Gene GmeIF2B5 for improving salt tolerance of soybeans and application of gene GmeIF2B5
By knocking out the soybean GmeIF2B5 gene using CRISPR gene editing technology, the growth and yield problems caused by soybean salt stress were solved, and a new variety with high salt tolerance was bred, improving the salt resistance and yield of soybeans.
Patent Information
- Application Number
- CN202411075497.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-07
- Publication Date
- 2026-02-10
AI Technical Summary
Salt stress severely affects the growth and yield of soybeans, limits agricultural productivity, and threatens food security. Current technologies lack effective salt-resistant genes for breeding salt-tolerant soybean varieties.
By knocking out or silencing the soybean GmeIF2B5 gene using CRISPR gene editing technology and introducing it into soybean cells using a recombinant expression vector, salt tolerance can be improved, thus cultivating salt-tolerant soybean varieties.
It significantly improved the salt tolerance of soybeans, enhanced their growth and development under salt stress, and increased crop yield and biomass.
Smart Images
Figure BDA0004982114790000031 
Figure BDA0004982114790000041 
Figure HDA0004982114800000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering, specifically relating to a gene GmeIF2B5 that improves salt tolerance in soybeans and its application. Background Technology
[0002] Environmental stress severely impacts crop growth and yield, especially salt stress, which limits agricultural plant productivity and threatens food security. Water loss and salt stress during vegetative growth lead to decreased seed quality; during reproductive growth, they directly affect kernel development, consequently impacting seedling development and biomass, and ultimately affecting the yield of the next generation. The total global area of saline-alkali land is approximately 1.1 × 10⁹ hm². 2 Soybeans (G. max(L.) Merr.) are distributed in 100 countries and regions. As a major global crop, soybeans provide humans with vegetable oils and proteins, but their growth and yield are severely limited by salt stress. Therefore, exploring salt-tolerant genes for breeding new varieties to ensure crop yield and food security is of great significance for improving our quality of life.
[0003] eIFs encode translation initiation factors in eukaryotes, regulating cellular activity and signal transduction. eIFs include eIF1-eIF6, with GmeIF2B5 belonging to the eIF2B family, playing a crucial role in regulating protein synthesis in yeast and humans. eIF2B mutations cause several diseases in infants and young children, but no related cases have been reported in plants. Summary of the Invention
[0004] The purpose of this invention is to provide the soybean GmeIF2B5 gene and its application in salt tolerance. This gene can be introduced into plants to improve the salt tolerance of soybeans and to breed new varieties.
[0005] One of the objectives of this invention is to provide a gene GmeIF2B5.
[0006] The second objective of this invention is to provide the application of the gene GmeIF2B5.
[0007] The specific details of this invention are as follows:
[0008] This invention provides a gene GmeIF2B5, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0009] This invention also provides primers for amplifying the GmeIF2B5 gene:
[0010] GmeIF2B5-F ATGCCGGATGTTCATACCCTCGTT
[0011] GmeIF2B5-R TCAACTCCCTGTAGTGGGTCTTCG.
[0012] The present invention also provides a recombinant expression vector containing the gene GmeIF2B5.
[0013] The recombinant expression vector can be formed by inserting the gene GmeIF2B5 described in this invention into an expression plasmid commonly used in plant genetic transformation.
[0014] Gene editing vectors can be used to silence or knock out the gene GmeIF2B5. The gene GmeIF2B5 described in this invention can be silenced or knocked out through genetic transformation.
[0015] Primers, sgRNAs, or knockout vectors for GmeIF2B5 knockout are also protected by this invention. The primers and sgRNAs for GmeIF2B5 knockout can be designed according to conventional methods in the art. In some specific examples, the knockout primer pairs are shown in SEQ ID NO. 2 and SEQ ID NO. 3; or the knockout primer pairs are shown in SEQ ID NO. 4 or SEQ ID NO. 5. In some embodiments, the sgRNA sequence is shown in SEQ ID NO. 6 or SEQ ID NO. 7.
[0016] When constructing plant expression vectors using GmeIF2B5, any enhanced or inducible promoter can be added before the transcription initiation nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector can be modified, for example, by adding selective marker genes expressed in the plant (GUS gene, GFP gene, etc.) or antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.). From a safety perspective, no selective marker genes may be added, and transformed plants can be screened directly based on phenotype.
