagacccagcaacctctgccttcgccgatgatttagggcatctcatttccatcagctatgggaaacctctcatttaaccctggggagtttggtttttaatggtgatggatgccagtctggatgacgctctagtgtgtctaggaggaagggggacggagtgatgcacagagccgatgtattagggggctggttgccactgctcttggaaggagaactgaagaatgcagacagcagcgactgttcttcagcatccaccaggcttccagcaggaaatctcaccctgcagcgatggcttggcacatgctaaatgaaattcagactttagtaaacatggccgccatccaggagggagcaaggccagcgtctcggtccaaatggggcctataaataaagatagatggttgagtggggagtgggaaagaagagggagcagccgctggagtccctttgcccctccccctcctgctcccttactatcttcttgtc, Human COL2A1-exon 9: taacttcttgtcctttgcccgggctgttggctgggagaagatggcaagtaaacccctcattttctgttccgatgcaggcccccatgggacctcgaggacctccaggccctgcaggtgctcctgtaagtatctgcaatt ctttttgcctccatcgtgtcgcagatgattcccaagcactatg, Right homologous arm: cggcacagcttggaggtcaacatggcgtccttatttccccttttagggccctcaaggatttcaagg caatcctggtgaacctggcgagcctggtgtctctgtgagtaccacaggctaccctctcccaggaggctctggggacaatcttctacccaagctaccgtctgctcccaggctctgccagccctttcccacaatgggagtgccttacccacggggcacaacggcagagaatcaatatggcaggaactccatcgggacacttccccttaggggtcgccagcctgcgcagtcccctcctcccaccatgatctgctttacagttttgttactacctttttgtctctcttccttgtagagtaactagcttccaaagcgaccgcctcgagttgtgtttcccttccaaccaggtcttgaattctctatttgtagggtcccatgggtccccgaggtcctcctggccctgctggaaaacctggtgacgacgtgagtagacccaagaagccccagacccagagagaggatgtgctggggcttggggtagagagacgtcctgaggaaccaggctagccagtcctaaattccagctatctaccacccacatatcctttatttgcatctcagcttgccagatccctggggatccctttagatcccacaagaaggagagtaattaaaacatcattaacttcgggaagagaaatgagaaaggagagagccagccgggatgggaggactcaaagcacagcggtatagagtagaaaaacaaagcaagagtcggtcaacaaacaggctac。 7. The model according to any one of claims 1 to 6, characterized in that In the said model, the primers for preparing the said homologous recombination template include: (1) Mouse-COL2A1-exon 9-Left arm-F: 5’ggaagtgattctaccactgtcgc3’; (2) Mouse-COL2A1-exon 9-Left arm-R: 5’gacaagaagatagtaagggagcaggag3’; (3)Mouse-COL2A1-exon 9-Right arm-F:5'cggcacagcttggaggtc3'; (4)Mouse-COL2A1-exon 9-Right arm-R:5'gtagcctgtttgttgaccgactc3'; (5)Human-COL2A1-exon 9-F1: 5'tactatcttcttgtctaacttcttgtcctttgcccggg3'; (6)Human-COL2A1-exon 9-R1: 5'gggcctgcatcggaacag3'; (7)Human-COL2A1-exon 9-F2: 5'ctgttccgatgcaggccc3'; (8) Human-COL2A1-exon 9-R2: 5'ctccaagctgtgccgcatagtgcttgggaatcatctgcg3'.
8. A method for preparing a humanized collagen gene mutation pathogenic model according to any one of claims 1 to 7, characterized in that: The following steps are involved: (1) Provide sgRNA and Cas9-mRNA for mouse COL2A1-exon 9 excision; (2) providing the DNA sequence upstream of the Cas9 cleavage site on the left side of mouse COL2A1-exon 9 and the DNA sequence downstream of the Cas9 cleavage site on the right side of COL2A1-exon 9 as the left and right homology arms; (3) provide a human COL2A1-exon 9 DNA sequence carrying the p.G204A mutation as a replacement insert sequence; (4) Integrate the left and right homologous arms and the replacement insertion sequence together to form a homologous recombination template for mouse model construction, which serves as the donor; (5) injecting the sgRNA, Cas9-mRNA, and donor obtained in the previous step into a mouse fertilized egg to obtain the F0 generation developed from the fertilized egg; (6) Crossbreeding F0 generation mice with wild mice to obtain F1 generation; (7) Self-fertilizing F1 generation heterozygous knock-in female mice with heterozygous knock-in male mice to obtain F2 generation; (8) Genetic identification was performed on the F2 generation mice, and heterozygous knock-in mice and homozygous knock-in mice were raised separately.
9. The method according to claim 8, characterized in that The sgRNA is selected from: (A) One or more of the following: (1)COL2A1-exon 9-left-sg1:5'aataaagatagatggttgag tgg3', (2)COL2A1-exon 9-left-sg2: 5'ataaagatagatggttgagt ggg3', (3)COL2A1-exon 9-left-sg3: 5'taaagatagatggttgagtg ggg3', (4)COL2A1-exon 9-left-sg4: 5'gaggggcaaagggactccag cgg3', (5)COL2A1-exon 9-left-sg5: 5'ctaggattccatcttagaag agg3', (6)COL2A1-exon 9-left-sg6: 5'agaaaaaacgagacgcttac tgg3'; and (B) one or more of the group consisting of the following sequences: (7)COL2A1-exon 9-right-sg1:5'gcatctacagcgcccccaag agg3', (8)COL2A1-exon 9-right-sg2: 5'gatgctcatcatccacatga cgg3', (9)COL2A1-exon 9-right-sg3: 5'caagctgtgccgccgtcatg tgg3', (10)COL2A1-exon 9-right-sg4:5'gctcatcatccacatgacgg cgg3', (11)COL2A1-exon 9-right-sg5: 5'atgacggcggcacagcttgg agg3', (12)COL2A1-exon 9-right-sg6: 5'gcacagcttggaggtcaaca tgg3'; Preferred sgRNAs include: (5)COL2A1-exon 9-left-sg5, namely Mouse-COL2A1-exon 9-Left-sgRNA: 5'ctaggattccatcttagaag agg3', (8) COL2A1-exon 9-right-sg2, namely Mouse-COL2A1-exon 9-Right-sgRNA:5'gatgctcatcatccacatga cgg3'; Preferably, the sgRNA is used for fertilized egg injection.
10. Use of the humanized collagen gene mutation pathogenic model according to claims 1 to 7, or the humanized collagen gene mutation pathogenic model prepared by the preparation method according to claims 8 to 9, characterized in that: The uses include: preparing a kit for detecting the human COL2A1 p.G204A mutation, preparing or screening drugs for preventing or treating the human COL2A1 p.G204A mutation, and testing the effectiveness and / or efficacy of drugs for treating the human COL2A1 p.G204A mutation.