Recombinant Escherichia coli, construction method thereof and application of recombinant Escherichia coli in production of indoleacetic acid

Abstract

The invention provides recombinant escherichia coli, a construction method of the recombinant escherichia coli and application of the recombinant escherichia coli in production of indoleacetic acid, and belongs to the technical field of synthetic biology and microbial metabolism engineering. The recombinant Escherichia coli is obtained by taking Escherichia coli as a chassis cell, introducing an IAA pathway into the chassis cell and knocking out a tnaA gene and an mtr gene; the recombinant escherichia coli can be fermented by taking glucose or cellulose as a substrate to generate IAA; the yield of the synthesized IAA is improved by further optimizing the fermentation time, the fermentation temperature and the composition of a buffer solution, and the synthesized IAA can effectively promote plant growth and has good practicability.

Description

Technical Field

[0001] The invention belongs to the technical field of synthetic biology and microbial metabolic engineering, and particularly relates to a recombinant Escherichia coli, a construction method thereof, and an application thereof in producing indoleacetic acid. Background Art

[0002] Indole-3-acetic acid (IAA) is a green plant growth regulator and the main active ingredient in natural plant auxins. It can increase the size and distribution of plant roots, helping them absorb more nutrients from the soil, and has the potential for widespread agricultural applications. Currently, IAA can be synthesized through chemical and microbial methods. Traditional chemical methods have disadvantages such as high cost and heavy pollution. In contrast, microbial methods have the advantage of being environmentally friendly. However, existing microbial synthesis of IAA still suffers from low yields.

[0003] Synthetic biology has made it possible to synthesize IAA through microbial fermentation using glucose or cellulose as substrates. However, the complexity and maturity of genetic manipulation vary significantly among different microorganisms. Escherichia coli, with its clear genetic background and ease of manipulation, is an ideal platform for metabolic engineering. However, it naturally lacks a complete pathway from L-tryptophan to IAA, and its synthesis efficiency is limited. Therefore, there is a need to develop recombinant E. coli that can produce indoleacetic acid using glucose or cellulose as substrates. Summary of the Invention

[0004] In response to some deficiencies in the prior art, the present invention provides a recombinant Escherichia coli, a construction method thereof, and an application thereof in the production of indoleacetic acid. The present invention uses Escherichia coli as a chassis cell, introduces an IAA pathway into the chassis cell, and knocks out the tnaA gene and the mtr gene to obtain the recombinant Escherichia coli. The recombinant Escherichia coli can ferment glucose or cellulose as a substrate to produce IAA. The present invention further optimizes the fermentation time, temperature, and buffer composition to increase the yield of synthesized IAA. The synthesized IAA can effectively promote plant growth and has good practicality.

[0005] In order to achieve the above technical objectives, the present invention adopts the following technical means:

[0006] The present invention first provides a recombinant Escherichia coli, wherein the gene tnaA for synthesizing the by-product indole is knocked out and the iaaM and ami genes are knocked into the tnaA site.

[0007] Preferably, the recombinant E. coli is further knocked into a tac promoter to enhance the tryptophan biosynthesis pathway.

[0008] Preferably, the recombinant E. coli also has the mtr gene knocked out to reduce tryptophan internalization.

[0009] The present invention also provides a method for constructing the above-mentioned recombinant Escherichia coli, the method comprising:

[0010] The dissolved oxygen-inducible promoter nar, the iaaM gene, and the ami gene are connected in series to construct an integration fragment nar-iaaM-ami, which is inserted into the tnaA gene site of the chassis cell by CRISPR-Cas9 gene editing technology, and the tnaA gene of the chassis cell is knocked out at the same time to obtain the recombinant Escherichia coli.

[0011] Preferably, the nucleotide sequence of the tnaA gene is shown in SEQ ID NO.1;

[0012] The nucleotide sequence of the nar is shown in SEQ ID NO.2;

[0013] The nucleotide sequence of the iaaM gene is shown in SEQ ID NO. 3;

[0014] The nucleotide sequence of the ami gene is shown in SEQ ID NO.4.

[0015] Preferably, the chassis cell is E. coli CICC 10303.

