High-yield L-homoserine engineering bacterium as well as construction method and application thereof

Abstract

The invention belongs to the technical field of microbial metabolism and genetic engineering, and relates to construction and application of engineering bacteria for producing L-homoserine. The construction method of the high-yield L-homoserine engineering bacteria provided by the invention is characterized in that escherichia coli (E.coli Bio-67727) for producing threonine is used as an original strain; a homoserine kinase coding gene thrB and a homoserine O-succinyltransferase coding gene metA are knocked out, and the expression of aspartate kinase I ThrA, aspartate semialdehyde dehydrogenase Asdbs, aspartate kinase III LysCpa, glucokinase Glk and a homoserine extracellular transport protein RhtA is enhanced. The engineering bacteria constructed by the invention can accumulate 156.2 g / L of L-homoserine after being fermented for 80 hours. The engineering bacterium does not carry plasmids, induction is not needed in the fermentation process, control is easy, and application to industrial production is facilitated.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial metabolic engineering and genetic engineering. Specifically, it relates to a genetically engineered bacterium for efficiently producing L-homoserine, a method for constructing the bacterium and an application thereof. BACKGROUND

[0002] Homoserine (molecular formula: C4H9NO3) is a non-protein amino acid, which has two isomers, L-homoserine and D-homoserine. L-homoserine is a precursor of essential amino acids such as L-methionine, L-threonine and L-isoleucine, and is involved in various physiological and biochemical reactions and biological metabolic processes, and has important physiological functions and application values. L-homoserine is also an important platform compound, which is widely used in food, cosmetics, medicine and feed industries, and can be used as a synthetic material or intermediate for various chemical products, such as L-glufosinate, which has herbicidal activity, thereby reducing the use amount and cost of herbicides and the harm to soil and crops.

[0003] Traditional methods for producing L-homoserine include chemical synthesis, chemical chiral resolution and biological methods. At present, chemical synthesis is dominant among the three methods. Biological methods include enzymatic method and fermentation method. The enzymatic method has the characteristics of high cost and environmental unfriendliness due to the use of expensive coenzymes and toxic raw materials such as formaldehyde and formic acid. The chemical synthesis method and the chemical chiral resolution method have the problems of high cost, complex process and the use of large amounts of organic solvents, which pose a great threat to the environment. Microbial fermentation method has many advantages such as low cost, mild conditions and less environmental pollution, and therefore is the preferred process for producing various amino acids.

[0004] Fermentation method started late, initially its market is mainly Japan, the United States using microbial fermentation method to obtain a small amount of product. With the rapid development of metabolic engineering and synthetic biology, the fermentation method for synthesizing L-homoserine has attracted widespread attention. At present, there are many patents providing L-homoserine producing engineering bacteria, such as "CN1175353 30A, CN117286087A, CN116622607A" of Zhejiang University of Technology, "CN112779204B, CN11718 7151A" of Tianjin University of Science and Technology, "CN118497101B" of the Institute of Microbiology of the Chinese Academy of Sciences, "CN117384811A" of Nanjing Shengdechuangying Biological Technology Co., Ltd. According to the data, the existing research mainly takes the model strain as the chassis strain, and modifies the homoserine main synthesis pathway, the external transport system and the cofactor module, as well as the competition and degradation pathway. Escherichia coli uses glucose as the substrate, and synthesizes homoserine through glycolysis, tricarboxylic acid cycle and aspartate pathway. Homoserine is converted into threonine under the action of homoserine kinase. According to the existing patent literature, the homoserine kinase gene thrB of Escherichia coli cannot accumulate homoserine by itself. In this study, the selected chassis strain is an Escherichia coli with threonine production ability selected by selection pressure. Compared with other Escherichia coli, its metabolic pathway has the innate advantage of accumulating homoserine. By knocking out the thrB gene to block the threonine production channel of homoserine metabolism, the strain can directly accumulate homoserine. Further modification of other related metabolic pathways can obtain a strain with high yield of L-homoserine.

[0005] At present, homoserine is mainly produced by chemical synthesis method, which has the problems of complex process, high technical barrier, low safety, serious environmental pollution and the like. Although the production strain of L-homoserine has achieved a certain high yield, the yield and conversion rate of L-homoserine in fermentation production still have a certain distance from industrial production. Therefore, improving the production performance of L-homoserine engineering bacteria is the goal of those skilled in the art. SUMMARY

[0006] Therefore, the purpose of the present application is to overcome the deficiencies in the prior art, provide a recombinant Escherichia coli with high yield of L-homoserine and a construction method thereof, and apply it to the fermentation production of L-homoserine, so as to overcome the problem of low yield of L-homoserine production strain in the fermentation production of L-homoserine in the prior art.

[0007] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:

[0008] In a first aspect, the present application provides any one of the following applications in constructing L-homoserine production strain and / or fermentation production of L-homoserine, comprising:

[0009] (I) Knock out or weaken the expression of thrB and / or metA genes in the homoserine degradation pathway;

[0010] and / or

[0011] (II) Enhance the expression of any one or more of the following:

[0012] (II-1), thrA, asd bs lysC pa The expression;

[0013] (II-2) Expression of glk;

[0014] (II-3) Expression of rhtA.

[0015] In some specific embodiments of the present invention, Escherichia coli Bio-67727 is used as the chassis strain.

[0016] In some specific embodiments of the present invention, the knocking method includes non-marking knocking;

[0017] The thrA, asd bs lysC pa , glk and / or rhtA are expressed by strong promoters;

[0018] As a preferred option, a strong promoter P is used. em7 For thrA, asd bs and / or lysC pa It has been expressed;

[0019] As a preferred option, a strong promoter P is used. tac Overexpression of glk and / or rhtA;

[0020] Preferably, the strong promoter P tac have:

[0021] (i) A nucleotide sequence as shown in SEQ ID No. 50; or

[0022] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0023] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0024] Preferably, the strong promoter P em7 have:

[0025] (i) A nucleotide sequence as shown in SEQ ID No. 51; or

[0026] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0027] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

[0028] In some specific embodiments of the present invention, the thrA is integrated into the efeU gene site, and the asd bs Integrated into the ilvG gene site, the lysC pa It is integrated into the yghX gene locus, and the glk is integrated into the lafU gene locus.

[0029] In some specific embodiments of the present invention, the enhanced expression of the thrA gene is derived from an Escherichia coli K12-derived strain, and the enhanced expression of the asd gene... bs The gene is derived from Bacillus subtilis subsp. 168, and its expression is enhanced by lysC. pa The glk gene, derived from Pseudomonas aeruginosa PAO1, with enhanced expression, originates from Escherichia coli K12-derived strains.

