Construction and application of recombinant escherichia coli

Through genetic modification, the expression of narJ and setA was enhanced, and the iclR, lpxM, ldhA, nadR, and ptsP genes were knocked out to construct recombinant E. coli, which solved the problem of low glucose utilization efficiency, achieved rapid growth and high biomass growth, and improved fermentation efficiency and product synthesis ability.

CN120485085APending Publication Date: 2025-08-15MICROCYTO BIOTECHNOLOGY (BEIJING) CO LTD
View PDF 0 Cites 4 Cited by

Patent Information

Application Number
CN202510692724.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-27
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The existing E. coli strains are inefficient in glucose utilization, resulting in slow growth, prolonging the fermentation cycle and increasing the risk of bacterial infection, and insufficient proliferation ability in an anaerobic/microoxygen environment, affecting biomass and product synthesis.

Method used

The expression of narJ and setA was enhanced through genetic modification, and the iclR, lpxM, ldhA, nadR, and ptsP genes were knocked out, and the related genes were replaced by the P119 promoter was used to construct recombinant E. coli, which increased glucose intake rate and biomass growth.

Benefits of technology

E. coli has achieved rapid intake of glucose and achieved high biomass growth, shortened the fermentation cycle, and improved the fermentation efficiency and product synthesis ability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention provides recombinant Escherichia coli. The recombinant Escherichia coli comprises the following multiple modifications: knocking out genes such as iclR, lpxM, ldhA, nadR, ptsP and the like; the expression of genes such as narJ, setA and the like is enhanced. The Escherichia coli disclosed by the invention can rapidly intake a glucose raw material, and can rapidly grow under various culture conditions. Therefore, the method has potential application value in the field of fermentation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the fields of gene editing, gene recombination-edited microbial strains, synthetic biology, and microbial whole-cell catalysis technology. Specifically, it relates to the construction and application of a recombinant Escherichia coli that can rapidly absorb glucose raw materials and achieve high biomass growth. Background Art

[0002] Efficient use of raw materials such as glucose, and the ability to grow rapidly and accumulate high biomass are of great significance to industrial microbial strains. The growth characteristics are the core factors that determine the efficiency of biofermentation processes. In the industrial biomanufacturing process, the proliferation rate of microbial cells directly restricts the fermentation cycle - slow growth will not only significantly extend the production cycle, but also cause metabolic regulation imbalance, increase the risk of contamination, and significantly increase the unit cost due to reduced fermentation equipment utilization. These technical bottlenecks have seriously restricted the industrial application of engineered strains. On the other hand, there is a significant positive correlation between the biomass concentration at the fermentation endpoint and the level of product synthesis. The realization of high-density culture technology has become an important breakthrough direction in modern fermentation engineering. It is worth noting that in the late fermentation stage of nutrient deficiency, how to ensure the continued proliferation ability of the strain in extreme environments such as anaerobic / microaerobic environments through the optimization of the metabolic regulatory network is a key technical challenge to break through the existing biomass bottleneck and increase the yield of the target product. Summary of the Invention

[0003] The technical problem addressed by this invention is to provide a set of engineered Escherichia coli strains containing a combination of target sites that promote glucose utilization and rapid growth. These targets were discovered and validated through laboratory adaptive evolution, and then reconstructed through genetic modification. The resulting strains possess the ability to rapidly uptake glucose and achieve high biomass growth, thus possessing significant value in the fields of fermentation and metabolic engineering.

[0004] According to an exemplary embodiment of the present invention, one of the engineered E. coli strains is achieved by performing the following multiple modifications in the recipient strain:

[0005] (a): Enhanced expression of the gene narJ encoding the molecular chaperone of nitrate reductase and the gene setA encoding the sugar transporter;

[0006] (b): Knockout of the gene iclR encoding isocitrate lyase inhibitor, the gene lpxM encoding lipid A biosynthesis myristoyltransferase, the gene ldhA encoding D-lactate dehydrogenase, the gene nadR encoding NMN adenylyltransferase, and the gene ptsP encoding PEP protein phosphotransferase.

[0007] (c): The above modification (a) can specifically be replacing the promoter of the nitrate reductase molecular chaperone gene narJ and the promoter of the sugar transporter gene setA with the constitutive promoter P119.