[0016] Preferably, a tac promoter is also knocked into the recombinant Escherichia coli, and the nucleotide sequence of the tac promoter is shown in SEQ ID NO.19.

[0017] Preferably, the recombinant Escherichia coli further has the mtr gene knocked out, and the nucleotide sequence of the mtr gene is shown in SEQ ID NO.23.

[0018] The present invention also provides the use of the recombinant Escherichia coli in the fermentation production of IAA.

[0019] Preferably, the fermentation substrate is a sugar, including glucose or a polysaccharide that can be hydrolyzed to obtain glucose; the polysaccharide is preferably cellulose.

[0020] The present invention also provides a method for producing IAA, which comprises: inoculating the above-mentioned recombinant Escherichia coli into a substrate to ferment and produce IAA.

[0021] Preferably, when the substrate is glucose, the inoculation amount of the recombinant E. coli is 5% (v / v);

[0022] When the substrate is cellulose, the inoculation amount of the recombinant E. coli is 1.25% to 50% (v / v), and cellulase is added thereto.

[0023] Preferably, the fermentation conditions are: using Tris-HCl buffer and fermenting at 30° C. for 12 to 60 hours under oxygen supply.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention discovered the key role of key genes such as mtr in enhancing IAA production, and revealed the potential of using polysaccharide substrates such as cellulose to produce IAA and promote plant growth.

[0026] The present invention constructs a genetically engineered Escherichia coli strain, introduces an IAA synthesis pathway, and performs related metabolic optimization, which may break through technical bottlenecks and construct an efficient IAA synthesis strain. On the one hand, the IAM pathway (L-tryptophan → indole-3-acetamide → IAA) is considered to be a preferred IAA synthesis route, wherein iaaM (tryptophan monooxygenase gene) and ami (deaminase gene) are key genes. On the other hand, the mtr gene is a key gene for L-tryptophan transport into the cell, and the trpEDCBA gene cluster is one of the key gene clusters for synthesizing L-tryptophan. In addition, the tnaA gene encodes a protein that catalyzes the decomposition of L-tryptophan to produce indole, which is unfavorable for synthesizing IAA. Optimizing this series of key metabolic pathways and gene expression may have a significant impact on IAA production.

[0027] Furthermore, the present invention uses inexpensive, widely available carbohydrate substrates as raw materials, avoiding the use of expensive raw materials such as L-tryptophan, effectively reducing costs. After metabolic pathway optimization, IAA production increased from 133.54 mg / L to 251.06 mg / L, an increase of 88.0%. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The bar graph shows the comparison of IAA production by different strains using glucose as substrate.

[0029] Figure 2 This is a bar chart comparing the IAA production of different strains using cellulose as substrate and cellulase addition at 0.7 mg / L.

[0030] Figure 3 The curve shows the effect of inoculum size (0.25 mL to 10 mL, i.e., 1.25% to 50%) on IAA production.

[0031] Figure 4 This is a bar graph showing the effect of fermentation time (12h to 60h) on IAA production.

[0032] Figure 5 This is a comparison chart of the overall growth of lettuce and the measurement results of single plant length of lettuce in Group A (watered with E. coli IAA-1ΔtnaAΔmtr fermentation liquid) and Group B (watered with DH5α fermentation liquid). DETAILED DESCRIPTION

[0033] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto.

[0034] Example 1: Construction of recombinant E. coli IAA-1ΔtnaA and shake flask fermentation

[0035] In this example, the iaaM and ami genes were knocked into the tnaA locus and tnaA was knocked out to construct recombinant E. coli IAA-1ΔtnaA, wherein the nucleotide sequence of the tnaA gene is shown in SEQ ID NO. 1; the nar promoter sequence is (SEQ ID NO. 2); the nucleotide sequence of the iaaM gene is shown in SEQ ID NO. 3; and the nucleotide sequence of the ami gene is shown in SEQ ID NO. 4. The construction steps are as follows:

[0036] tnaA gene (SEQ ID NO.1):

[0037]

[0038] nar promoter sequence (SEQ ID NO.2):

[0039] CTCTTGATCGTTATCAAATCCCATCTAGTAGAGACAACGTATAATGCCCTTAAAAGGAGGATTACAAAA

[0040] iaaM gene (SEQ ID NO. 3):

[0041]

[0042] ami gene (SEQ ID NO.4):

[0043]

[0044] (1) Primers up1f and up1r were used to amplify the upstream homology arm of tnaA from the E. coli CICC 10303 genome; primers d1f and d1r were used to amplify the downstream homology arm of tnaA from the E. coli CICC 10303 genome.