[0017] The plant expression vector carrying the present invention can be used to transform soybean cells or tissues using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed soybean tissues can be cultured into soybean plants.
[0018] This invention also provides the application of the aforementioned gene GmeIF2B5 or primers, sgRNAs, knockout vectors, or transformants for knocking out GmeIF2B5 in improving the salt tolerance of soybeans. Specifically, it involves knocking out the GmeIF2B5 gene using CRISPR gene knockout technology.
[0019] This invention also provides the application of the aforementioned gene GmeIF2B5 or primers, sgRNAs, knockout vectors, or transformants for knocking out GmeIF2B5 in the breeding of salt-tolerant soybean varieties. Specifically, it involves knocking out the GmeIF2B5 gene using CRISPR gene knockout technology.
[0020] The present invention also provides the application of substances that knock out or silence the rice GmeIF2B5 gene in improving the salt tolerance of soybeans, wherein the substances that knock out or silence the rice GmeIF2B5 gene are CRISPR-CAS9 vectors or CRISPR-CAS9 vector compositions targeting the rice GmeIF2B5 gene.
[0021] This invention also provides a method for breeding salt-tolerant soybean varieties by knocking out the GmeIF2B5 gene using CRISPR gene knockout technology.
[0022] The beneficial effects of this invention are:
[0023] This invention identified the GmeIF2B5 protein, and GmeIF2B5 inducible expression analysis showed that it participates in salt induction. GmeIF2B5 gene-edited lines improved soybean salt resistance. Attached Figure Description
[0024] Figure 1 PCR amplification product of GmeIF2B5;
[0025] Figure 2 Tissue expression pattern analysis of GmeIF2B5;
[0026] Figure 3 Analysis of the expression pattern of GmeIF2B5 induced by 200mM NaCl;
[0027] Figure 4 gmeif2b5 edited strain T0 generation target peak diagram;
[0028] Figure 5 Phenotypic analysis of gmeif2b5 gene-edited lines in terms of salt tolerance. Detailed Implementation
[0029] The present invention will be further described below with reference to embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention. Any simple improvements to the preparation method of the present invention under the premise of the concept of the present invention are within the protection scope of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally carried out in accordance with well-known means in the art.
[0030] Example 1: Cloning of the GmeIF2B5 gene
[0031] The GmeIF2B5 gene was searched using Phytozome (http: / / www.phytozome.net / ). Its CDS sequence length is 1248 bp (as shown in SEQ ID NO.1), encoding 416 amino acids, with a protein molecular weight of 44.54 kDa and an isoelectric point of 6.019. Primers (GmeIF2B5-F and GmeIF2B5-R) were designed, and their sequences are shown in Table 1. The amplified size was 1248 bp. Figure 1 ).
[0032] Table 1 Primer sequences
[0033]
[0034]
[0035] The GmeIF2B5 gene was cloned using RT-PCR with a mixed sample of roots, stems, and leaves from the soybean cultivar Tianlong No. 1 as a template. Soybean root, stem, and leaf tissues were collected, ground in a mortar, and added to 1.5 ml EP tubes containing lysis buffer. After thorough shaking, total RNA was extracted using the RNAprep Pure Plant Kit (Tiangen, Beijing). The reverse transcription was performed according to the YEASEN (Shanghai, China) reverse transcription kit. III. First-strand cDNA was obtained through reverse transcription using 1st-strand cDNA Synthesis SuperMix for qPCR (gDNAdigester plus), followed by PCR amplification. The PCR program was as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 15 seconds remission (temperature determined by primers), 72℃ extension for 1.5 minutes, for a total of 35 cycles, followed by incubation at 72℃ for 5 minutes, and finally isothermal treatment at 12℃. The PCR product was then purified by gel extraction, ligated into the pBin-GFP4 vector, and transformed into *E. coli* competent cells DH5α. Positive single clones were picked and sequenced.
[0036] Example 2: Expression analysis of GmeIF2B5 in different soybean tissues and under abiotic stress.
[0037] Under normal field growing conditions, soybean roots, epicotyls, hypocotyls, leaves, and cotyledons were collected, flash-frozen in liquid nitrogen, and stored at -80℃. One-week-old soybean cultivar Tianlong No. 1, cultured in an artificial climate chamber, was subjected to hydroponic induction treatment with 200 mM NaCl. Samples were taken at different time points, with leaves as the sampled tissue. Three plants constituted one replicate, and three replicates were taken at each time point. All samples were flash-frozen in liquid nitrogen and stored at -80℃.