[0008] The recipient strain mentioned above can specifically be Escherichia coli MG1655, Escherichia coli BW25113, or Escherichia coli BL21 (DE3).

[0009] Furthermore, the nucleotide sequence of P119 is SEQ ID NO.8.

[0010] According to another exemplary embodiment of the present invention, one of the groups of engineered E. coli strains is a recipient bacterium that undergoes the following modifications:

[0011] According to the engineered Escherichia coli strain provided by the present invention, the recombinant Escherichia coli strain has at least one of the following characteristics:

[0012] 1) Rapid glucose uptake; in the examples, the glucose uptake rate was increased by more than 50% compared to the control strains MG1655 or BW25113.

[0013] 2) High biomass growth; in the examples, the biomass of the strains MG1655 and BW25113 was increased by more than 50% under the same conditions compared to the control strains.

[0014] Another aspect of the present invention provides the use of any of the aforementioned recombinant Escherichia coli in industrial fermentation;

[0015] Or, use of the strain as an industrial fermentation chassis cell to produce a target product;

[0016] or, use of the strain in industrial fermentation to produce target products;

[0017] Or, use of the strain in preparing recombinant microorganisms for industrial fermentation.

[0018] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the lipid A biosynthesis myristoyltransferase gene lpxM is Gene ID: 945143 (2022.3.9), and the amino acid Reference Sequence Number (NCBI Reference Sequence) of the protein encoded by it is NP_416369.1 (2022.3.9).

[0019] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the isocitrate lyase inhibitor (iclR) is Gene ID: 948524 (2022.3.9), and the amino acid reference sequence number (NCBI Reference Sequence) of the protein encoded by it is AAC76988.2 (2022.3.9).

[0020] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the D-lactose dehydrogenase gene ldhA gene is Gene ID: 946315 (2022.3.9), and the amino acid reference sequence number (NCBI Reference Sequence) of the protein encoded by it is NP_415898.1 (2022.3.9).

[0021] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the NMN adenylyltransferase nadR is GeneID: 948911 (2022.3.9), and the amino acid reference sequence number (NCBI Reference Sequence) of the protein encoded by it is NP_418807.4 (2022.3.9).

[0022] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the PEP protein phosphotransferase ptsP is GeneID: 947300 (2022.3.9), and the amino acid reference sequence number (NCBI Reference Sequence) of the protein encoded by it is NP_417307.1 (2022.3.9).

[0023] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the nitrate reductase molecular chaperone narJ is GeneID: 945780 (2022.3.9), and the amino acid reference sequence number (NCBI Reference Sequence) of the protein encoded by it is NP_415743.1 (2022.3.9).

[0024] In the present invention, the NCBI Reference Sequence number (NCBI Reference Sequence) of the sugar transporter setA is GeneID: 944793 (2022.3.9), and the amino acid reference sequence number (NCBI Reference Sequence) of the encoded protein is YP_025293.1 (2022.3.9). Preservation Instructions

[0025] (1) Bacteria species: Escherichia coli

[0026] Latin name: Escherichia coli

[0027] Strain ID: MC02

[0028] Depository: General Microbiology Center of China Culture Collection Administration

[0029] Abbreviation of depository institution: CGMCC34378

[0030] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0031] Deposit date: April 27, 2025

[0032] CGMCC registration number: CGMCC No.34378 BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0034] Figure 1 These are the results of growth experiments with different strains.

[0035] Figure 2 These are the experimental results of glucose utilization by different strains.

[0036] Figure 3 These are the growth experimental results of different strains under acidic and organic solvent conditions. DETAILED DESCRIPTION

[0037] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0038] The liquid LB medium (pH 7.0) in the following examples contained 1 g / 100 mL NaCl, 1 g / 100 mL tryptone, 0.5 g / 100 mL yeast extract, and the balance was water. Solid culture medium is obtained by adding agarose to liquid culture medium.