[0045] up1f(SEQ ID NO.5):GCTTCGCTTCATTGTTAC;

[0046] up1r (SEQ ID NO. 6):

[0047] TTATACGTTGTCTCTACTAGATGGGATTTGATAACGATCAAGAGTACATAATCCTTCA TTTATT.

[0048] tnaA upstream homology arm (SEQ ID NO.7):

[0049] GCTTCGCTTCATTGTTACCACTCCTGTTATTCCTCAACCCTTTTTTTAAACATTAAAATTCTTACGTAATTTATAATTCTTAAAAAAAGCATTTAATATTGCTCCCCGAACGATTGTGATTCGATTCACATTTAAACAATTTCAGAATAGACAAAAACTCTGAGTGTAATAATGTAGCCTCGTGTCTTGCGAGGATAAGTGCATTATGAATATCTTACATATATGTGTGACCTCAAAATGGTTCAAATT GACAACAAAATTGTCGATCACCGCCCTTGATTTGCCCTTCTGTAGCCATCACCAGAGCCAAACCGATTAGATTCAATGTGATCTATTTGTTTGCTATATCTTAATTTTGCCTTTTGCAAAGGTCA TCTCTCGTTTATTTACTTGTTTTAGTAAAATGATGGTGCTTGCATATATATCTGGCGAATTAATCCGGTATAGCAGATGTAATATTCACAGGGATCACTGTAATTAAAATAAATGAAGGATTATGTA;

[0050] d1f(SEQ ID NO.8):CTGAAAGGAGGAACTATATCTTAATACTACAGAGTGGCTAT;d1r(SEQ IDNO.9):ACGAAAATGGCTGTGCAGAT;

[0051] tnaA (SEQ ID NO.10):

[0052] TTAATACTACAGAGTGGCTATAAGGATGTTAGCCACTCTCTTACCCTACTCCAATAACAAATAGCCTTCCTCTAAAGGTGGCATCATGACTGATCAAGCTGAAAAAAGCACTCTGCATT TTGGGGTGTTATGGTTATAGCAGGTACAGTAATTGGTGGAGGTATGTTTGCTTTACCTGTTGATCTTGCCGGTGCCTGGTTTTTCTGGGGTGCCTTTATCCTTATTCTTGGTTTTCATGC TTCATTCCGGGTTATTGTTATTAGAGCAATTTAAATTATCCCGTCGGCTCCAGTTTTAACACCATCCAAAGATTTAATCGGTAACACCTGGAACATTATCAGCGGTATTACCGTTGCCTTC GTTCTCTATATCCTCACTTATGCCTATATCTCTGCTAATGGTGCGATCATTAGTGAAACGATATCAATTTGGGTTATCACGCTAATCCACGTATTGTCGGGATCTGCACAGCCATTTTCGT。

[0053] (2) In the case of iaam1f, we are afraid of the nar-iaaM-ami.

[0054] iaam1f(SEQ ID NO.11):TAGTAGAGACAACGTATAAT;

[0055] iaar(SEQ ID NO.12):GATATAGTTCCTCCTTTCAG。

[0056] (3) Primers pUC1f and pUC1r were used to amplify the pUC19 plasmid backbone. Then, the tnaA upstream homology arm, nar-iaaM-ami fragment, tnaA downstream homology arm, and pUC19 plasmid backbone were connected using seamless cloning technology to construct the donor plasmid pUC19-up-nar-iaaM-ami-down.

[0057] pUC1f (SEQ ID NO. 13): TTCCTGCGTTATCCCCTG;

[0058] pUC1r (SEQ ID NO. 14): CACCTGACGTTAAGAAAC.