[0038] Total RNA extraction and cDNA reversal were performed in the same manner as in Example 1.
[0039] Using the constitutively expressed GmActin11 gene in soybean as an internal reference, quantitative real-time PCR analysis was performed on cDNA from the cultivated soybean cultivar Tianlong No. 1 as a template. The results showed that GmeIF2B5 was expressed most highly in the hypocotyl. Figure 2 GmeIF2B5 tissue expression pattern analysis, R: root; L: leaf; C: cotyledon; E: epicotyl; H: hypocotyl). The GmeIF2B5 gene can be induced by 200 mM NaCl. Figure 3 Expression pattern of GmeIF2B5 in leaves of soybean cultivar Tianlong No. 1 under 200mM NaCl induction. This indicates that the gene plays an important role in salt stress.
[0040] Example 3: Genetic Engineering Applications of GmeIF2B5
[0041] Based on the CRISPR-P website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), using the GmeIF2B5 exon sequence as a template, suitable target sites were located using PAM sequences. In this study, two pairs of primers were designed using the U6 promoter to drive SgRNA (Table 1: GmeIF2B5-PUC1 / 4). Root root analysis showed that only one pair of primers from each pair failed to target the target. Primer sequences are shown in Table 1. The primers were ligated into the Cas9 vector, and after bacterial testing and sequencing, the plasmids were extracted and transformed into Agrobacterium rhizogenes K599 and Agrobacterium tumefaciens EHA101 strains using electroporation to infect soybean cotyledon nodes (soybean cultivar Tianlong No. 1). The obtained T0 generation was sequenced and analyzed (…). Figure 4 Positive lines were used for propagation and selection to identify pure lines. Two prematurely terminated Gmeif2b5 gene-edited lines were obtained in the T2 generation. Figure 5 (a: location of PAM site and homogenized base sequence), followed by salt stress treatment after addition generation. Results showed that the Gmeif2b5 strain had higher salt tolerance than WT ( Figure 5 b: bud stage phenotype), hypocotyl and total root length ( Figure 5 c) Supports the above viewpoint; the results at the seedling stage and the bud stage show the same trend. Figure 5 d), manifested in a significantly lower relative ion permeability than WT ( Figure 5 e). All the above results indicate that GmeIF2B5 plays an important role in the salt tolerance of soybeans and is a negative regulator of soybean salt tolerance.
Claims
1. A gene GmeIF2B5, the nucleotide sequence of which is shown in SEQ ID NO.
1.
2. Knock out the primers for GmeIF2B5 as described in claim 1.
3. The primer according to claim 2, characterized in that, The sequences are as shown in SEQ ID NO.2 and SEQ ID NO.3; or the sequences are as shown in SEQ ID NO.4 or SEQ ID NO.
5.
4. Knock out the sgRNA of GmeIF2B5 as described in claim 1.
5. The sgRNA sequence according to claim 4 is shown in SEQ ID NO. 6 or SEQ ID NO.
7.
6. Knockout vector of GmeIF2B5 as described in claim 1.
7. The application of the gene GmeIF2B5 shown in SEQ ID NO.1, the primers of claim 2 or 3, the sgRNA of claim 4 or 5, or the knockout vector of claim 6 in improving the salt tolerance of soybeans; preferably, the gene GmeIF2B5 is knocked out by CRISPR gene knockout technology.
8. The application of the gene GmeIF2B5 shown in SEQ ID NO.1, the primers of claim 2 or 3, the sgRNA of claim 4 or 5, or the knockout vector of claim 6 in the breeding of salt-tolerant soybean varieties; preferably, the gene GmeIF2B5 is knocked out by CRISPR gene knockout technology.
9. Application of substances that knock out or silence the rice GmeIF2B5 gene in improving the salt tolerance of soybeans, wherein the sequence of the GmeIF2B5 gene is shown in SEQ ID NO.1, and the substances that knock out or silence the rice GmeIF2B5 gene are CRISPR-CAS9 vectors or CRISPR-CAS9 vector compositions targeting the rice GmeIF2B5 gene.
10. A method for breeding salt-tolerant soybean varieties, wherein the gene GmeIF2B5 is knocked out using CRISPR gene knockout technology, and the sequence of the gene GmeIF2B5 is shown in SEQ ID NO.1.