[0039] The E. coli MG1655 (CGSC#: 6300), BW25113 (CGSC#: 76376), BL21(DE3) (CGSC#: 12504), and plasmid pKD46 (CGSC#: 7739) used in the following examples are products of the Yale E. coli Collection (CGSC). The pKD46 plasmid contains the temperature-sensitive replication origin, oriR101, which replicates normally at 30°C but is lost at temperatures above 37°C. E. coli carrying the pKD46 plasmid are cultured at 30°C and induced with arabinose, resulting in efficient expression of Gam, Exo, and Beta. Once exogenous dsDNA is electroporated into the cells, it undergoes homologous recombination with the genomic target sequence. The pKD46 plasmid also carries an ampicillin resistance gene as a selection marker. The gene sequence of the pSCre plasmid is shown in SEQ ID NO.9, and the public can obtain it through gene synthesis: Escherichia coli carrying the pSCre plasmid can express the recombinase (Cre) gene when cultured at 30°C, causing the lox66 sequence and lox71 sequence on the chromosome to recombine, thereby eliminating the DNA sequence located between the lox66 sequence and lox71 sequence. In this patent, the kanamycin resistance gene located between the lox66 sequence and lox71 sequence in the sequence of SEQ ID NO.1 can be eliminated; Escherichia coli carrying the pSCre plasmid will automatically lose the pSCre plasmid when cultured at 42°C; and the streptomycin resistance gene is carried as a selection marker.