[0059] (4) Gene editing using CRISPR-Cas9 technology. Cas9 was expressed using the pCas9 plasmid, and the pTargetF plasmid was used as a template. The primers N20Tf and N20Tr were used to PCR amplify the pTargetF1 plasmid targeting the tnaA gene. The pTargetF1 plasmid and the homologous recombination donor DNA1 fragment up-nar-iaaM-ami-down were co-introduced into E. coli CICC 10303 by electroporation (2.5 kV, 200 Ω, 25 μF). PCR and sequencing confirmed the successful knock-in and knock-out, and a recombinant E. coli was obtained, which was recorded as E. coli IAA-1ΔtnaA.

[0060] N20Tf (SEQ ID NO. 15): TAACTCTGCAGGTGGTCAGCGTTTTAGAGCTAGAAATAGC;

[0061] N20Tr (SEQ ID NO. 16):

[0062] GCTGACCACCTGCAGAGTTA ACTAGTATTATACCTAGGAC;

[0063] The prepared E. coli IAA-1ΔtnaA was subjected to shake flask fermentation. The fermentation medium consisted of 20 g / L glucose, 10 g / L calcium carbonate, 1.43 g / L potassium dihydrogen phosphate, 7.2 g / L potassium hydrogen phosphate, 2 g / L citric acid, 2 g / L magnesium sulfate heptahydrate, 0.4 g / L ammonium ferric citrate, and 1-4 mL / L of trace elements, prepared in water. The trace element composition was: 10 g / L Na2SO4, 10 g / L FeSO4·7H2O, 2 g / L ZnCl2, 2 g / L MnSO4·H2O, 2 g / L CoCl2·6H2O, and 0.3 g / L CuSO4·5H2O.

[0064] A 100 mL conical flask was filled with 20 mL of fermentation medium, and E. coli IAA-1ΔtnaA was inoculated into the conical flask at a 5% (v / v) inoculum size (i.e., 1 mL). Fermentation was carried out at 37° C., pH 6.5-6.9, and 200 rpm for 48 hours. After the fermentation, IAA production was detected by HPLC using 100% acetonitrile as the organic mobile phase and 1% (v / v) acetic acid in water as the aqueous phase. The absorbance was 270 nm, the detection time was 20 minutes, the flow rate was 0.8 mL / min, and the gradient elution program was as follows: 20% organic mobile phase concentration from 0 to 2 minutes, increased to 60% from 2 to 15 minutes, decreased to 20% from 15 to 17 minutes, and maintained at 20% from 17 to 20 minutes.

[0065] Test results such as Figure 1 As shown, after testing, the IAA production was 133.54 mg / L, which was significantly better than the IAA production of ordinary plant probiotics.

[0066] Example 2: Construction and shake flask fermentation of recombinant E. coli IAA-2ΔtnaA

[0067] To further increase the yield of IAA produced by recombinant E. coli fermentation, this example further knocked in the tac promoter based on the E. coli IAA-1ΔtnaA constructed in Example 1 to construct a recombinant E. coli IAA-2ΔtnaA with enhanced expression of the trpEDCBA gene cluster, and performed shake flask fermentation verification. The specific steps are as follows:

[0068] Using the pTargetF plasmid as a template, primers Ntac20f and Ntac20r were used to amplify the pTargetF2 plasmid targeting the upstream region of the trpEDCBA gene cluster. A DNA sequence containing the tac promoter and upstream and downstream homology arms (donor DNA2) was synthesized. Cas9 was expressed using the pCas9 plasmid. The pTargetF2 plasmid and donor DNA2 were then introduced into competent E. coli IAA-2ΔtnaA cells by electroporation, thereby introducing the tac promoter upstream of the trpEDCBA gene cluster using CRISPR-Cas9 technology. PCR and sequencing confirmed the successful knock-in, resulting in recombinant E. coli, designated E. coli IAA-2ΔtnaA.

