Gjb2 gene enhancer and application thereof
By using a specific enhancer sequence of the GJB2 gene, the problem of gene expression specificity in inner ear support cells was solved, thus improving the precision and safety of gene therapy for deafness.
Patent Information
- Application Number
- CN202511719607.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-21
- Publication Date
- 2026-01-23
AI Technical Summary
Existing technologies make it difficult to achieve specific expression of the GJB2 gene in inner ear support cells, leading to issues with the safety and effectiveness of gene therapy for deafness.
The specific enhancer sequence of the GJB2 gene (SEQ ID No. 1) was used to bind recombinant DNA, vector, or adenovirus to specifically enhance gene expression in inner ear supporting cells.
It significantly enhanced the expression of the GJB2 gene or other genes in the inner ear supporting cells, improving the precision and safety of gene therapy for deafness.
Smart Images
Figure CN121380072A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering, in particular to a Gjb2 gene enhancer and its application in gene expression regulation and deafness gene therapy. BACKGROUND
[0002] Sensorineural hearing loss is one of the most common sensory impairments, and a high proportion of it is caused by genetic factors. Mutations in the GJB2 gene (encoding Connexin 26) are the most common genetic cause of autosomal recessive non-syndromic deafness (DFNB1A). In many populations around the world, about 50% of cases of genetic deafness are associated with mutations in this gene. Connexin 26 is widely expressed in cochlear supporting cells, forming intercellular gap junction channels, which are crucial for maintaining potassium ion circulation and internal environment stability in the inner ear. Loss-of-function mutations in the GJB2 gene can disrupt this critical physiological process, ultimately leading to hair cell dysfunction and hearing loss.
[0003] Currently, there is no fundamental treatment for deafness caused by GJB2 mutations in clinical practice, and hearing aids and cochlear implantation are the main intervention measures. With the development of gene therapy technology, gene replacement therapy has brought hope for the radical cure of such genetic deafness. The basic principle is to introduce a functional GJB2 gene into the cells of the inner ear through a viral vector (such as adeno-associated virus AAV) to compensate for the functional defects of the mutant gene.
[0004] However, this strategy faces a key challenge: achieving cell-specific expression of the transgene. GJB2 expression in the inner ear is strictly limited to cell types, mainly in supporting cells, not in hair cells. If a broad-spectrum strong promoter (such as CMV, CAG) is used to drive GJB2 expression, it may lead to ectopic expression of the gene in non-target cells (such as hair cells or neurons), which not only cannot accurately repair the function of supporting cells, but also may disrupt the normal physiological activities of other cells, and even pose potential safety risks. Therefore, developing a regulatory element that can mimic the endogenous expression pattern of GJB2 is crucial for developing a safe and effective gene therapy strategy.
[0005] As a key cis-regulatory element in the eukaryotic genome, enhancers can precisely enhance the transcription level of genes in a spatiotemporal specific manner. Using the enhancer of the endogenous gene itself is an ideal approach to achieve targeted expression of transgenes. In recent years, studies have found that combining tissue-specific enhancers with mini-promoters can construct expression cassettes with high activity and high specificity in various tissues, significantly better than single-promoter systems. For example, in gene therapy research in tissues such as the liver and retina, such strategies have been successfully applied, effectively improving the safety window of treatment.
[0006] Although the pathogenesis and clinical importance of the GJB2 gene have been fully recognized, the research on the transcriptional regulation mechanism of the gene, especially its specific enhancer, is still blank. Exploring and verifying the specific enhancer of the Gjb2 gene not only helps to deeply understand its expression regulation network, but also provides core elements for developing the next generation of precise gene therapy tools for DFNB1A deafness.
[0007] Currently, the main target cells for deafness gene therapy are hair cells, and there are few studies on gene therapy targeting supporting cells. In order to achieve efficient transfection of supporting cells by AAV virus, we identified an enhancer of the Gjb2 gene. SUMMARY
[0008] The technical problem to be solved by the present application is to provide an enhancer that can enhance the specific expression of genes in cochlear supporting cells and its use.
[0009] The technical solution of the present application is an enhancer, the nucleotide sequence of which is shown in SEQ ID No. 1.
[0010] A vector containing the above-mentioned enhancer.
[0011] The above-mentioned enhancer or vector is used for enhancing the specific expression of genes in cochlear supporting cells for non-disease treatment purposes.
[0012] The above-mentioned enhancer or vector is used for preparing a product for enhancing the specific expression of genes in cochlear supporting cells.
