GLP1-ET circular RNA, synthetic method thereof and application of GLP1-ET circular RNA in preparation of long-acting blood glucose reducing nucleic acid medicine

Abstract

The invention relates to the technical field of molecular biology. The invention provides a plasmid for synthesizing a GLP1-ET (Glucagon-like Peptide 1-ET) annular RNA (Ribonucleic Acid) and a construction method of the plasmid. The constructed pcDNA3-EVB-IRES-circGLP1-ET plasmid contains a GLP1-ET gene sequence for coding a GLP-1 similar polypeptide. The invention also provides a method for in-vitro synthesis of GLP1-ET circular RNA by using the plasmid, and the in-vitro synthesized GLP1-ET circular RNA can be used for preparing nucleic acid drugs with a long-acting hypoglycemic effect, which brings a certain prospect enlightenment for clinical research and development of nucleic acid drugs for diabetes.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a GLP1-ET circular RNA, a synthesis method thereof, and an application thereof in the preparation of a long-acting glucose-lowering nucleic acid drug. Background Art

[0002] Diabetes is a chronic, complex disease characterized by impaired glucose metabolism, caused by absolute or relative insulin deficiency or decreased insulin sensitivity in target cells. Type 2 diabetes is the result of a combination of peripheral insulin resistance and β-cell dysfunction. Diabetes is highly prevalent worldwide. Diabetes medications, ranging from insulin, metformin, α-glucosidase inhibitors, to DPP-4 inhibitors, all have a glucose-lowering effect for no more than 24 hours. Glucagon-like peptide-1 (GLP-1) peptides are the only incretin hormones proven to be effective in the treatment of diabetes alone, with a duration of action of 5-7 days. The discovery and application of these drugs has transformed the treatment landscape for obesity and diabetes, providing new treatment options for countless diabetic patients.

[0003] At present, long-acting GLP-1R agonist hypoglycemic drugs are mainly concentrated in polypeptide drugs, including: exenatide (2005), liraglutide (2010), and semaglutide (2021). The weight loss indications of semaglutide and tilpotide were approved by the FDA in 2021 and 2023, respectively. At present, there are 8 GLP-1R single-target new drugs approved for marketing, mainly for the treatment of type 2 diabetes. Among them, they are developed for the treatment of obesity due to their lower adverse reactions and higher weight loss effects. At present, long-acting GLP-1 receptor agonists such as semaglutide and albigglutide can achieve a dosing frequency of once a week. Continuously improving the half-life has become a technical difficulty that needs to be overcome in the research and development of GLP-1R agonist drugs and an internal driving force for promoting product updates and iterations.

[0004] A key metabolic pathway for peptide protein drugs in the body is clearance by immune cells such as macrophages. Peptide drugs are internalized by macrophages through phospholipid bilayer-mediated endocytosis and transported to lysosomes for degradation. Some transmembrane peptides, such as Tat peptide, have the ability to escape lysosomes, thereby prolonging the drug metabolism cycle. Currently, there are no reports of using transmembrane peptides to assist in the pharmacokinetics optimization of GLP-1.

[0005] Translatable circular RNAs (circRNAs) are emerging as an important nucleic acid drug delivery vehicle, promising to replace linear messenger RNA (mRNA) and reshape the RNA pharmaceutical industry. Circular RNAs used for protein expression are typically driven by a ribosome reentry site (IRES) sequence to drive target gene expression. Currently, IRESs capable of efficiently translating circular RNA into proteins in vivo include coxsackievirus B3 (CVB3), human rhinovirus (HRV), and human enterovirus B (EVB).

[0006] At present, the method for efficient in vitro synthesis of circular RNA generally uses the permutated intron-exon (PIE) system of the T4 phage thymidylate synthase (Td) gene to perform self-splicing of linear RNA transcripts. Taking the PIE of the Td gene as an example, this type I PIE structure can be used to transcribe mRNA synthesized in vitro from the T7 / T3 promoter in the presence of GTP and Mg. 2+ Under the action of the intron homology arms on both sides, RNA splicing and circularization are mediated by the intron homology arms. The circularized RNA contains the IRES and the target protein-coding RNA. In addition, this splicing often leaves behind a portion of the exon splicing sequence E1 / E2 (E1, TTGGGT; E2, CTACCGTTTAATATTGCGTCACC). This residual E2 / E1 sequence can still induce a certain immune response in the body, which has an adverse impact on related clinical trials.