[0030] In some specific embodiments of the present invention, the thrB has:

[0031] (i) A nucleotide sequence as shown in SEQ ID No. 52; or

[0032] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0033] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0034] The metA has:

[0035] (i) A nucleotide sequence as shown in SEQ ID No. 53; or

[0036] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0037] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0038] The thrA has:

[0039] (i) A nucleotide sequence as shown in SEQ ID No. 54; or

[0040] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0041] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0042] The asd bs have:

[0043] (i) A nucleotide sequence as shown in SEQ ID No. 55; or

[0044] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0045] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0046] The lysC pa have:

[0047] (i) A nucleotide sequence as shown in SEQ ID No. 56; or

[0048] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0049] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0050] The rhtA has:

[0051] (i) A nucleotide sequence as shown in SEQ ID No. 57; or

[0052] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0053] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0054] The glk has:

[0055] (i) A nucleotide sequence as shown in SEQ ID No. 58; or

[0056] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0057] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

[0058] Secondly, the present invention also provides a genetically engineered bacterium that produces high levels of L-homoserine, comprising:

[0059] (I) Knock out or weaken the expression of thrB and / or metA genes in the homoserine degradation pathway;

[0060] and / or

[0061] (II) Enhance the expression of any one or more of the following:

[0062] (II-1), thrA, asd bs lysC pa The expression;

[0063] (II-2) Expression of glk;

[0064] (II-3) Expression of rhtA.

[0065] In some specific embodiments of the present invention, the genetically engineered bacteria uses Escherichia coli Bio-67727 as the chassis strain.

[0066] In some specific embodiments of the present invention, the knocking method includes non-marking knocking;

[0067] The thrA, asd bs lysC pa , glk and / or rhtA are expressed by strong promoters;

[0068] As a preferred option, a strong promoter P is used. em7 For thrA, asd bs and / or lysC pa It has been expressed;

[0069] As a preferred option, a strong promoter P is used. tac Overexpression of glk and / or rhtA;

[0070] Preferably, the strong promoter P tac have:

[0071] (i) A nucleotide sequence as shown in SEQ ID No. 50; or

[0072] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0073] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0074] Preferably, the strong promoter P em7 have:

[0075] (i) A nucleotide sequence as shown in SEQ ID No. 51; or

[0076] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0077] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

[0078] In some specific embodiments of the present invention, the thrA is integrated into the efeU gene site, and the asd bs Integrated into the ilvG gene site, the lysC pa It is integrated into the yghX gene locus, and the glk is integrated into the lafU gene locus.

[0079] In some specific embodiments of the present invention, the enhanced expression of the thrA gene is derived from an Escherichia coli K12-derived strain, and the enhanced expression of the asd gene... bs The gene is derived from Bacillus subtilis subsp. 168, and its expression is enhanced by lysC. pa The glk gene, derived from Pseudomonas aeruginosa PAO1, with enhanced expression, originates from Escherichia coli K12-derived strains.

[0080] In some specific embodiments of the present invention, the thrB has:

[0081] (i) A nucleotide sequence as shown in SEQ ID No. 52; or

[0082] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0083] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0084] The metA has:

[0085] (i) A nucleotide sequence as shown in SEQ ID No. 53; or

[0086] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0087] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0088] The thrA has:

[0089] (i) A nucleotide sequence as shown in SEQ ID No. 54; or

[0090] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0091] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0092] The asd bs have:

[0093] (i) A nucleotide sequence as shown in SEQ ID No. 55; or

[0094] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0095] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0096] The lysC pa have:

[0097] (i) A nucleotide sequence as shown in SEQ ID No. 56; or

[0098] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0099] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0100] The rhtA has:

[0101] (i) A nucleotide sequence as shown in SEQ ID No. 57; or

[0102] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0103] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0104] The glk has:

[0105] (i) A nucleotide sequence as shown in SEQ ID No. 58; or

[0106] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0107] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

[0108] Thirdly, the present invention also provides a method for constructing the genetically engineered bacteria.

[0109] In some specific embodiments of the present invention, the construction method includes any one or more of the following steps:

[0110] Step (A): Use CRISPR / Cas technology to knock out the thrB gene, which encodes homoserine kinase, in E. coli without scarring;

[0111] Step (B): The homoserine O-succinyltransferase encoding gene metA was knocked out without scarring using CRISPR / Cas technology;

[0112] Step (C): The gene encoding aspartate kinase I-homoserine dehydrogenase I, thrA, is transferred from the strong promoter P... em7 Control, will force the starter P em7 The controlled gene thrA integrates into the efeU gene locus;

[0113] Step (D): The aspartate semialdehyde dehydrogenase encoding gene asd bs By strong promoter P em7 Control, will force the starter P em7 Controlled genes asd bs Integration into the ilvG gene locus; asd bs The gene is derived from Bacillus subtilis subsp. 168;

[0114] Step (E): The aspartate kinase III encoding gene lysC pa By strong promoter P em7 Control, will force the starter P em7 Controlled gene lysC pa Integration into the yghX gene locus; lysC pa Derived from Pseudomonas aeruginosa PAO1;

[0115] Step (F): The homoserine efflux transporter gene rhtA is transferred from the strong promoter P... tac Control, utilizing the strong promoter P tac Replace the in situ promoter of the rhtA gene;

[0116] Step (G): The glucokinase encoding gene glk is transferred from the strong promoter P tac Control, will force the starter P tac The controlled gene glk integrates into the lafU gene locus;

[0117] There is no specific order between the steps; they can be performed individually or combined in any way.

[0118] Fourthly, the present invention also provides a genetically engineered bacterium for fermentation production of L-homoserine obtained by the construction method described above.

[0119] Fifthly, the present invention also provides the application of the genetically engineered bacteria in the fermentation production of L-homoserine.

[0120] In a sixth aspect, the present invention also provides a method for producing L-homoserine by fermentation, wherein the genetically engineered bacteria are selected, fermented, the fermentation broth is collected, purified, and L-homoserine is obtained.

[0121] Specifically, steps (1) to (7) achieved the following effects:

[0122] In step (A), the gene encoding homoserine kinase thrB is knocked out to reduce the homoserine degradation pathway;

[0123] In step (B), the gene metA encoding homoserine O-succinyltransferase is knocked out to reduce the synthesis of O-succinylhomoserine from homoserine and promote the accumulation of L-homoserine.

[0124] Step (C) Integration and insertion of P at the efeU gene site em7 -thrA sequence to enhance the expression level of aspartate kinase I-homoserine dehydrogenase I and promote L-homoserine accumulation;

[0125] Step (D) Integration of P into the ilvG gene site em7 -asd bs Sequences were modified to enhance the expression level of aspartate-semialdehyde dehydrogenase and promote the accumulation of L-homoserine.

[0126] Step (E) involves integration and insertion of P at the yghX gene locus. em7 -lysC pa Sequence modification to enhance the expression level of aspartate kinase III and promote the synthesis of aspartate phosphate from aspartate; Step (F) utilizes the strong promoter P tac The in situ promoter of the rhtA gene was replaced to enhance the expression level of serine efflux transporter and promote the extracellular transport of L-homoserine.

[0127] Step (G) involves integration and insertion of P at the lafU gene site. tac -glk sequence to enhance glucokinase expression levels and promote glucose conversion.

[0128] By performing at least one of the above construction steps, a recombinant Escherichia coli that efficiently produces L-homoserine can be constructed.

[0129] Furthermore, by combining and executing the above seven construction steps, this invention successfully obtained recombinant Escherichia coli that efficiently produces L-homoserine.