[0040] Table 1. List of sequence fragments

[0041] Serial number Fragment name Sequence (5'-3') SEQ ID NO.1 MC-1 agttcaacagatttcgaatattctgaagcaaacttgaacttatcatcaggcgaaggcctctcctcgcgagaaaaatgatttgtcgttagtgttatacctagccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaatgggaaatttactgagccaatccctctggtgatagtgtagcggcgcaacttgccccgcaccaaataaaaaaagccggtactgactgcgtaccgg SEQ ID NO.2 MC-2 tcagtaactattgcattagctaacaataaaaatgaaaatgatttccacgatacagaaaaaagagactgtcaaatgggaaatttactgagccaatccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaaatgatttgtcgttagtgttatacctagcccctttttctggcgggcagaggcaatattctgcccatcatacctgagtggcaatagaataagggtgtctgtt SEQ ID NO.3 MC-3 attaaatttgaaattttgtaaaatatttttagtagcttaaatgtgattcaacatcactggagaaagtcttaaaatgatttgtcgttagtgttatacctagccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaatgggaaatttactgagccaatccctcttgccgctcccctgcattccaggggagctgattcagataatccccaatgacctttcatcctctattct SEQ ID NO.4 MC-4 ttggcgttaaaaaactctccgacgcgcttagcgtgttcgacgacttataatgagatatacggagggagataaatgggaaattatgtgaccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaacatgaatgtcatgaaaatggtcccccgtgatgaaactgctcaaaggcgaggtataaaatgagtttttttgatgagttgaaaacctctctggaag SEQ ID NO.5 MC-5 gcaggaaaatacgccaaaaccacaaaacgcatctgcttatcgacgtaaaagaggttaagtcacgccaattaaaatggcttgtcatgcttaaccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaacattgaaatggttctcacgctaacccccgcggatcatatacatatcttttaacggtatccggcaaccagccaggtccccttgtgctattattcgcac SEQ ID NO.6 MC-6 ccaaattcaatctgttcaacagccgtcgtatcgatgccatcgatgtgaccagcaaaacggagccgcatccataaaaaggtgaatctcattgacattgagctccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaatattgagaattagaaattcccatggcttgtcatgcttaattgacagctagctcagtcctaggtataatgctagcagggagaccacaacggtttccctctacaaataattttgtttaactttcgcgcgcgtaacaggaggaattaaccatgatcgaactcgtgattgtatcgcgtctccttgaatatccggatgctgccttatggcagcatcaacaag SEQ ID NO.7 MC-7 cctgcatcatgtgtgactgagtattggtgtaaaatcacccgccagcagattatacctgctggttttttttaaatgggctaatggtttagaaattccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaatgtcatgctaatggttgtcatgaaaatcccatggcttgtcatgcttaattgacagctagctcagtcctaggtataatgctagcagggagaccacaacggtttccctctacaaataattttgtttaactttcgcgcgcgtaacaggaggaattaaccatgatctggataatgacgatggctcgccgtatgaacggtgtttacgcggcatttatgctggtcgctttta SEQ ID NO.8 P119 atggcttgtcatgcttaattgacagctagctcagtcctaggtataatgctagcagggagaccacaacggtttccctctacaaataattttgtttaactttcgcgcgcgtaacaggaggaattaacc SEQ ID NO.9 pSCre aatgtgcctgtcaaatggacgaagcagggattctgcaaaccctatgctactccgtcaagccgtcaattgtctgattcgttaccaattatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgttttttgggctaacaggaggaattaaccatgggatccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaccctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattagctcgagggtagatctggtactagtggtgaattcggtgagctcggtctgcagctggtgccgcgcggcagccaccaccaccaccaccactaatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgtcgaccagacccgccataaaacgccctgagaagcccgtgacgggcttttcttgtattatgggtagtttccttgcatgaatccataaaaggcgcctgtagtgccatttacccccattcactgccagagccgtgagcgcagcgaactgaatgtcacgaaaaagacagcgactcaggtgcctgatggtcggagacaaaaggaatattcagcgatttgcccgagcttgcgagggtgctacttaagcctttagggttttaaggtctgttttgtagaggagcaaacagcgtttgcgacatccttttgtaatactgcggaactgactaaagtagtgagttatacacagggctgggatctattctttttatctttttttattctttctttattctataaattataaccacttgaatataaacaaaaaaaacacacaaaggtctagcggaatttacagagggtctagcagaatttacaagttttccagcaaaggtctagcagaatttacagatacccacaactcaaaggaaaaggactagtaattatcattgactagcccatctcaattggtatagtgattaaaatcacctagaccaattgagatgtatgtctgaattagttgttttcaaagcaaatgaactagcgattagtcgctatgacttaacggagcatgaaaccaagctaattttatgctgtgtggcactactcaaccccacgattgaaaaccctacaaggaaagaacggacggtatcgttcacttataaccaatacgttcagatgatgaacatcagtagggaaaatgcttatggtgtattagctaaagcaaccagagagctgatgacgagaactgtggaaatcaggaatcctttggttaaaggctttgagattttccagtggacaaactatgccaagttctcaagcgaaaaattagaattagtttttagtgaagagatattgccttatcttttccagttaaaaaaattcataaaatataatctggaacatgttaagtcttttgaaaacaaatactctatgaggatttatgagtggttattaaaagaactaacacaaaagaaaactcacaaggcaaatatagagattagccttgatgaatttaagttcatgttaatgcttgaaaataactaccatgagtttaaaaggcttaaccaatgggttttgaaaccaataagtaaagatttaaacacttacagcaatatgaaattggtggttgataagcgaggccgcccgactgatacgttgattttccaagttgaactagatagacaaatggatctcgtaaccgaacttgagaacaaccagataaaaatgaatggtgacaaaataccaacaaccattacatcagattcctacctacgtaacggactaagaaaaacactacacgatgctttaactgcaaaaattcagctcaccagttttgaggcaaaatttttgagtgacatgcaaagtaagcatgatctcaatggttcgttctcatggctcacgcaaaaacaacgaaccacactagagaacatactggctaaatacggaaggatctgaggttcttatggctcttgtatctatcagtgaagcatcaagactaacaaacaaaagtagaacaactgttcaccgttagatatcaaagggaaaactgtccatatgcacagatgaaaacggtgtaaaaaagatagatacatcagagcttttacgagtttttggtgcatttaaagctgttcaccatgaacagatcgacaatgtaacagatgaacagcatgtaacacctaatagaacaggtgaaaccagtaaaacaaagcaactagaacatgaaattgaacacctgagacaacttgttacagctcaacagtcacacatagacagcctgaaacaggcgatgctgcttatcgaatcaaagctgccgacaacacgggagccagtgacgcctcccgtggggaaaaaatcatggcaattctggaagaaatagcgctttcagccggcaaacctgaagccggatctgcgattctgataacaaactagcaacaccagaacagcccgtttgcgggcagcaaaacccgcggccgcctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagggaagcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacgcggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaagcaagagaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtcggcaaataatgtctaacaattcgttcaagccgaggggccgcaagatccggccacgatgacccggtcgtcggttcagggcagggtcgttaaatagccgcttatgtctattgctggtttaccggtttattgactaccggaagcagtgtgaccgtgtgcttctcaaatgcctgaggtttcaggcatgc