[0007] Currently, there are no nucleic acid drugs for diabetes, especially those encoding GLP-1 analogous peptides. Therefore, designing nucleic acid drugs that can express GLP-1 analogous peptides has certain research and development prospects. Summary of the Invention

[0008] The object of the present invention is to provide a GLP1-ET circular RNA and a synthesis method thereof. The GLP1-ET circular RNA can be used to prepare a nucleic acid drug with a long-lasting hypoglycemic effect and performs well in lowering blood sugar and body weight.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0010] The present invention provides a gene sequence encoding a GLP-1 analogous polypeptide GLP1-ET, and the gene sequence of GLP1-ET is shown in SEQ ID NO.5.

[0011] The present invention also provides a plasmid for synthesizing circular RNA for use in conjunction with the GLP1-ET gene sequence, the plasmid comprising an empty vector and a structural unit, the empty vector being a pcDNA3.1 plasmid, the structural unit comprising a Td 3' homology arm sequence, an EVB-IRES 3' sequence, a target gene sequence containing an ET fragment, a 6xPolyAC sequence, an EVB-IRES 5' sequence, and a Td 5' homology arm sequence.

[0012] Preferably, the Td 3' homology arm sequence is shown as SEQ ID NO.1, the EVB-IRES 3' sequence is shown as SEQ ID NO.2, the EVB-IRES 5' sequence is shown as SEQ ID NO.3, the 6xPolyAC sequence is shown as SEQ ID NO.6, the Td 5' homology arm sequence is shown as SEQ ID NO.7, and the ET fragment sequence is shown as SEQ ID NO.25.

[0013] The present invention also provides a plasmid for synthesizing circular RNA containing the GLP1-ET gene sequence, the plasmid being a pcDNA3-EVB-IRES-circGLP1-ET plasmid, which comprises an empty vector and a structural unit, the empty vector being a pcDNA3.1 plasmid, and the structural unit comprising a Td 3' homology arm sequence, an EVB-IRES 3' sequence, the GLP1-ET gene sequence, a 6xPolyAC sequence, an EVB-IRES 5' sequence, and a Td 5' homology arm sequence.

[0014] The present invention also provides a method for constructing a plasmid for synthesizing circular RNA containing the GLP1-ET gene sequence, comprising the following steps: performing a PCR amplification reaction using the Td 3' homology arm sequence, the EVB-IRES 3' sequence, the GLP1-ET gene sequence, the 6xPolyAC sequence, the EVB-IRES 5' sequence and the Td 5' homology arm sequence as templates to obtain a PCR amplification product, then performing a recombination reaction with the linearized vector obtained after enzyme digestion, and obtaining the GLP1-ET circular RNA after transformation and verification.

[0015] Preferably, the primer pair for the Td 3' homology arm sequence includes Td-3-F and Td-3-R, the sequence of the Td-3-F is shown in SEQ ID NO.8, and the sequence of the Td-3-R is shown in SEQ ID NO.9; the primer pair for the EVB-IRES 3' sequence includes EVB-3-F and EVB-3-R, the sequence of the EVB-3-F is shown in SEQ ID NO.10, and the sequence of the EVB-3-R is shown in SEQ ID NO.11; the primer pair for the GLP1-ET gene sequence includes GLP1-F and GLP1-ET-R, the sequence of the GLP1-F is shown in SEQ ID NO.14, and the sequence of the GLP1-ET-R is shown in SEQ ID NO.20; the primer pair for the 6xPolyAC sequence includes ET-6xPolyAC-F and 6xPolyAC-R, and the sequence of the ET-6xPolyAC-F is shown in SEQ ID NO.21, the sequence of the 6xPolyAC-R is shown in SEQ ID NO.13; the primer pair for the EVB-IRES 5' sequence includes EVB-5-F and EVB-5-R, the sequence of the EVB-5-F is shown in SEQ ID NO.16, and the sequence of the EVB-5-R is shown in SEQ ID NO.17; the primer pair for the Td 5' homology arm sequence includes Td-5-F and Td-5-R, the sequence of the Td-5-F is shown in SEQ ID NO.18, and the sequence of the Td-5-R is shown in SEQ ID NO.19.

[0016] The present invention also provides a method for synthesizing GLP1-ET circular RNA in vitro using the above plasmid, comprising the following steps:

[0017] (1) The pcDNA3-EVB-IRES-circGLP1-ET plasmid was digested to obtain a linearized vector;

[0018] (2) performing an in vitro transcription reaction on the linearized vector described in step (1), followed by digestion to obtain transcribed RNA;

[0019] (3) The transcribed RNA of step (2) is circularized by intron-mediated in vitro self-splicing, and purified to obtain the GLP1-ET circular RNA.