[0130] The coding gene sequence involved in this invention is as follows:

[0131] The homoserine kinase encoding gene thrB has the nucleotide sequence shown in SEQ ID No. 52;

[0132] The homoserine O-succinyltransferase encoding gene metA has the nucleotide sequence shown in SEQ ID No. 53;

[0133] The nucleotide sequence of the aspartate kinase I-homoserine dehydrogenase I encoding gene thrA is shown in SEQ ID No. 54.

[0134] The aspartate semialdehyde dehydrogenase encoding gene asd bs The nucleotide sequence is shown in SEQ ID No. 55;

[0135] The gene encoding aspartate kinase III, lysC pa The nucleotide sequence is shown in SEQ ID No. 56;

[0136] The homoserine extracellular transporter gene rhtA has the nucleotide sequence shown in SEQ ID No. 57.

[0137] The glucokinase encoding gene glk has the nucleotide sequence shown in SEQ ID No. 58.

[0138] Further, the application involves inoculating any of the recombinant *E. coli* strains into a fermentation basal medium and fermenting at 35°C and 180-220 rpm. The culture medium is then separated and purified to obtain L-homoserine, which is preferred. The final composition of the fermentation medium is as follows: glucose 45 g / L, ammonium sulfate 17 g / L, yeast extract 4 g / L, potassium dihydrogen phosphate 2 g / L, MgSO4 1.5 g / L, L-threonine 0.40 g / L, L-methionine 0.4 g / L, calcium carbonate 0.1 g / L, FeSO4 0.01 g / L, MnSO4 0.01 g / L, ZnSO4 0.01 g / L, with deionized water as the solvent. The pH is 7.0, and the medium is autoclaved at 121°C for 30 min.

[0139] Furthermore, before fermentation, slant activation and seed culture are performed first. Then, the secondary seed culture is inoculated into the fermentation basal medium at a concentration of 5% by volume. The slant activation method is as follows: recombinant Escherichia coli is inoculated onto LB plates and cultured overnight at 35°C to obtain slant cells. The seed culture method is as follows: a single colony of the slant cells is picked and inoculated into LB liquid medium and cultured overnight at 35°C and 200 rpm to obtain the primary seed culture. The primary seed culture is then inoculated into TB medium at a concentration of 10% by volume and cultured for 5 hours at 37°C and 200 rpm to obtain the secondary seed culture.

[0140] Compared with the prior art, the present invention has the following beneficial effects:

[0141] The initial strain *E. coli* Bio-67727 provided in this invention possesses the ability to produce threonine, and its metabolic pathway can better convert carbon sources such as glucose into L-threonine. Subsequently, by modifying and knocking out the homoserine kinase thrB, the production of L-homoserine can be promoted. After multiple steps of modification, the optimal fermentation strain was obtained, with a shake-flask fermentation level of 28.7 g / L and a 50L fermentation level of 156.2 g / L, a sugar-acid conversion rate of 0.60 g / g, and a space-time yield of 1.95 g / L / h. Furthermore, this engineered bacterium does not carry plasmids, and the fermentation process does not require induction and is easy to control. Therefore, the recombinant *E. coli* provided in this invention has significant industrial application value. Attached Figure Description

[0142] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0143] Figure 1 The biomass OD of strain GS0-GS7 after 48 hours of shake-flask fermentation is shown. 600 Bar graph showing the concentrations of L-homoserine;

[0144] Figure 2 The biomass OD of strain GS7 during fed-batch fermentation in a 50L fermenter is shown. 600 Concentration curves of L-homoserine. Detailed Implementation

[0145] This invention discloses a genetically engineered bacterium for the efficient production of L-homoserine, its construction method, and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0146] This invention is achieved through the following technical solution:

[0147] This invention uses threonine-producing *Escherichia coli* as the starting strain, which was purchased from Beijing BioBio Biotechnology Co., Ltd., platform number: Bio-67727. In this study, this strain is named *E. coli* Bio-67727.

[0148] This invention includes at least one of the following construction steps:

[0149] Using CRISPR / Cas technology to perform scarless knockout of the thrB gene, which encodes homoserine kinase in E. coli;

[0150] The metA gene encoding homoserine O-succinyltransferase was knocked out without scarring using CRISPR / Cas technology.

[0151] The gene encoding aspartate kinase I-homoserine dehydrogenase I, thrA, was modified from the strong promoter P. em7 Control, will force the starter P em7 The controlled gene thrA integrates into the efeU gene locus;

[0152] The aspartate-semialdehyde dehydrogenase encoding gene asd bs By strong promoter P em7 Control, will force the starter P em7 Controlled genes asd bs Integration into the ilvG gene locus; asd bs The gene is derived from Bacillus subtilis subsp. 168;

[0153] The aspartate kinase III encoding gene lysC pa By strong promoter P em7 Control, will force the starter P em7 Controlled gene lysC pa Integration into the yghX gene locus; lysC pa Derived from Pseudomonas aeruginosa PAO1;

[0154] The gene rhtA, which encodes a homoserine efflux transporter, was modified from the strong promoter P. tac Control, utilizing the strong promoter P tac Replace the in situ promoter of the rhtA gene;

[0155] The glucokinase encoding gene glk was modified by the strong promoter P. tac Control, will force the starter P tac The controlled gene glk integrates into the lafU gene locus.

[0156] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0157] Unless otherwise specified, the test materials used in the following examples are all conventional biochemical reagents, which are all available on the market. Please refer to the instruction manual for usage methods.

[0158] The primer synthesis and sequence sequencing in this invention were completed by Qingke Biotechnology Co., Ltd.

[0159] In the examples described below, the term "enhancement" refers to increasing the activity of the enzyme encoded by the corresponding polynucleotide. This can be achieved by increasing the copy number of the gene or by replacing the gene's expression regulatory sequence on the genome (such as promoter substitution).

[0160] In the following examples, the LB liquid culture medium consisted of: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride, with deionized water as the solvent, and was sterilized at 121°C under high temperature and pressure for 30 min.

[0161] In the examples below, LB plates were prepared by adding agar to LB liquid medium at a final concentration of 20 g / L.

[0162] In the following examples, the TB culture medium consisted of: 12 g / L peptone, 24 g / L yeast extract, 5.04 g / L glycerol, 2.31 g / L dipotassium hydrogen phosphate, and 12.54 g / L potassium dihydrogen phosphate. The solvent was deionized water, and the medium was autoclaved at 121°C for 30 min.

[0163] The final composition of the fermentation medium in the following examples is as follows: glucose 45 g / L, ammonium sulfate 17 g / L, yeast extract 4 g / L, potassium dihydrogen phosphate 2 g / L, MgSO4 1.5 g / L, L-threonine 0.40 g / L, L-methionine 0.4 g / L, calcium carbonate 0.1 g / L, FeSO4 0.01 g / L, MnSO4 0.01 g / L, ZnSO4 0.01 g / L, deionized water as solvent, pH 7.0, autoclaved at 121°C for 30 min.