[0042] Table 2 Primers of Example 1

[0043] Primer Sequence (5'-3') lpxM-1 agttcaacagatttcgaatattctgaagca lpxM-2 ccggtacgcagtcagtaccggcttttttta lpxM-3 aacgccacatccggcctacagttcaatgat iclR-1 tcagtaactattgcattagctaacaataaa iclR-2 aacagacacccttattctattgccactcag iclR-3 atttgttcaacattaactcatcggatcagt ldhA-1 attaaatttgaaattttgtaaaata ldhA-2 agaatagaggatgaaaggtcattgg ldhA-3 atgaatttttcaatatcgccatagctttca nadR-1 ttggcgttaaaaaactctccgacgcgctta nadR-2 cttccagagaggttttcaactcatcaaaaa nadR-3 cgaaaaaagcgccggaagggatgcagattt ptsP-1 gcaggaaaatacgccaaaaccacaaaacgc ptsP-2 gtgcgaataatagcacaaggggacctggct ptsP-3 gaaagagttcgcgagtgtggtgatgtcact narJ-1 ccaaattcaatctgttcaacagccgtcgta narJ-2 cttgttgatgctgccataaggcagcatccg narJ-3 cctttggtgatggctgccacggttcagata setA-1 cctgcatcatgtgtgactgagtattggtgt setA-2 taaaagcgaccagcataaatgccgcgtaaa setA-3 gggatgaccgcaattctgaaagttgacttg Kan-R tcgtcaagaaggcgatagaa

[0044] Example 1. Construction of Escherichia coli MC02

[0045] The preparation method of the relevant strains is obtained according to the following steps (1)-(2):

[0046] (1) Starting from Escherichia coli MG1655, the gene lpxM encoding lipid A biosynthesis myristoyltransferase was knocked out to obtain the MC011 strain.

[0047] The specific steps are as follows:

[0048] (1-a) Preparation of targeting fragment MC-1

[0049] A gene-synthesized DNA fragment (GenScript) was prepared as follows: from 5' to 3', it consisted of the following: the lpxM upstream homology arm, lox66-Kan-lox71, and the lpxM downstream homology arm. PCR amplification was performed using primers lpxM-1 / lpxM-2 as template, yielding the target fragment MC-1 (SEQ ID NO. 1).

[0050] (1-b) Preparation of host bacteria containing the pKD46 plasmid

[0051] The pKD46 plasmid (from the Yale Genetic Collection of Escherichia coli (CGSC)) was transformed into E. coli MG1655 using the calcium chloride method. After overnight culture at 30°C on LB plates containing ampicillin, colonies were selected to obtain recombinant E. coli MG1655 / pKD46 containing the pKD46 plasmid. After induction with arabinose, MG1655 / pKD46 expressed the three recombinant proteins of phage λ, conferring homologous recombination capability. Competent MG1655 / pKD46 cells were then prepared by washing with 10% glycerol.

[0052] (1-c) Homologous recombination

[0053] The targeting fragment MC-1 prepared in (1-a) was electroporated into the MG1655 / pKD46 competent cells prepared in (1-b) and incubated overnight at 37°C on LB plates containing kanamycin (50µg / ml). A clone was selected and genomic DNA extracted. PCR amplification was performed using primers lpxM-3 / Kan-R. A positive clone was identified by amplifying a target band of approximately 1000bp. Sequencing analysis confirmed that the target sequence on the genomic DNA of MC011-kan was correct, and the coding region of the lpxM gene was deleted. MC011-kan was cultured overnight at 42°C to eliminate the temperature-sensitive plasmid pKD46.

[0054] (1-d) Elimination of resistance

[0055] The pSCre plasmid was transformed into the MC011-kan strain, which had been depleted of pKD46, using the calcium chloride method. The strain was cultured overnight at 30°C on LB plates containing 50 mg / L streptomycin and 0.2% L-arabinose. The kanamycin resistance fragment was eliminated using the Cre recombinase on the pSCre plasmid. The temperature-sensitive pSCre plasmid was eliminated by culturing overnight at 42°C. The resulting strain was named MC011.

[0056] (2) Acquisition of MC012, MC013, MC014, MC015, MC016, and MC02 strains

[0057] Using the same method as in Example 1 (1), starting from MC011, the targeting fragment MC-2 (containing the iclR upstream homology arm, lox66-Kan-lox71, and the iclR downstream homology arm from 5' to 3') was used to knock out the gene iclR encoding the isocitrate lyase inhibitor in the strain by homologous recombination to obtain the MC012 strain;

[0058] Starting from MC012, the targeting fragment MC-3 (containing the ldhA upstream homology arm, lox66-Kan-lox71, and the ldhA downstream homology arm from 5' to 3') was used to knock out the gene ldhA encoding D-lactate dehydrogenase in the strain by homologous recombination to obtain the MC013 strain.