[0020] Preferably, the reaction system of in vitro transcription in step (2) comprises the following components: 10×Reaction Buffer A 2 μL, N 6 -methyladenosine(m 6A) Solution 1 μL, ATP solution 1.9 μL, GTP solution 2 μL, CTP solution 2 μL, UTP solution 2 μL, linearized vector 500 ng-1 μg, Enzyme Mix 2 μL, add RNase-free ddH2O to 20 μL;

[0021] Preferably, in step (2), DNase I is added for digestion reaction, and the amount of DNase I added is 1-3 μL; the temperature of the digestion reaction is 36-38° C., and the time of the digestion reaction is 25-35 min.

[0022] The present invention also provides GLP1-ET circular RNA obtained by using the above-mentioned method for synthesizing GLP1-ET circular RNA in vitro.

[0023] The present invention also provides a nanolipid particle circGLP1-ET-LNP containing the GLP1-ET circular RNA, and the preparation method comprises the following steps: mixing the GLP1-ET circular RNA with a citric acid buffer to obtain a circRNA-citric acid buffer, and then mixing the nanoliposome-ethanol solution and the circRNA-citric acid buffer in a volume ratio of (2-4):1 to obtain the product.

[0024] The present invention also provides the use of the GLP1-ET circular RNA or the nanolipid particle circGLP1-ET-LNP in the preparation of a long-acting hypoglycemic nucleic acid drug.

[0025] By adopting the above technical solution, the present invention has the following beneficial effects:

[0026] 1. The GLP1-ET circular RNA prepared by the technical solution of the present invention is packaged and delivered via nanoliposomes (LNPs), and can drive the expression of the GLP1-ET polypeptide in vivo via the EVB-IRES. This demonstrates that the GLP1-ET circular RNA synthesized in vitro can be used to prepare a nucleic acid drug with a long-lasting hypoglycemic effect. It also demonstrates that the technical solution of the present invention can be used to develop and design nucleic acid drugs that encode GLP-1-like polypeptides.

[0027] 2. The GLP1-ET circular RNA synthesized in vitro using the technical solution of the present invention was delivered to DIO (Diet Induced Obesity) model mice via nanoliposomes. The experimental results showed that the blood glucose of the mice remained lower than the initial blood glucose for 96 hours, and their body weight also showed a significant downward trend within a week, demonstrating a good long-term hypoglycemic effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1This is the non-denaturing agarose gel electrophoresis analysis of circGLP1 and circGLP1-ET circular RNA;

[0029] Figure 2 This is a dual-luciferase reporter gene assay for circGLP1 and circGLP1-ET circRNA;

[0030] Figure 3 The particle size and Zeta potential results of nanolipid particles circGLP1-ET-LNP and circGLP1-LNP ( Figure 3 A represents the particle size result, and B represents the Zeta potential result);

[0031] Figure 4 The changes of blood glucose and body weight of DIO model mice in each treatment group ( Figure 4 A represents blood sugar status, and B represents weight status);

[0032] Figure 5 This is the pcDNA-EVB3-IRES-circGLP1 plasmid map;

[0033] Figure 6 This is the pcDNA-EVB3-IRES-circGLP1-ET plasmid map. DETAILED DESCRIPTION

[0034] The present invention provides a gene sequence encoding a GLP-1 analogous polypeptide GLP1-ET, wherein the gene sequence of GLP1-ET is shown in SEQ ID NO.5, and the specific sequence is

[0035] In the DNA sequence of GLP1-ET described in the present invention, the sequence segment from positions 7 to 78 is the insulin signal peptide expression sequence, the sequence segment from positions 97 to 285 is the GLP1 polypeptide expression sequence, and the sequence segment from positions 286 to 393 is the ET polypeptide expression sequence (as shown in SEQ ID NO.25).

[0036] The present invention also provides a plasmid for synthesizing circular RNA for use in conjunction with the GLP1-ET gene sequence, the plasmid comprising an empty vector and a structural unit, the empty vector being a pcDNA3.1 plasmid, the structural unit comprising a Td 3' homology arm sequence, an EVB-IRES 3' sequence, a target gene sequence containing an ET fragment, a 6xPolyAC sequence, an EVB-IRES 5' sequence, and a Td 5' homology arm sequence.