[0164] The culture medium in the following examples was: glucose 500 g / L, L-threonine 0.40 g / L, L-methionine 0.4 g / L, deionized water as solvent, and autoclaved at 121°C for 30 min.

[0165] The L-homoserine detection method in the following examples is as follows: Fermentation broth was centrifuged at 12000×g for 2 min, the precipitate was discarded, and the supernatant was diluted and the L-homoserine content was detected by HPLC. Detection conditions: Agilent C18 column (150 mm × 4.6 mm i.d., 5 μm); mobile phase: V(acetonitrile):V(water) = 40:60, flow rate: 0.3 mL / min, 0-15 min; mobile phase: V(acetonitrile):V(water) = 70:30, flow rate: 1 mL / min, 15.2-30 min; detection wavelength: 210 nm; column temperature: 30 ± 0.5℃. Derivatization reagent: 0.03 mol / L FMOC-Cl derivatization solution; buffer solution: 0.13 mol / L borate buffer solution with pH 9-10. Derivatization method: Take 0.5 mL of the centrifuged fermentation broth, add 1 mL of 0.13 mol / L borate buffer solution, and finally slowly add 1 mL of FMOC-Cl derivatization solution. Use a vortex apparatus (temperature: 30°C). o C, rotation speed: 400) oscillate for 30 min, then sample for analysis.

[0166] The following examples illustrate the preparation method for electrocompetent cells: After activating the relevant bacterial strains by streaking in LB solid medium, single colonies were picked and inoculated into LB liquid medium for overnight shaking culture. The overnight culture was then inoculated into LB liquid medium at a ratio of 1% and shaken for 2 hours until OD reached [value missing]. 600 At approximately 0.7 (logarithmic growth phase), transfer the bacterial culture to centrifuge tubes, centrifuge, and discard the supernatant. First, resuspend the cell pellet in pre-cooled sterile distilled water, centrifuge, and discard the supernatant. Then, resuspend the cell pellet in pre-cooled 10% glycerol solution, centrifuge, and discard the supernatant twice. Finally, resuspend the cells in pre-cooled 10% glycerol solution and aliquot for storage.

[0167] The electroporation method in the following examples is as follows: After adding plasmid DNA to competent cells and mixing well, the mixture is transferred to a pre-cooled electroporation cuvette to avoid immediate electroporation of air bubbles. 1 mL of preheated LB medium is quickly added and transferred to a 2 mL EP tube. The cells are then incubated at 37°C and 200 rpm for 1 h.

[0168] In the following examples, the pCas9 vector was derived from Addgene, catalog number: #62225.

[0169] In the following examples, the pTargetF vector was derived from Addgene, catalog number: #62226.

[0170] Table 1

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179] The present invention will be further illustrated below with reference to the embodiments:

[0180] Example 1: Knockout of the homoserine kinase encoding gene thrB

[0181] Using the NEB Q5® Site-Directed Mutagenesis Kit (catalog number E0552S), primers G1 and G2 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is ATTGCTCGGAGATGTAGTCA (as shown in SEQ ID No. 1), targeting the thrB gene. The mutated pTargetF was named pTargetF-thrB.

[0182] Using the E. coli Bio-67727 genome as a template, the upstream sequence of the thrB gene was amplified using primers G3 and G4 and Phanta Flash high-fidelity DNA polymerase. The downstream sequence of the thrB gene was amplified using primers G5 and G6. The upstream and downstream fragments were recovered by gel extraction and used as templates. Then, using overlapping PCR with primers G3 and G6 at both ends, the gene editing repair template Donor-thrB (thrB knockout) was obtained.

[0183] After electroporating the pCas9 plasmid into E. coli Bio-67727, the sample was plated on a plate containing 50 mg / L kanamycin resistance and incubated at 30°C to obtain strain E. coli Bio-67727 / pCas9. A portion of the E. coli Bio-67727 / pCas9 bacterial colony was picked and placed in a 250 mL shake flask containing 50 mL of LB medium containing kanamycin. The culture was incubated at 30°C and 220 rpm. When the OD of the medium reached... 600 When the concentration was 0.2, arabinose was added to a final concentration of 10 mM for induction, and OD... 600Competent cells were prepared at a concentration of 0.4. 2 μL of pTargetF-thrB plasmid and 10 μL of Donor-thrB template DNA were electroporated into E. coli Bio-67727 / pCas9 competent cells and plated on double antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C and 220 rpm. Single colonies with complete thrB gene knockout were identified using primers G3 and G6. Correctly sequenced single colonies were selected, cultured with 0.5 mM IPTG to eliminate the pTargetF-thrB plasmid, and the engineered strain E. coli Bio-67727△thrB / pCas was obtained.

[0184] The bacteria were further inoculated into non-resistant LB liquid medium and cultured at 37°C for 12 hours. The culture was then diluted and spread onto LB plates to obtain the engineered strain E. coli Bio-67727△thrB with pCas9 plasmid eliminated, which was named GS1.

[0185] thrB sgRNA target ATTGCTCGGAGATGTAGTCA (as shown in SEQ ID No. 1)

[0186] G1: GATGTAGTCAGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 2)

[0187] G2: TCCGAGCAATGACTAGTATTATACCTAGG (as shown in SEQ ID No. 3)

[0188] G3: GGGTGATGTTGCCGCTTTTATGG (as shown in SEQ ID No. 4)

[0189] G4: AGATTGTAGAGTTTCATGTCAGACTCCTAACTTCCATGAG (as shown in SEQ ID No. 5)

[0190] G5: GGAAGTTAGGAGTCTGACATGAAACTCTACAATCTGAAAG (as shown in SEQ ID No. 6)

[0191] G6: GTCACTGGCTTATCACCCGCAAT (as shown in SEQ ID No. 7).

[0192] Example 2: Knockout of metA gene encoding homoserine O-succinyltransferase

[0193] Using the NEB Site-Directed Mutagenesis Kit (catalog number E0552S), primers G7 and G8 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is AACTTCTCGTGCGTCTGGTC (as shown in SEQ ID No. 8), targeting the metA gene. The mutated pTargetF was named pTargetF-metA.

[0194] Using the E. coli Bio-67727 genome as a template, the upstream sequence of the metA gene was amplified using primers G9 and G10 and Phanta Flash high-fidelity DNA polymerase. The downstream sequence of the metA gene was amplified using primers G11 and G12. The upstream and downstream fragments were recovered by gel extraction and used as templates. The gene editing repair template Donor-metA, which knocks out metA, was obtained by overlapping PCR using primers G9 and G12 at both ends.

[0195] After electroporating the pCas9 plasmid into GS1, the sample was plated on a plate containing 50 mg / L kanamycin and incubated at 30°C to obtain strain GS1 / pCas9. A portion of the GS1 / pCas9 bacterial colony was picked and placed in a 250 mL shake flask containing 50 mL of LB broth containing kanamycin, and incubated at 30°C and 220 rpm. When the OD of the medium reached... 600 When the concentration was 0.2, arabinose was added to a final concentration of 10 mM for induction, and OD... 600 Competent cells were prepared at a concentration of 0.4. 2 μL of pTargetF-metA plasmid and 10 μL of Donor-metA template DNA were electroporated into GS1 / pCas9 competent cells and plated on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C and 220 rpm. Single colonies with complete knockout of the metA gene were identified using primers G9 and G12. Correctly sequenced single colonies were selected, cultured with 0.5 mM IPTG to eliminate the pTargetF-metA plasmid, yielding the engineered strain E. coli Bio-67727ΔthrBΔmetA / pCas.