[0069] Ntac20f (SEQ ID NO. 17):

[0070] TTTTCGTACTGAAAGGTTGGGTTTTAGAGCTAGAAATAGC

[0071] Ntac20r (SEQ ID NO. 18):

[0072] CCAACCTTTCAGTACGAAAAACTAGTATTATACCTAGGAC:

[0073] tac promoter (SEQ ID NO.19):

[0074] TTGACAATTAATCATCGGCTCGTATAATG;

[0075] Donor DNA2 sequence (SEQ ID NO.20):

[0076]

[0077] The fermentation medium and fermentation conditions described in Example 1 were used to conduct shake flask fermentation tests on the E. coli IAA-2ΔtnaA prepared above.

[0078] A 100 mL conical flask was filled with 20 mL of fermentation medium. E. coli IAA-2ΔtnaA was inoculated into the flask at a 5% (v / v) inoculum (i.e., 1 mL). 0.2 mM IPTG was added to induce expression of the tac promoter. Fermentation was carried out at 37°C, pH 6.5-6.9, and 200 rpm for 48 hours. After fermentation, IAA production was measured by HPLC.

[0079] Test results such as Figure 1 As shown, the IAA yield was 190.47 mg / L, which was 42.6% higher than that of E. coli IAA-1ΔtnaA.

[0080] Example 3: Construction and shake flask fermentation of recombinant E. coli IAA-1ΔtnaAΔmtr

[0081] To further increase the yield of IAA produced by recombinant E. coli fermentation, this example further knocked out the mtr gene based on the E. coli IAA-1ΔtnaA constructed in Example 1 to construct a recombinant E. coli IAA-1ΔtnaAΔmtr that reduces L-tryptophan transport into the cell, and conducted shake flask fermentation verification. The specific steps are as follows:

[0082] Using primers Nmtr20f and Nmtr20r, PCR amplification was performed to obtain the pTargetF plasmid targeting the mtr gene. The homologous recombination donor DNA3 sequence was fully synthesized and electroporated into E. coli IAA-1ΔtnaA competent cells, achieving the goal of knocking out mtr via CRISPR-Cas9. PCR and sequencing were used to verify the successful knock-in and knock-out, resulting in recombinant E. coli, designated E. coli IAA-1ΔtnaAΔmtr.

[0083] Nmtr20f (SEQ ID NO.21):

[0084] GCGACGTTGAACAATGTCGCGTTTTAGAGCTAGAAATAGC;

[0085] Nmtr20r (SEQ ID NO. 22):

[0086] GCGACATTGTTCAACGTCGCACTAGTATTATACCTAGGAC;

[0087] mtr gene (SEQ ID NO.23):

[0088]

[0089] Donor DNA3 sequence (SEQ ID NO.24):

[0090]

[0091] The fermentation medium and fermentation conditions described in Example 1 were used to conduct shake flask fermentation tests on the E. coli IAA-1ΔtnaAΔmtr prepared above.

[0092] A 100 mL conical flask was filled with 20 mL of fermentation medium and inoculated with E. coli IAA-1ΔtnaAΔmtr at a 5% (v / v) inoculum (i.e., 1 mL). Fermentation was carried out at 37°C, pH 6.5-6.9, and 200 rpm for 48 hours. After fermentation, IAA production was determined by HPLC.

[0093] Fermentation results such as Figure 1 As shown, the IAA yield was 251.06 mg / L, 88.0% higher than that of E. coli IAA-1ΔtnaA. This indicates that the IAA yield of E. coli IAA-1ΔtnaAΔmtr fermentation was higher than that of E. coli IAA-2ΔtnaA, indicating that knocking in the tac promoter or knocking out the mtr gene can increase IAA production.

[0094] Example 4:

[0095] In this example, cellulose was used as a fermentation substrate, and E. coli CICC 10303 was used as a blank control to investigate the ability of the recombinant E. coli prepared in Examples 1 to 3 to ferment cellulose to produce IAA. The specific steps are as follows:

[0096] (1) Formula of fermentation medium:

[0097] Prepare 15 g / L microcrystalline cellulose, 5 g / L glucose, 10 g / L calcium carbonate, 1.43 g / L potassium dihydrogen phosphate, 7.2 g / L dipotassium hydrogen phosphate, 2 g / L citric acid, 2 g / L magnesium sulfate heptahydrate, 0.4 g / L ammonium ferric citrate, and 1 mL / L of trace elements in water.