[0037] In the present invention, the Td 3' homology arm sequence is shown in SEQ ID NO. 1, and the specific sequence is GGGAGACCCTCGAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATT CCGGGGTAAGATTAACGACCTTATCTGAACATAATG.

[0038] In the present invention, the EVB-IRES 3' sequence is shown in SEQ ID NO. 2, and the specific sequence is: The sequence segment from position 674 to position 679 in the EVB-IRES 3' sequence of the present invention is an E1-like sequence.

[0039] In the present invention, the EVB-IRES 5' sequence is shown in SEQ ID NO. 3, and the specific sequence is ctAcACCATTAAATTACAAGGTCTTAGAAACTCTCAACTTTATTTTGACACTCAATACAGCAAA. The first to fourth sequence segments of the EVB-IRES 5' sequence in the present invention are E2-similar sequences.

[0040] In the present invention, the 6xPolyAC sequence is shown as SEQ ID NO. 6, and the specific sequence is ggacatggagTGAAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAAAACAAACAAAACAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAAAACAAAACAAAACAAAACAAAACAAAACAAAAC.

[0041] In the present invention, the Td 5' homology arm sequence is shown in SEQ ID NO. 7, and the specific sequence is TAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGT GCTAAATTGTAGGACTAATTCCATTTATCAGATTTCTAG.

[0042] In the present invention, the ET fragment sequence is shown in SEQ ID NO. 25, and the specific sequence is GGtGGaGGcGGaTCTGGaGGaGGTGGTTCTCTGCTGCATCATCTGCTGCATCATCTGCTGCATCATAAAACCCATCGCCCGCCGATGTGGAGCCCGGTGTGGCCGtga.

[0043] The present invention also provides a plasmid for synthesizing circular RNA containing the GLP1-ET gene sequence, wherein the plasmid is a pcDNA3-EVB-IRES-circGLP1-ET plasmid, comprising an empty vector and a structural unit, wherein the empty vector is a pcDNA3.1 plasmid, and the structural unit comprises a Td3' homology arm sequence, an EVB-IRES 3' sequence, the GLP1-ET gene sequence, a 6xPolyAC sequence, an EVB-IRES 5' sequence, and a Td 5' homology arm sequence.

[0044] The present invention also provides a method for constructing the plasmid for synthesizing GLP1-ET circular RNA, comprising the following steps: performing a PCR amplification reaction using the Td3' homology arm sequence, EVB-IRES 3' sequence, GLP1-ET gene sequence, 6xPolyAC sequence, EVB-IRES5' sequence and Td 5' homology arm sequence as templates to obtain a PCR amplification product, then performing a recombination reaction with the linearized vector obtained after enzyme digestion, and obtaining the product after transformation and verification.

[0045] In the present invention, the primer pair of the Td 3' homology arm sequence includes Td-3-F and Td-3-R, the sequence of the Td-3-F is shown in SEQ ID NO.8, and the specific sequence is GCTAGCGTTTAAACTTAAGCTTGGGAGACCCTCGAATGGAATTG; the sequence of the Td-3-R is shown in SEQ ID NO.9, and the specific sequence is AAGACCTTGTAATTTAATGGTgTagCATTATGTTCAGATAAGG.

[0046] In the present invention, the primer pair for the EVB-IRES 3' sequence includes EVB-3-F and EVB-3-R, the sequence of EVB-3-F is shown in SEQ ID NO.10, and the specific sequence is CCTTATCTGAACATAATGctAcACCATTAAATTACAAGGTCTT; the sequence of EVB-3-R is shown in SEQ ID NO.11, and the specific sequence is cgcatccacagggccatggtggcggatccTTTGCTGTATTGAGT.

[0047] In the present invention, the primer pair for the GLP1-ET gene sequence includes GLP1-F and GLP1-ET-R, the sequence of GLP1-F is shown in SEQ ID NO.14; the sequence of GLP1-ET-R is shown in SEQ ID NO.20, and the specific sequence is TCActccatgtcctcaCGGCCACACCGGGCTCC.

[0048] In the present invention, the primer pair for the 6xPolyAC sequence includes ET-6xPolyAC-F and 6xPolyAC-R. The sequence of the ET-6xPolyAC-F is shown in SEQ ID NO.21, and the specific sequence is TGAatgaggacatggagTGAAAAAAACAAAA; the sequence of the 6xPolyAC-R is shown in SEQ ID NO.13.