[0196] The bacteria were further inoculated into non-resistant LB liquid medium and cultured at 37°C for 12 hours. The culture was then diluted and spread onto LB plates to obtain the engineered strain E. coli Bio-67727△thrB △metA with pCas plasmid eliminated, which was named GS2.

[0197] metA sgRNA target AACTTCTCGTGCGTCTGGTC (as shown in SEQ ID No. 8)

[0198] G7: GCGTCTGGTCGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 9)

[0199] G8: ACGAGAAGTTGACTAGTATTATACCTAGG (as shown in SEQ ID No. 10)

[0200] G9: CAGCGCATCCATATGCTGCC (as shown in SEQ ID No. 11)

[0201] G10: CGACTATCACAGAAGA AACCTGATTACCTCACTACATA (as shown in SEQ ID No. 12)

[0202] G11: GTGAGGTAATCAGGTTTCTTCTGTGATAGTCGATCGTT (as shown in SEQ ID No. 13)

[0203] G12: GCTTCTCCTGCTCGCCATAC (as shown in SEQ ID No. 14)

[0204] Example 3: Enhancing the expression of the aspartate kinase I-homoserine dehydrogenase I encoding gene thrA

[0205] Using the NEB Site-Directed Mutagenesis Kit (catalog number E0552S), primers G13 and G14 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is GCTATCTTTAAGCGTACCCAG (as shown in SEQ ID No. 15), targeting the efeU gene. The mutated pTargetF was named pTargetF-efeU.

[0206] Using the E. coli Bio-67727 genome as a template, the upstream sequence of the efeU gene was amplified using primers G15 and G16 and Phanta Flash high-fidelity DNA polymerase. The downstream sequence of the efeU gene was amplified using primers G17 and G18. After gel extraction and recovery of the upstream and downstream fragments, P was added to each fragment. em7 -thrA anterior and posterior homologous arms; using the thrA gene nucleotide sequence of the E. coli K12 W3110 genome as a template, P was synthesized by Qingke Company after codon optimization. em7 -thrA template, P em7- The thrA template contains homologous arms for subsequent fusion PCR. After fusion PCR using primers G15 and G18 at both ends, the template was excised and recovered from the gel to obtain the repair template Donor-thrA containing the thrA gene knock-in frame.

[0207] After electroporating the pCas9 plasmid into GS2, the sample was plated on a plate containing 50 mg / L kanamycin resistance and incubated at 30°C to obtain strain GS2 / pCas9. A portion of the GS2 / pCas9 bacterial colony was picked and placed in a 250 mL shake flask containing 50 mL of LB broth containing kanamycin, and incubated at 30°C and 220 rpm. When the OD of the medium reached... 600 When the OD was 0.2, arabinose was added to a final concentration of 10 mM for induction, and OD... 600 Competent cells were prepared at a concentration of 0.4. 2 μL of pTargetF-efeU plasmid and 10 μL of Donor-thrA template DNA were electroporated into GS2 / pCas9 competent cells and plated on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C and 220 rpm. Single colonies with simultaneous knockout of the efeU gene and knock-in of the thrA gene were identified using primers G15 and G18. Correctly sequenced single colonies were selected, cultured with 0.5 mM IPTG to eliminate the pTargetF-efeU plasmid, and the engineered strain E. coli Bio-67727 △thrB △metA △efeU::P em7 -thrA / pCas.

[0208] Further inoculation with antibiotic-free LB liquid medium, incubation at 37°C for 12 h, followed by dilution and plating on LB agar plates yielded the engineered strain *E. coli* Bio-67727△thrB△metA △efeU:: P em7 -thrA, named GS3.

[0209] efeU sgRNA target GCTATCTTTAAGCGTACCCAG (as shown in SEQ ID No. 15)

[0210] G13: CGTACCCAGGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 16)

[0211] G14: CTTAAGATAGCGACTAGTATTATACCTAGG (as shown in SEQ ID No. 17)

[0212] G15: CGCGGATGGACGAAATTGCTTG (as shown in SEQ ID No. 18)

[0213] G16:GCCACCCACCCTTAAACGTTTTTC (as shown in SEQ ID No. 19)

[0214] G17:CAAATACGACGCAAACTCTTGCTTAG (as shown in SEQ ID No. 20)

[0215] G18: CGCCGTCATTTTCTGGCTAAAGC (as shown in SEQ ID No. 21)

[0216] Example 4: Enhancing the aspartate semialdehyde dehydrogenase encoding gene asd bs Express

[0217] Using the NEB Site-Directed Mutagenesis Kit (catalog number E0552S), primers G19 and G20 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is CAGGGTGTGAACACCGTTTT (as shown in SEQ ID No. 22), targeting the ilvG gene. The mutated pTargetF was named pTargetF-ilvG.

[0218] Using the E. coli Bio-67727 genome as a template, the upstream sequence of the ilvG gene was amplified using primers G21 and G22 and Phanta Flash high-fidelity DNA polymerase. The downstream sequence of the ilvG gene was amplified using primers G23 and G24. After gel extraction and recovery of the upstream and downstream fragments, P was added to each fragment. em7 -asd bs Homologous arms at both ends; using the asd gene nucleotide sequence of Bacillus subtilis subtilis 168 genome as a template, P was synthesized by Qingke Company after codon optimization. em7 -asd bs Template, P em7 -asd bs The template contains homologous arms for subsequent fusion PCR. After fusion PCR using primers G21 and G24 at both ends, the template was excised and recovered from the gel to obtain the template containing asd. bs Donor-asd, a repair template for gene knock-in boxes bs .

[0219] After electroporating the pCas9 plasmid into GS3, the sample was plated on a plate containing 50 mg / L kanamycin resistance and incubated at 30°C to obtain strain GS3 / pCas9. A portion of the GS3 / pCas9 bacterial colony was picked and placed in a 250 mL shake flask containing 50 mL of LB broth containing kanamycin, and incubated at 30°C and 220 rpm. When the OD of the medium reached... 600When the OD was 0.2, arabinose was added to a final concentration of 10 mM for induction, and OD... 600 Competent cells were prepared at a concentration of 0.4. 2 μL of pTargetF-ilvG plasmid and 10 μL of Donor-asd were added. bs Template DNA was electroporated into GS3 / pCas9 competent cells and plated on double antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C and 220 rpm. The ilvG gene base knockout was identified using primers G21 and G24, and the asd gene was also identified. bs Single colonies with gene knock-in. Selected colonies with correct sequencing results were cultured with 0.5 mM IPTG to eliminate the pTargetF-ilvG plasmid, yielding the engineered E. coli Bio-67727△thrB△metA△efeU:: P em7 -thrA△ilvG:: P em7 -asd bs / pCas.