[0059] Starting from MC013, the targeting fragment MC-4 (containing the nadR upstream homology arm, lox66-Kan-lox71, and the nadR downstream homology arm from 5' to 3') was used to knock out the gene nadR encoding NMN adenylyltransferase in the strain by homologous recombination to obtain the MC014 strain.

[0060] Starting from MC014, the targeting fragment MC-5 (containing the ptsP upstream homology arm, lox66-Kan-lox71, and the ptsP downstream homology arm from 5' to 3') was used to knock out the gene ptsP encoding PEP protein phosphotransferase in this strain by homologous recombination to obtain the MC015 strain.

[0061] Starting from MC015, using the targeting fragment MC-6 (containing the narJ upstream homology arm, lox66-Kan-lox71, P119 promoter, and narJ downstream homology arm from 5' to 3'), the P119 promoter was inserted upstream of the expression frame of the nitrate reductase molecular chaperone gene narJ by homologous recombination to obtain the MC016 strain.

[0062] Starting from MC016, the targeting fragment MC-7 (containing the setA upstream homology arm, lox66-Kan-lox71, P119 promoter, and setA downstream homology arm from 5' to 3') was used to insert the P119 promoter upstream of the expression frame of the sugar transporter gene setA by homologous recombination to obtain the MC02 strain.

[0063] The difference between the construction process of each strain and Example 1 (1) is that different starting strains, different target fragments, and different primers were used. The specific experimental materials used and the obtained strain information are shown in Table 3.

[0064] Table 3. MC011- MC016, MC02 construction process

[0065] Serial number Starting strain Target practice clip name Amplification primers Identification primers Obtain strains 1 MG1655 MC-1 (SEQ ID NO. 1) lpxM-1 / lpxM-2 lpxM-3 / KanR MC011 2 MC011 MC-2 (SEQ ID NO. 2) iclR-1 / iclR-2 iclR-3 / KanR MC012 3 MC012 MC-3 (SEQ ID NO. 3) ldhA-1 / ldhA-2 ldhA-3 / KanR MC013 4 MC013 MC-4 (SEQ ID NO. 4) nadR-1 / nadR-2 nadR-3 / KanR MC014 5 MC014 MC-5 (SEQ ID NO. 5) ptsP-1 / ptsP-2 ptsP-3 / KanR MC015 5 MC015 MC-6 (SEQ ID NO. 6) narJ-1 / narJ-2 narJ-3 / KanR MC016 5 MC016 MC-7 (SEQ ID NO. 7) setA-1 / setA-2 setA-3 / KanR MC02

[0066] The recombinant bacterium MC02 was deposited in the General Microbiology Center of China Culture Collection Administration (CGMCC) on April 27, 2025, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the deposit number is CGMCC No. 34378, and the classification name is Escherichia coli.

[0067] Example 2: Construction of Escherichia coli MC03, MC04, MC05, and MC06

[0068] Escherichia coli MC03, MC04, MC05, and MC06 have the properties shown in Table 4. Professionals can obtain them by following the process of Example 1, starting from specific node strains, through the multi-step transformation process described in Example 1.

[0069] Table 4. Characteristics of MC02, MC03, MC04, MC05, and MC06

[0070] lpxM knockout Knockout of iclR ldhA knockout Knockout of nadR ptsP knockout Enhance narJ Enhance setA MC02 + (yes) + + + + + + MC03 + -(no) + + + + + MC04 + + - + + + + MC05 + + + - + - + MC06 + + + + - + -

[0071] Example 3: Growth of Escherichia coli strains in different culture media

[0072] (1) The test bacteria were MC02-MC06, and the control strains were MG1655, BW25113, and BL21 (DE3).

[0073] (2) Test culture medium: inorganic salt culture medium (12.8 g / L Na2HPO4·7H2O, 3 g / L KH2PO4, 0.5 g / LNaCl, 1 g / L NH4Cl, 10 g / L glucose).

[0074] (3) Culture of bacteria:

[0075] The overnight cultured strain was inoculated into a shake flask containing 50 mL of culture medium at a 1% inoculum size and cultured at 37°C for 15 h. The bacterial growth rate and biomass were determined by measuring the OD600 of the culture at different times.