[0049] In the present invention, the primer pair for the EVB-IRES 5' sequence includes EVB-5-F and EVB-5-R. The sequence of EVB-5-F is shown in SEQ ID NO. 16, and the specific sequence is CAAAAAACAAAAAACAAAACTTAAAACAGCCTGTGGGTTG; the sequence of EVB-5-R is shown in SEQ ID NO. 17, and the specific sequence is TCACCTTATACTCAGGCCTCAATTAAcCCAACAAACAAGTAAACA.

[0050] In the present invention, the primer pair of the Td 5' homology arm sequence includes Td-5-F and Td-5-R, the sequence of the Td-5-F is shown in SEQ ID NO.18, and the specific sequence is TGTTTACTTGTTTGTTGGgTTAATTGAGGCCTGAGTATAAGGTGA; the sequence of the Td-5-R is shown in SEQ ID NO.19, and the specific sequence is GGGCCCTCTAGACTCGAGCTAGAAATCTGATAAATGGAATTAGTC.

[0051] The present invention also provides a method for synthesizing GLP1-ET circular RNA in vitro using the above plasmid, comprising the following steps:

[0052] (1) The pcDNA3-EVB-IRES-circGLP1-ET plasmid was digested to obtain a linearized vector;

[0053] (2) performing an in vitro transcription reaction on the linearized vector described in step (1), followed by digestion to obtain transcribed RNA;

[0054] (3) The transcribed RNA of step (2) is circularized by intron-mediated in vitro self-splicing, and purified to obtain the GLP1-ET circular RNA.

[0055] In the present invention, the reaction system of in vitro transcription in step (2) includes the following components: 10×Reaction Buffer A2 μL, N 6 -methyladenosine(m 6 A) Solution 1 μL, ATP solution 1.9 μL, GTP solution 2 μL, CTP solution 2 μL, UTP solution 2 μL, linearized vector 500 ng-1 μg, Enzyme Mix 2 μL, add RNase-free ddH2O to 20 μL.

[0056] In the present invention, step (2) adds DNase I for digestion reaction, and the amount of DNase I added is preferably 1-3 μL, more preferably 1.5-2.5 μL, and more preferably 2 μL; the temperature of the digestion reaction is preferably 36-38°C, more preferably 37°C; and the digestion reaction time is 25-35 min, more preferably 28-32 min, and more preferably 30 min.

[0057] The present invention also provides GLP1-ET circular RNA obtained by using the above-mentioned method for synthesizing GLP1-ET circular RNA in vitro.

[0058] The present invention also provides a nanolipid particle circGLP1-ET-LNP containing the GLP1-ET circular RNA, and the preparation method comprises the following steps: mixing the GLP1-ET circular RNA with a citric acid buffer to obtain a circRNA-citric acid buffer, and then mixing the nanoliposome-ethanol solution and the circRNA-citric acid buffer according to a volume ratio to obtain the product.

[0059] In the present invention, the volume ratio of the lipid-ethanol solution to the circRNA-citrate buffer is preferably (2-4):1, more preferably (2.5-3.5):1, and further preferably 3:1.

[0060] The present invention also provides the use of the GLP1-ET circular RNA or the nanolipid particle circGLP1-ET-LNP in the preparation of a long-acting hypoglycemic nucleic acid drug.

[0061] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0062] Example 1 (one)

[0064] Based on the GLP1 polypeptide structure, the insulin signal peptide Insulin-SP was fused to its N-terminus, and the GSlinker and lysosomal escape fragment ET sequence were fused to its C-terminus to construct a DNA structure expressing a GLP-1 similar polypeptide, referred to as GLP1-ET.

[0065] The gene sequence of GLP1-ET is shown in SEQ ID NO.5, and the specific sequence is

[0066] Among them, the sequence segment from position 7 to position 78 in the DNA sequence of GLP1-ET is the insulin signal peptide Insulin-SP expression sequence, the sequence segment from position 97 to position 285 is the GLP1 polypeptide expression sequence, and the sequence segment from position 286 to position 393 is the ET polypeptide expression sequence.

[0067] In vitro synthesis of circular RNA was performed based on the PIE system of the Td gene. The PIE system of the Td gene (Gene ID: 5783859) can be characterized by a degenerate core exon splicing sequence (E2; E1), where the E2 sequence is shown in SEQ ID NO. 22, specifically CTAC; and the E1 sequence is shown in SEQ ID NO. 23, specifically TTGGGT. This core exon splicing sequence was designed to introduce a point mutation at base 676 of the EVB virus ribosome re-entry sequence (IRES), and also to mutate bases 679-683.