[0220] The culture was further inoculated into antibiotic-free LB liquid medium and incubated at 37°C for 12 hours. The resulting culture was then diluted and plated on LB agar plates to obtain the engineered strain *E. coli* Bio-67727 with the pCas9 plasmid eliminated. em7 -thrA△ilvG:: P em7 -asd bs It was named GS4.

[0221] The ilvG sgRNA target is CAGGGTGTGAACACCGTTTT (as shown in SEQ ID No. 22).

[0222] G19: GAACACCGTTTTGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 23)

[0223] G20: ACACCCTGGACTAGTATTATACCTAGG (as shown in SEQ ID No. 24)

[0224] G21: GAGGAAGGGAACAACATTCATACTG (as shown in SEQ ID No. 25)

[0225] G22: AGTTAGTTCCCCGTCCTGAATC (as shown in SEQ ID No. 26)

[0226] G23: TGCAACATCAGGTCAATGTATCGG (as shown in SEQ ID No. 27)

[0227] G24: GCTCAGGCGCGGATTTGTTGTG (as shown in SEQ ID No. 28).

[0228] Example 5: Enhancing the encoding gene lysC of aspartate kinase III pa Express

[0229] Using the NEB Site-Directed Mutagenesis Kit (catalog number E0552S), primers G25 and G26 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is ACGTGAGTTCCTCAACCTTG (as shown in SEQ ID No. 29), targeting the yghX gene. The mutated pTargetF was named pTargetF-yghX.

[0230] Using the E. coli Bio-67727 genome as a template, the upstream sequence of the yghX gene was amplified using primers G27 and G28 and Phanta Flash high-fidelity DNA polymerase. The downstream sequence of the yghX gene was amplified using primers G29 and G30. After gel extraction and recovery of the upstream and downstream fragments, P was added to each fragment. em7 -lysC pa Homologous arms at both ends; using the nucleotide sequence of the PAO1 lysC gene from *Pseudomonas aeruginosa* as a template, P was synthesized by Qingke Company after codon optimization. em7 -lysC pa Template, P em7 -lysC pa The template contains homologous arms for subsequent fusion PCR. Fusion PCR was performed using primers G27 and G30 at both ends, followed by gel extraction and recovery to obtain samples containing lysC. pa Donor-lysC, a repair template for gene knock-in boxes pa .

[0231] After electroporating the pCas9 plasmid into GS4, the sample was plated on a plate containing 50 mg / L kanamycin resistance and incubated at 30°C to obtain strain GS4 / pCas9. A portion of the GS4 / pCas9 bacterial colony was picked and placed in a 250 mL shake flask containing 50 mL of LB broth containing kanamycin, and incubated at 30°C and 220 rpm. When the OD of the medium reached... 600 When the concentration was 0.2, arabinose was added to a final concentration of 10 mM for induction, and OD... 600 Competent cells were prepared at a concentration of 0.4. 2 μL of pTargetF-yghX plasmid and 10 μL of Donor-lysC were added. paTemplate DNA was electroporated into GS4 / pCas9 competent cells and plated on double antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C and 220 rpm. The yghX gene base knockout and lysC gene knockout were identified using primers G27 and G30. pa Single colonies with correctly sequenced gene base knock-in were selected, cultured with 0.5 mM IPTG to eliminate the pTargetF-yghX plasmid, and the engineered E. coli Bio-67727△thrB△metA△efeU:: P em7 -thrA△ilvG:: P em7 -asd bs △yghX:: P em7 -lysC pa / pCas.

[0232] The culture was further inoculated into antibiotic-free LB liquid medium and incubated at 37°C for 12 hours. The resulting culture was then diluted and plated on LB agar plates to obtain the engineered strain *E. coli* Bio-67727 with the pCas9 plasmid eliminated. em7 -thrA△ilvG:: P em7 -asd bs △yghX:: P em7 -lysC pa It was named GS5.

[0233] yghX sgRNA target ACGTGAGTTCCTCAACCTTG (as shown in SEQ ID No. 29)

[0234] G25: CTCAACCTTGGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 30)

[0235] G26: GAACTCACGTGACTAGTATTATACCTAGG (as shown in SEQ ID No. 31)

[0236] G27: GCCCAAATCAAACGCTTTACGCA (as shown in SEQ ID No. 32)

[0237] G28: CGTTGCACTCCTCAGTTGGT (as shown in SEQ ID No. 33)

[0238] G29: TAGGTTTATCTCTTACGGGATTACG (as shown in SEQ ID No. 34)

[0239] G30: CTCACGAAAGAAATCCATTACCATC (as shown in SEQ ID No. 35)

[0240] Example 6: Enhancing the expression of rhtA, a gene encoding a homoserine extracellular transporter.

[0241] Using the NEB Site-Directed Mutagenesis Kit (catalog number E0552S), primers G31 and G32 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is GCGCATTTTAGTCAAAACGG (as shown in SEQ ID No. 36), targeting a nearby sequence outside the rhtA gene. The mutated pTargetF was named pTargetF-rhtA.

[0242] Using the E. coli K12 Bio-67727 genome as a template, the upstream sequence of the target site was amplified using primers G33 and G34 and PhantaFlash ultra-fidelity DNA polymerase. The downstream sequence of the target site was amplified using primers G35 and G36. After gel extraction and recovery, P was added to each sequence. tac The promoter sequence homologous arm was used for fusion PCR with primers G33 and G36 at both ends, followed by gel extraction to obtain P-containing homologous arms. tac Donor-P, the repair template for the starter key input box tac .

[0243] After electroporating the pCas9 plasmid into GS5, the sample was plated on a plate containing 50 mg / L kanamycin resistance and incubated at 30°C to obtain strain GS5 / pCas9. A portion of the GS5 / pCas9 bacterial colony was picked and placed in a 250 mL shake flask containing 50 mL of LB broth containing kanamycin, and incubated at 30°C and 220 rpm. When the OD of the medium reached... 600 When the concentration was 0.2, arabinose was added to a final concentration of 10 mM for induction, and OD... 600 Competent cells were prepared at a concentration of 0.4. 2 μL of pTargetF-rhtA plasmid and 10 μL of Donor-P were added. tac Template DNA was electroporated into GS3 / pCas9 competent cells, plated on plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubated at 30°C and 220 rpm. P was identified using primers G33 and G36. tac Single colonies with promoter base knock-in were selected. Colonies with correct sequencing were cultured with 0.5 mM IPTG to eliminate the pTargetF-rhtA plasmid, yielding the engineered E. coli Bio-67727△thrB△metA△efeU:: P em7-thrA△ilvG:: P em7 -asd bs △yghX:: P em7 -lysC pa P tac -rhtA / pCas.

[0244] The culture was further inoculated into antibiotic-free LB liquid medium and incubated at 37°C for 12 hours. The resulting culture was then diluted and plated on LB agar plates to obtain the engineered strain *E. coli* Bio-67727 with the pCas9 plasmid eliminated. em7 -thrA△ilvG:: P em7 -asd bs △yghX:: P em7 -lysC pa P tac -rhtA, named GS6.