[0098] The trace element composition is: Na2SO4 10g / L, FeSO4·7H2O 10g / L, ZnCl2 2g / L, MnSO4·H2O 2g / L, CoCl2·6H2O 2g / L, CuSO4·5H2O 0.3g / L.

[0099] (2) Fermentation conditions and optimization:

[0100] The genetically engineered strains and starting bacteria obtained in Examples 1 to 3 were cultured in 100 mL conical flasks with a liquid volume of 20 mL. The basic condition was a 5% (v / v) inoculation volume (i.e., 1 mL). 0.7 mg / L cellulase was added and fermented at 37°C and 200 rpm. After the fermentation, the IAA production of different strains was detected.

[0101] Figure 2 A bar chart comparing IAA production by different strains using microcrystalline cellulose as a substrate and 0.7 mg / L of cellulase was shown. The starting strain, E. coli CICC 10303, produced no IAA. However, E. coli IAA-1ΔtnaA produced 72.81 mg / L, E. coli IAA-2ΔtnaA produced 122.34 mg / L, and E. coli IAA-1ΔtnaAΔmtr produced 144.78 mg / L, indicating that knocking in the tac promoter or knocking out the mtr gene can increase IAA production.

[0102] In this example, the fermentation conditions of E. coli IAA-1ΔtnaAΔmtr were optimized using a control group with an inoculum size of 5%, a cellulase addition amount of 2.33 mg / L, a fermentation temperature of 37°C, and a phosphate buffer solution for 48 hours. The specific optimization steps are as follows:

[0103] (a) Optimization of inoculum size:

[0104] Fermentation was carried out for 48 hours with inoculation amounts of 1.25%, 2.5%, 3.75%, 5%, 10%, 25%, 40%, and 50% (v / v) (i.e., 0.25mL, 0.5mL, 0.75mL, 1mL, 2mL, 5mL, 8mL, and 10mL). After fermentation, the IAA yields at different inoculation amounts were detected.

[0105] The results are as follows Figure 3 As shown in the figure, it can be seen that when the inoculum size is 1.25% (0.25 mL), the IAA yield is 25.54 mg / L; when the inoculum size is 2.5% (0.5 mL), the IAA yield is 52.04 mg / L; when the inoculum size is 3.75% (0.75 mL), the IAA yield is 59.3 mg / L; when the inoculum size is 5% (1 mL), the IAA yield is 122.94 mg / L; when the inoculum size is 10% (2 mL), the IAA yield is 58.24 mg / L; when the inoculum size is 25% (5 mL), the IAA yield is 30.69 mg / L; when the inoculum size is 40% (8 mL), the IAA yield is 24.53 mg / L; when the inoculum size is 50% (10 mL), the IAA yield is 20.93 mg / L.

[0106] It can be seen that when the inoculum size was 1 mL (5%), the IAA yield reached a maximum value of 122.94 mg / L, and then as the inoculum size continued to increase, the yield gradually decreased, indicating that 5% was the optimal inoculum size.

[0107] (b) Optimization of enzyme addition:

[0108] With an inoculation rate of 5%, 0.07 mg / L, 0.7 mg / L, 1.4 mg / L, 2.33 mg / L, 3.5 mg / L, 4.66 mg / L, 5.83 mg / L, and 7 mg / L cellulase were added respectively, and fermentation was carried out for 48 hours. After the fermentation, the IAA yields at different enzyme addition rates were detected.

[0109] After testing, when the addition amount of cellulase was 0.07 mg / L, the IAA production was 147.92 mg / L; when the addition amount of cellulase was 0.7 mg / L, the IAA production was 144.78 mg / L; when the addition amount of cellulase was 1.4 mg / L, the IAA production was 177.08 mg / L; when the addition amount of cellulase was 2.33 mg / L, the IAA production was 181.85 mg / L; when the addition amount of cellulase was 3.5 mg / L, the IAA production was 56.93 mg / L; when the addition amount of cellulase was 4.66 mg / L, the IAA production was 92.19 mg / L; when the addition amount of cellulase was 5.83 mg / L, the IAA production was 96.55 mg / L; when the addition amount of cellulase was 7 mg / L, the IAA production was 92.05 mg / L.