[0076] Figure 1 The results show that the biomass of MC02-MC06 is better than that of the three control strains, which proves the effect of the present invention.

[0077] Example 4: Utilization of Glucose by Escherichia coli Strains

[0078] (1) The test bacteria were MC02-MC06, and the control strains were MG1655, BW25113, and BL21 (DE3).

[0079] (2) Test culture medium: inorganic salt culture medium.

[0080] (3) Culture of bacteria:

[0081] An overnight culture of the strain was inoculated at a 1% inoculum into a shake flask containing 50 mL of inorganic salt medium and incubated at 37°C for 15 h. The cells were harvested and re-added to 10 mL of inorganic salt medium to a cell concentration of 20 OD. The culture was continued for 6 h. The glucose utilization rate was determined by measuring the residual glucose in the culture. Glucose concentration was determined by HPLC using a Hi-Plex Ca column (300 mm × 7.7 mm, 8 μm). The mobile phase consisted of ultrapure water at a flow rate of 0.5 mL / min, the column temperature was 78°C, and the detector was a differential refractive index detector at 40°C. D-glucose (Beijing Mairuida Product (Cat. No. M043597)) was used as a standard. Qualitative analysis was performed based on the retention time of the standard, and quantitative analysis was performed using a standard curve method (external standard method).

[0082] Figure 2 The results show that the glucose utilization rates of MC02-MC06 are better than those of the three control strains, which proves the effectiveness of the present invention.

[0083] Example 5. Growth of Escherichia coli strains in acidic conditions and organic solvents

[0084] (1) The test bacteria were MC02-MC06, and the control strains were MG1655, BW25113, and BL21 (DE3).

[0085] (2) Test culture medium: inorganic salt culture medium.

[0086] (3) Culture of bacteria:

[0087] The strain cultured overnight was inoculated into a shake flask containing 50 mL of inorganic salt medium at a 1% inoculum size and cultured at 37°C for 24 h. The bacterial biomass was determined by measuring the OD600 of the culture at different times.

[0088] In experimental group A, the pH of the culture medium was 3; in experimental group B, 3% methanol was additionally added to the culture medium.

[0089] Figure 3 The results show that in experimental groups A and B, the glucose utilization rates of MC02-MC06 are better than those of the three control strains, which proves the effectiveness of the present invention.

Claims

1. An Escherichia coli strain MC02, whose deposit number is CGMCC No. 34378.

2. The recombinant Escherichia coli according to claim 1, comprising at least one of the following modifications: The gene iclR encoding isocitrate lyase inhibitor, the gene lpxM encoding lipid A biosynthesis myristoyltransferase, the gene ldhA encoding D-lactate dehydrogenase, the gene nadR encoding NMN adenylyltransferase, or the gene ptsP encoding PEP protein phosphotransferase were knocked out.

3. The recombinant Escherichia coli according to claim 1 or 2, further comprising the following modifications: The expression of the gene narJ encoding the molecular chaperone of nitrate reductase and / or the gene setA encoding the sugar transporter is enhanced.

4. The recombinant Escherichia coli according to any one of claims 1-3, comprising the four, five, or six target modifications described in claims 2-3.

5. The recombinant Escherichia coli according to any one of claims 1 to 4, wherein the recombinant Escherichia coli strain has at least one of the following characteristics: 1) Rapid glucose uptake, preferably at least 50% faster than that of the wild-type strain; 2) High biomass growth, preferably, more than 50% increase in biomass compared to the wild-type strain.

6. Use of the recombinant Escherichia coli according to any one of claims 1 to 5 in industrial fermentation; Or, use of the strain as an industrial fermentation chassis cell to produce a target product; or, use of the strain in industrial fermentation to produce target products; Or, use of the strain in preparing recombinant microorganisms for industrial fermentation.

Citation Information

Cited By

  • Construction and application of a strain for synthesizing polyhydroxybutyrate (PHB) from one-carbon compounds.

    CN122357311A

  • Construction and application of methanol-utilizing engineered escherichia coli

    CN122521498A

  • Construction and application of escherichia coli strain for synthesizing alanine by using methanol as raw material

    CN122609480A

  • Engineering strain for synthesizing l-lysine from one-carbon compounds and application thereof

    CN122686539A