[0245] sgRNA target GCGCATTTTAGTCAAAACGG (as shown in SEQ ID No. 36)

[0246] G31: GTCAAAACGGGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 37)

[0247] G32: TAAAATGCGCGACTAGTATTATACCTAGG (as shown in SEQ ID No. 38)

[0248] G33: CAGGTTGAAACCGCCCATTTTGTTC (as shown in SEQ ID No. 39)

[0249] G34: GTTGAAAAAATTTCCCCCAGGATTGATGGAATCATTAGTCTGG (as shown in SEQ ID No. 40)

[0250] G35: GGGAAAATTTTTTCAACAAATGCTCAACCAGCATTGGGTATATCC (as shown in SEQ ID No. 41)

[0251] G36: CCCAGCGGTACTGTCTGAATAG (as shown in SEQ ID No. 42)

[0252] Example 7: Enhancing the expression of the glucokinase encoding gene glk

[0253] Using the NEB Site-Directed Mutagenesis Kit (catalog number E0552S), primers G37 and G38 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is AGCGTGAAAGCATTATCGCC (as shown in SEQ ID No. 43), targeting the lafU gene. The mutated pTargetF was named pTargetF-lafU.

[0254] Using the E. coli K12 W3110 genome as a template, the upstream sequence of the lafU gene was amplified using primers G39 and G40 and Phanta Flash high-fidelity DNA polymerase. The downstream sequence of the lafU gene was amplified using primers G41 and G42. After gel extraction and recovery of the upstream and downstream fragments, P was added to the gel. tac -glk anterior and posterior homologous arms; using the E. coli K12 W3110 glk gene nucleotide sequence as a template, P was synthesized by Qingke Company after codon optimization. tac -glk template, P tac The -glk template contains homologous arms for subsequent fusion PCR. Fusion PCR was performed using primers G39 and G42 at both ends, followed by gel extraction to obtain the repair template Donor-glk containing the glk gene knock-in frame.

[0255] After electroporating the pCas9 plasmid into GS6, the sample was plated on a plate containing 50 mg / L kanamycin resistance and incubated at 30°C to obtain strain GS6 / pCas9. A portion of the GS6 / pCas9 bacterial colony was picked and placed in a 250 mL shake flask containing 50 mL of LB broth containing kanamycin, and incubated at 30°C and 220 rpm. When the OD of the medium reached... 600 When the concentration was 0.2, arabinose was added to a final concentration of 10 mM for induction, and OD... 600 Competent cells were prepared at a concentration of 0.4. 2 μL of pTargetF-lafU plasmid and 10 μL of Donor-glk template DNA were electroporated into GS6 / pCas9 competent cells and plated on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C and 220 rpm. Single colonies with both lafU gene knockout and glk gene knock-in were identified using primers G41 and G44. Correctly sequenced single colonies were selected, cultured with 0.5 mM IPTG to eliminate the pTargetF-lafU plasmid, and the engineered strain *E. coli* Bio-67727△thrB△metA△efeU:: P em7 -thrA△ilvG:: P em7 -asd bs △yghX:: Pem7 -lysC pa P tac -rhtA △lafU::P tac -glk / pCas.

[0256] The culture was further inoculated into antibiotic-free LB liquid medium and incubated at 37°C for 12 hours. The resulting culture was then diluted and plated on LB agar plates to obtain the engineered strain *E. coli* Bio-67727 with the pCas9 plasmid eliminated. em7 -thrA△ilvG:: P em7 -asd bs △yghX:: P em7 -lysC pa P tac -rhtA△lafU::P tac -glk, named GS7.

[0257] lafU sgRNA target AGCGTGAAAGCATTATCGCC (as shown in SEQ ID No. 43)

[0258] G37: CATTATGCCGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 44)

[0259] G38: CTTTCACGCTGACTAGTATTATACCTAGG (as shown in SEQ ID No. 45)

[0260] G39: CGATGGTCATCAGCACATACTG (as shown in SEQ ID No. 46)

[0261] G40: CAAAGGGGCCGAGCGTATTTC (as shown in SEQ ID No. 47)

[0262] G41: GCTGAATCTTTACGCATTTCTCAAAC (as shown in SEQ ID No. 48)

[0263] G42: GGTTCAATGCGCGAGGTGTAGC (as shown in SEQ ID No. 49)

[0264] Example 8: Shake-flask fermentation experiment

[0265] (1) Seed culture

[0266] L-homoserine genetically engineered bacteria GS1, GS2, GS3, GS4, GS5, GS6 and GS7 were inoculated onto LB solid medium slant, with E. coli Bio-67727 as a control. They were cultured overnight at 35°C. Then, a single colony was picked and inoculated into 5 ml of LB medium and cultured overnight at 35°C with a rotation speed of 200 rpm to obtain the seed culture.

[0267] (2) Fermentation culture

[0268] Add 20 ml of fermentation medium to a 250 ml shake flask, and inoculate the seed culture into the fermentation medium at a 1% inoculum. Incubate in a shaker at 35°C for 48 hours at 200 rpm. Take a certain amount of fermentation broth from the shake flask, lyse the cells, centrifuge, and collect the supernatant. Dilute the supernatant with ultrapure water in a gradient to a L-homoserine concentration of 0.1-1 g / L. After filtration, detect the L-homoserine content in the fermentation broth using high-performance liquid chromatography (HPLC). Finally, compare the L-homoserine content obtained from different genotype strains. The results of the shake-flask fermentation experiment of the metabolically modified strain are shown in the table below:

[0269] Table 2

[0270]

[0271] Example 9: Fermentation Experiment in a 50L High-Density Tank

[0272] (1) Seed culture

[0273] The three genetically engineered bacteria with the highest L-homoserine production in the shake-flask experiment, namely GS5, GS6 and GS7, were inoculated onto LB solid medium slant, with E. coli Bio-67727 as a control. They were cultured overnight at 35°C. Then, several single colonies were picked and inoculated into 100 ml of LB medium and cultured overnight at 35°C with a rotation speed of 200 rpm to obtain the primary seed culture. The primary seed culture was then inoculated into 1000 ml of TB medium and cultured at 37°C with a rotation speed of 200 rpm for 5 h to obtain the secondary seed culture.

[0274] (2) Fermentation culture

[0275] Add 20L of fermentation medium to a 50L fermenter, and then add 1000ml of secondary seed culture to the fermenter. The fermentation cycle is 48-96 hours. During fermentation, control the culture temperature at 35℃, maintain the pH at 7.0±0.1 by adding ammonia, introduce 1.5±0.5 vvm of air to provide dissolved oxygen, and maintain dissolved oxygen at 35% ± 5% by activating the agitation coupled with dissolved oxygen mode. Control the agitation speed at 300–600 rpm. Add the culture medium in batches to maintain residual sugar at 3 ± 1 g / L.