[0110] It can be seen that when the addition amount of cellulase is 2.33 mg / L, the IAA yield is the highest, which is 181.85 mg / L. Therefore, the optimal addition amount of cellulase is 2.33 mg / L.

[0111] (c) Fermentation time optimization:

[0112] With an inoculum size of 5% and 0.7 mg / L cellulase, the fermentation was carried out for 12 h, 24 h, 36 h, 48 h, and 60 h. After the fermentation, the IAA yields at different fermentation times were detected.

[0113] Test results such as Figure 4 As shown in the figure, it can be seen that when the fermentation time is 48h, the IAA production reaches the maximum value of 90.29mg / L, indicating that 48h is the optimal fermentation time.

[0114] (d) Anoxic fermentation:

[0115] The inoculum size was 5%, the cellulase was 0.7 mg / L, and the fermentation was carried out at 37° C. under anoxic conditions (sealed bottle mouth) for 48 hours. After the fermentation was completed, the IAA yield was detected.

[0116] After testing, the IAA production at this time was 74.61 mg / L, which was lower than the production under aerobic conditions (144.78 mg / L), indicating that oxygen supply can increase the IAA production.

[0117] (e) Fermentation at 30°C:

[0118] The inoculum size was 5%, the cellulase was 0.7 mg / L, the fermentation was carried out at 30°C and 200 rpm for 48 hours, and the IAA yield was detected after the fermentation was completed.

[0119] After testing, the IAA production at this time was 88.11 mg / L, which was lower than the production at 37°C (144.78 mg / L), indicating that the IAA production would decrease when the temperature was lowered.

[0120] (f) Tris-HCl buffer fermentation:

[0121] The inoculum size was 5%, 0.7 mg / L cellulase was added, phosphate buffer was replaced by 50 mM Tris-HCl (pH 6.5-6.9), and the fermentation was carried out for 48 hours. After the fermentation was completed, the IAA yield was detected.

[0122] After testing, the IAA production at this time was 59.73 mg / L, which was lower than that of the fermentation system containing phosphate, indicating that limiting phosphorus will lead to a decrease in IAA production.

[0123] In summary, the optimal conditions for producing IAA using cellulose as a substrate are 5% inoculum, 2.33 mg / L cellulase, and fermentation under aerobic conditions for 48 h at 37°C.

[0124] Example 5:

[0125] This example investigates the effect of the fermentation liquid obtained in Example 4 using cellulose as a substrate and E. coli IAA-1ΔtnaAΔmtr as a fermentation bacterium on the growth of lettuce. The specific steps are as follows:

[0126] Experimental Group: E. coli IAA-1ΔtnaAΔmtr was fermented under the optimal fermentation conditions optimized in Example 4 to obtain a fermentation broth. Then, 1 mL of the fermentation broth was diluted 100-fold with sterile water (the IAA concentration after dilution was approximately 1.2294 mg / L) to obtain an E. coli IAA-1ΔtnaAΔmtr fermentation broth.

[0127] Control group: 1 mL of E.coli DH5α fermentation broth (without IAA synthesis ability) was used and diluted 100 times.

[0128] Lettuce seedlings of uniform growth (two plants per group, labeled A1, A2, and B1, B2) were selected and watered with diluted E. coli IAA-1ΔtnaAΔmtr fermentation broth (Group A) and DH5α fermentation broth (Group B). The plants were watered with 100 mL of the diluted fermentation broth every three days for 21 days. The growth conditions were 25°C and 16 hours of light per day.

[0129] Measurements and results:

[0130] After 21 days, the length (from the root to the leaf tip) and weight (fresh weight of the above-ground part) of the lettuce were measured. The results are as follows:

[0131] A 1E. coli IAA-1ΔtnaAΔmtr fermentation broth water: length 12.5cm, weight 9.84g;

[0132] A2 E. coli IAA-1ΔtnaAΔmtr fermentation broth water: length 12.5 cm, weight 7.99 g;

[0133] B 1DH5α fermentation broth watered: length 9.5 cm, weight 7.60 g;

[0134] B 2DH5α fermentation liquid watering: length 10cm, weight 7.78g.