[0013] Further, the gene is the Gjb2 gene.
[0014] The above-mentioned enhancer or vector is used for preparing a drug for deafness caused by mutation of the Gjb2 gene.
[0015] Compared with the prior art, the present application has the following beneficial effects:
[0016] The mouse microinjection system is used to confirm that the sequence is an enhancer, which can significantly enhance the transcriptional activity of the EGFP protein gene in the inner ear. Compared with other sequences of similar size, the enhancer sequence fragment can significantly enhance the expression ability of the reporter gene or the Gjb2 gene in the inner ear, and specifically express in the cochlear supporting cells, and is suitable for recombinant DNA, vectors or adenovirus biological materials, and is used for promoting the transcription of the EGFP gene or other genes in the inner ear.
[0017] The enhancer can significantly enhance the expression of the Gjb2 gene itself or other genes (such as the GFP gene) in inner ear supporting cells. By using the ability of the enhancer to specifically enhance gene expression in inner ear supporting cells, it can be used for gene therapy of deafness; and by integrating it to prepare recombinant DNA, vectors or adenoviruses containing the Gjb2 gene enhancer, gene expression regulation research can be carried out, and the application prospect is good. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 Vector structure diagram after cloning Gjb2 enhancer and EGFP to PiggyBac plasmid;
[0019] Figure 2 Comparison of mouse inner ear fluorescence effects when different enhancers are used; Group A: mouse inner ear after injection of PiggyBac-promoter vector, no fluorescence; Group B: mouse inner ear after injection of PiggyBac-Gjb2-promoter plasmid, fluorescence effect (top: whole inner ear cochlear basement membrane; middle: enlarged view; bottom: side view, Myo7a marks hair cells, Gjb2 enhancer specifically expresses GFP in supporting cells). DETAILED DESCRIPTION
[0020] The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all purchased from commercial channels unless otherwise specified.
[0021] Example 1 Cloning and activity analysis of Gjb2 gene enhancer sequence
[0022] I. Obtaining and positioning of Gjb2 gene enhancer
[0023] Gjb2 gene (NCBI accession number NM_008125.3) is mainly specifically expressed in animal inner ear supporting cells. Therefore, the physical and functional units of Gjb2 gene were analyzed in the previous stage, and the enhancer that enables Gjb2 gene to be specifically expressed in the inner ear was found, and the nucleotide sequence thereof is SEQ ID No. 1. According to genome positioning, the enhancer shown in SEQ ID No. 1 is located in the regulatory region of the Gjb2 gene, and it is judged that the enhancer is the Gjb2 gene enhancer.
[0024] II. Verification of enhancing the expression of target genes
[0025] 1. Method
[0026] (1) The Hsp68 promoter sequence (vector PCR4-Hsp68::lacZ-H11 from Addgene, Plasmid #139099) was cloned upstream of the reporter gene EGFP to test the activity of the enhancer by detecting the expression of the EGFP gene. The PiggyBac vector, EGFP gene and Hsp68 promoter sequence were ligated, and to facilitate transposase-mediated transgene synthesis, the "P19 ins-Hsp68 promoter-Kozak-EGFP-EF-1a poly(A) signal-P19 ins" expression frame was inserted between the two ITRs of PiggyBac using In-Fusion technology, and the successfully ligated vector was named PiggyBac-promoter vector.
[0027] (2) The DNA of the mouse inner ear tissue was extracted, and the Gjb2 gene enhancer sequence (shown in SEQ ID No. 1, with a sequence length of 814 bp) was amplified;
[0028] The primer pairs used for PCR amplification of the Gjb2 gene enhancer region are as follows:
[0029] Gjb2-F: 5'- CGCGGATCCAATGCTTGACTAGATGTGAG-3' (SEQ ID No. 2)
[0030] Gjb2-R: 5'- CCGCTCGAGCTGCCAATCCTGCAACAAA -3' (SEQ ID No. 3).
[0031] (3) The enhancer sequence was transferred into the PiggyBac-promoter vector using ClonExpress Ultra One Step Cloning Kit (Vazyme, C115-01 / 02), and the successfully constructed plasmid was named PiggyBac-Gjb2-promoter plasmid, as shown in Figure 1 .
[0032] (4) Preparation of injection solution: The PiggyBac-Gjb2-promoter plasmid and the PiggyBac vector were respectively configured into the same injection concentration (4 ng / ul) and stored at 4°C for standby.