[0276] (3) Detection of L-homoserine in fermentation broth

[0277] During fermentation, a certain amount of fermentation broth was taken every 5 hours. After cell lysis, the supernatant was collected by centrifugation and serially diluted with ultrapure water to achieve an L-homoserine concentration of 0.1 g / L-1 g / L. After filtration, the L-homoserine content in the fermentation broth was detected by high-performance liquid chromatography (HPLC). Finally, the amount of L-homoserine obtained from different genotype strains was compared. The results of the high-density fermentation experiment of the metabolically modified strains are shown in the table below:

[0278] Table 3

[0279]

[0280] As shown in Table 3, the metabolically modified GS7 strain, due to its ability to produce and accumulate L-homoserine extracellularly without carrying exogenous plasmids, can better utilize carbon sources such as glucose for L-homoserine production compared to the wild-type strain. The modified strain with the best performance achieved an L-homoserine production level of 156.2 g / L after 80 hours of fermentation, with a sugar-acid conversion rate of 0.60 g / g and a space-time yield of 1.95 g / L / h.

[0281] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of any one of the following in constructing L-homoserine-producing strains and / or fermenting for the production of L-homoserine, characterized in that, include: (I) Knock out or weaken the expression of thrB and / or metA genes in the homoserine degradation pathway; and / or (II) Enhance the expression of any one or more of the following: (II-1), thrA, asd bs lysC pa The expression; (II-2) Expression of glk; (II-3) Expression of rhtA.

2. The application as described in claim 1, characterized in that, Escherichia coli Bio-67727 was used as the chassis strain.

3. The application as described in claim 1 or 2, characterized in that, The removal methods include non-marking removal; The thrA, asd bs lysC pa , glk and / or rhtA are expressed by strong promoters; As a preferred option, a strong promoter P is used. em7 For thrA, asd bs and / or lysC pa It has been expressed; As a preferred option, a strong promoter P is used. tac Overexpression of glk and / or rhtA; Preferably, the strong promoter P tac have: (i) A nucleotide sequence as shown in SEQ ID No. 50; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); Preferably, the strong promoter P em7 have: (i) A nucleotide sequence as shown in SEQ ID No. 51; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

4. The application as described in any one of claims 1 to 3, characterized in that, The thrA is integrated into the efeU gene site, and the asd bs Integrated into the ilvG gene site, the lysC pa It is integrated into the yghX gene locus, and the glk is integrated into the lafU gene locus.

5. The application as described in any one of claims 1 to 4, characterized in that, The thrB has: (i) A nucleotide sequence as shown in SEQ ID No. 52; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The metA has: (i) A nucleotide sequence as shown in SEQ ID No. 53; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The thrA has: (i) A nucleotide sequence as shown in SEQ ID No. 54; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The asd bs have: (i) A nucleotide sequence as shown in SEQ ID No. 55; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The lysC pa have: (i) A nucleotide sequence as shown in SEQ ID No. 56; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The rhtA has: (i) A nucleotide sequence as shown in SEQ ID No. 57; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The glk has: (i) A nucleotide sequence as shown in SEQ ID No. 58; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

6. A genetically engineered bacterium that produces high levels of L-homoserine, characterized in that, include: (I) Knock out or weaken the expression of thrB and / or metA genes in the homoserine degradation pathway; and / or (II) Enhance the expression of any one or more of the following: (II-1), thrA, asd bs lysC pa The expression; (II-2) Expression of glk; (II-3) Expression of rhtA.

7. The genetically engineered bacterium as described in claim 6, characterized in that, Escherichia coli Bio-67727 was used as the chassis strain.

8. The genetically engineered bacteria as described in claim 6 or 7, characterized in that, The removal methods include non-marking removal; The thrA, asd bs lysC pa , glk and / or rhtA are expressed by strong promoters; As a preferred option, a strong promoter P is used. em7 For thrA, asd bs and / or lysC pa It has been expressed; As a preferred option, a strong promoter P is used. tac Overexpression of glk and / or rhtA; Preferably, the strong promoter P tac have: (i) A nucleotide sequence as shown in SEQ ID No. 50; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); Preferably, the strong promoter P em7 have: (i) A nucleotide sequence as shown in SEQ ID No. 51; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

9. The genetically engineered bacteria according to any one of claims 6 to 8, characterized in that, The thrA is integrated into the efeU gene site, and the asd bs Integrated into the ilvG gene site, the lysC pa It is integrated into the yghX gene locus, and the glk is integrated into the lafU gene locus.

10. The genetically engineered bacteria according to any one of claims 6 to 9, characterized in that, The thrB has: (i) A nucleotide sequence as shown in SEQ ID No. 52; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The metA has: (i) A nucleotide sequence as shown in SEQ ID No. 53; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The thrA has: (i) A nucleotide sequence as shown in SEQ ID No. 54; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The asd bs have: (i) A nucleotide sequence as shown in SEQ ID No. 55; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The lysC pa have: (i) A nucleotide sequence as shown in SEQ ID No. 56; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The rhtA has: (i) A nucleotide sequence as shown in SEQ ID No. 57; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The glk has: (i) A nucleotide sequence as shown in SEQ ID No. 58; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

11. The method for constructing the genetically engineered bacteria as described in any one of claims 6 to 10.

12. The construction method as described in claim 11, characterized in that, Includes any one or more of the following steps: Step (A): Use CRISPR / Cas technology to knock out the thrB gene, which encodes homoserine kinase, in E. coli without scarring; Step (B): The homoserine O-succinyltransferase encoding gene metA was knocked out without scarring using CRISPR / Cas technology; Step (C): The gene encoding aspartate kinase I-homoserine dehydrogenase I, thrA, is transferred from the strong promoter P... em7 Control, will force the starter P em7 The controlled gene thrA integrates into the efeU gene locus; Step (D): The aspartate semialdehyde dehydrogenase encoding gene asd bs By strong promoter P em7 Control, will force the starter P em7 Controlled genes asd bs Integration into the ilvG gene locus; asd bs The gene is derived from Bacillus subtilis subsp. 168; Step (E): The aspartate kinase III encoding gene lysC pa By strong promoter P em7 Control, will force the starter P em7 Controlled gene lysC pa Integration into the yghX gene locus; lysC pa Derived from Pseudomonas aeruginosa PAO1; Step (F): The homoserine efflux transporter gene rhtA is transferred from the strong promoter P... tac Control, utilizing the strong promoter P tac Replace the in situ promoter of the rhtA gene; Step (G): The glucokinase encoding gene glk is transferred from the strong promoter P tac Control, will force the starter P tac The controlled gene glk integrates into the lafU gene locus; There is no specific order between the steps; they can be performed individually or combined in any way.

13. The genetically engineered bacteria for fermentation production of L-homoserine, constructed by the construction method as described in claim 11 or 12.

14. The use of the genetically engineered bacteria as described in any one of claims 6 to 10 or the genetically engineered bacteria as described in claim 13 in the fermentation production of L-homoserine.

15. A method for producing L-homoserine by fermentation, characterized in that, Select the genetically engineered bacteria as described in any one of claims 6 to 10 or as described in claim 13, ferment them, collect the fermentation broth, purify it, and obtain L-homoserine.

Images