[0135] Figure 5 The overall growth of lettuce from Group A (watered with E. coli IAA-1ΔtnaAΔmtr fermentation broth) and Group B (watered with DH5α fermentation broth) is shown. Group A lettuce had wider leaves and more vigorous overall growth. The lettuce length of Group A (A1 and A2) was 12.5 cm, significantly longer than that of Group B (B1: 9.5 cm, B2: 10 cm). The average length of lettuce in Group A was 28.2% greater than that in Group B, and the average weight was 15.9% greater, indicating that the IAA in the E. coli IAA-1ΔtnaAΔmtr fermentation broth significantly promoted lettuce growth.

[0136] In summary, the present invention uses Escherichia coli as a chassis cell, introduces the IAA pathway into the chassis cell, and knocks out the tnaA gene and the mtr gene to obtain the recombinant Escherichia coli; the recombinant Escherichia coli can ferment glucose or cellulose as a substrate to produce IAA; the present invention further optimizes the fermentation time, temperature and buffer composition to increase the yield of synthesized IAA, and the synthesized IAA can effectively promote plant growth and has good practicality.

[0137] The embodiments described are preferred implementations of the present invention, but the present invention is not limited to the above implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention are within the scope of protection of the present invention.

Claims

1. A recombinant Escherichia coli, characterized in that The recombinant E. coli knocks out the gene tnaA for synthesizing the by-product indole and knocks in the iaaM and ami genes in the tnaA site.

2. The recombinant Escherichia coli according to claim 1, characterized in that The recombinant E. coli also has a tac promoter knocked into it.

3. The recombinant Escherichia coli according to claim 1, characterized in that The recombinant E. coli also has the mtr gene knocked out.

4. The method for constructing the recombinant Escherichia coli according to any one of claims 1 to 3, characterized in that: The method comprises: The dissolved oxygen-inducible promoter nar, the iaaM gene, and the ami gene are connected in series to construct an integration fragment nar-iaaM-ami, which is inserted into the tnaA gene site of the chassis cell by CRISPR-Cas9 gene editing technology, and the tnaA gene of the chassis cell is knocked out at the same time to obtain the recombinant Escherichia coli.

5. The method for constructing recombinant Escherichia coli according to claim 4, characterized in that: The nucleotide sequence of the tnaA gene is shown in SEQ ID NO. 1; The nucleotide sequence of the nar is shown in SEQ ID NO.2; The nucleotide sequence of the iaaM gene is shown in SEQ ID NO. 3; The nucleotide sequence of the ami gene is shown in SEQ ID NO. 4; The chassis cell is E. coli CICC 10303.

6. The method for constructing recombinant Escherichia coli according to claim 4, characterized in that: The tac promoter was also knocked into the recombinant E. coli, and the nucleotide sequence of the tac promoter is shown in SEQ ID NO.

19.

7. The method for constructing recombinant Escherichia coli according to claim 4, characterized in that: The recombinant E. coli also has the mtr gene knocked out, and the nucleotide sequence of the mtr gene is shown in SEQ ID NO.

23.

8. Use of the recombinant Escherichia coli according to any one of claims 1 to 3 in the fermentation production of IAA; the fermentation substrate is a carbohydrate.

9. A method for producing IAA, characterized in that: The method comprises: inoculating the recombinant Escherichia coli according to any one of claims 1 to 3 into a substrate to ferment and produce IAA.

10. The method according to claim 9, characterized in that When the substrate was glucose, the inoculum size of the recombinant E. coli was 5% (v / v); When the substrate is cellulose, the inoculation amount of the recombinant Escherichia coli is 1.25% to 50% (v / v), and cellulase is added thereto; The fermentation conditions are as follows: using Tris-HCl buffer and fermenting at 30°C for 12 to 60 hours under oxygen supply.

Images