[0033] (5) Obtain mouse zygotes: healthy and age-appropriate female mice (usually 3-4 weeks old) were selected for superovulation treatment. After superovulation for 12-14 hours, these female mice were mated with healthy and sexually mature male mice. The female mice were dissected the next morning, and the zygotes in their oviducts were collected.
[0034] (6) Microinjection of exogenous DNA: The collected zygotes were placed in a culture medium containing HEPES buffer, and a PiggyBac-Gjb2-promoter plasmid solution was directly injected into the zygotes using a microinjection needle. After the injection was completed, the zygotes were moved into a culture dish containing a suitable culture medium and continued to be incubated. Usually, 10-20 zygotes were implanted into the oviduct of each pseudopregnant female mouse until the implantation was completed. After the implantation was completed, the female mice were individually raised and observed for pregnancy. Meanwhile, a control was set up, i.e., a PiggyBac-promoter vector without a Gjb2 gene enhancer sequence was microinjected in the same manner as a control.
[0035] (7) Identification of transgenic mice: After the successful embryo transplantation, the mouse embryos were taken at the required time for detection. The mouse head was cut, the skull was opened, the brain tissue was removed, and the temporal bone was exposed to take out the cochlea. After the cochlea was taken out, it was moved into a culture dish containing pre-cooled 1XPBS; under a dissecting microscope, the bone wall of the cochlea shell at the apex of the cochlea was picked up with a sharp needle, and then the cochlea shell was peeled off along the gap between the spiral ligament and the cochlea shell until the complete spiral ligament was fully exposed; then the entire spiral ligament was separated and taken out with a sharp needle or forceps, and immediately transferred to a 2ml centrifuge tube containing 4% paraformaldehyde, and fixed at 4°C for 30min. After 30min, the spiral ligament was removed under a dissecting microscope, and the whole cochlear basement membrane was evenly laid on a glass slide, and DAPI (4', 6 - diamidino - 2 - phenylindole) was added and then the glass slide was sealed. Finally, under a fluorescence microscope, the nuclear signal of the basement membrane was observed in the DAPI fluorescence channel, the EGFP signal was observed in the 488nm laser excitation channel, and the whole complete basement membrane, the top, the middle and the local basement membrane pictures were taken.
[0036] 2. Results
[0037] According to Figure 2 It can be seen that in the embryos injected with the PiggyBac-Gjb2-promoter plasmid (containing the Gjb2 gene enhancer-EGFP), the cochlear supporting cells showed green fluorescence different from the hair cells shown by Myo7a (Fig. Figure 2 B), and there was no green fluorescence in other cells; in the embryos injected with the exogenous gene of the PiggyBac-promoter vector (without the Gjb2 gene enhancer sequence), the cochlear supporting cells had no fluorescence signal (Fig. Figure 2 A), indicating that the EGFP gene can be specifically expressed in the supporting cells under the action of the Gjb2 enhancer, and cannot be specifically expressed in the supporting cells without the action of the Gjb2 gene enhancer (Fig. Figure 2 A).
[0038] The experimental results can prove that the Gjb2 gene enhancer can specifically enhance the expression of the EGFP gene in the supporting cells, is consistent with the expression characteristics of Gjb2 in the existing literature, and verifies that the enhancer is the Gjb2 gene enhancer.
[0039] In conclusion, the enhancer shown in SEQ ID No. 1 is determined as the Gjb2 gene enhancer, the enhancer can significantly enhance the expression of the Gjb2 gene itself or other genes in the cochlear supporting cells, and the ability of the enhancer to specifically enhance the gene expression in the inner ear supporting cells can be used for the gene therapy of deafness; the enhancer is integrated to prepare the recombinant DNA, the carrier or the adenovirus containing the Gjb2 gene enhancer, and the biological material is used for the gene expression regulation research, and has a good application prospect.
Claims
1. Enhancer, whose nucleotide sequence is shown in SEQ ID No.
1.
2. A carrier containing the enhancer of claim 1.
3. The use of the enhancer of claim 1 or the vector of claim 2 in enhancing gene-specific expression in cochlear support cells for non-disease treatment purposes.
4. The use of the enhancer of claim 1 or the vector of claim 2 in the preparation of products that enhance gene-specific expression in cochlear supporting cells.
5. The application according to claim 4, characterized in that, The gene in question is the Gjb2 gene.
6. The use of the enhancer of claim 1 or the vector of claim 2 in the preparation of a drug for deafness caused by Gjb2 gene mutation.