[0068] The EVB3 IRES sequence after evolutionary mutation is shown in SEQ ID NO.24, and the specific sequence is TTAAAACAGCCTGTGGGTTGTTCCCACCCGCAGGGCCCACTGGGCGCTAGCACACTGGTATCCCGGTACCCTTGTGCGCCTGTTTTATATACCCTCCCCCTTATGTAACTTAGAAGTATGATTCAAACGGTCGACAGGCGGCTCAGTGCACCAACTGAGTCATGACCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAAGCTGTTCACACGGCTGAAGGAGAAAACGTTCGTTACCCGGCCAATTACTTCGAGAAACCTAGTACCACCATGAAGGTTGCGCAGTGTTTCGCTCCACACAACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGCAACCCATGGGACGCTTCAATACTGACATGGTGTGAAGAGTCTATTGAGCTAATTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCCAACTGTGGAGCAGATACTCACAAACCAGTGAGCGGTCTGTCGTAACGGGCAACTCCGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCTTTTTATTCTTACATTGGCTGCTTATGGTGACAATTGACAAATTGTTACCATATAGCTATTGGATTGGCCATCCGGTGACAAACAGAGCTATTGTTTACTTGTTTGTTGGgTctAcACCATTAAATTACAAGGTCTTAGAAACTCTCAACTTTATTTTGACACTCAATACAGCAAA。

[0069] The EVB-IRES obtained above was separated into 3' and 5' ends. The EVB-IRES 3' sequence was then attached to the 3' homology arm of the Td gene, followed by the target sequence and the translation termination sequence of 6×PolyAC. This was followed by the EVB-IRES 5' sequence and the 5' homology arm of the Td gene, resulting in a structure consisting of Td gene 3' homology arm-EVB-IRES 3' sequence-target sequence-6×PolyACV-EVB-IRES 5'-Td gene 5' homology arm. The entire fragment was transcribed in vitro using a T7 promoter, and the resulting linear RNA was self-assembled by a PIE-mediated nuclease to generate a circular RNA.

[0070] In the present invention, when the target sequence is GLP1-ET, a circular RNA (GLP1-ET circular RNA) comprising EVB-IRES, GLP1-ET and 6×PolyAC termination sequences is obtained.

[0071] (II) In vitro synthesis of circGLP1 circular RNA and GLP1-ET circular RNA

[0072] 1. Construction of pcDNA3-EVB-IRES-circGLP1 expression plasmid (1)

[0074] Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the Td 3' homology arm sequence, EVB-IRES 3' sequence, EVB-IRES 5' sequence, GLP1 sequence, GLP1-ET gene sequence, 6xPolyAC sequence, and Td 5' homology arm sequence. The sequence information is shown in Table 1.

[0075] Table 1 DNA sequence information

[0076]

[0077] (2)

[0079] Using the Td 3' homology arm sequence as a template, primer pairs Td-3-F and Td-3-R were designed. The fragment was amplified using a high-fidelity PCR kit (Norvozymes, Cat. No. P505-d1), and the PCR product was purified using a kit (Norvozymes, Cat. No. DC301-01). The product is designated Td-3. The sequence of Td-3-F is shown in SEQ ID NO. 8, specifically GCTAGCGTTTAAACTTAAGCTTGGGAGACCCTCGAATGGAATTG; the sequence of Td-3-R is shown in SEQ ID NO. 9, specifically AAGACCTTGTAATTTAATGGTgTagCATTATGTTCAGATAAGG.

[0080] As above, using the EVB-IRES 3' sequence as a template, primer pairs EVB-3-F and EVB-3-R were designed, and PCR amplification was performed to obtain the product EVB-3. The sequence of EVB-3-F is shown in SEQ ID NO. 10, specifically CCTTATCTGAACATAATGctAcACCATTAAATTACAAGGTCTT; the sequence of EVB-3-R is shown in SEQ ID NO. 11, specifically cgcatccacagggccatggtggcggatccTTTGCTGTATTGAGT.

[0081] As above, using the GLP1 gene fragment as a template, primer pairs GLP1-F and GLP1-R were designed, and PCR amplification was performed to obtain the product GLP1. The sequence of GLP1-F is shown in SEQ ID NO. 14, specifically ACTCAATACAGCAAAggatccgccaccatggccctgtggatgcg; the sequence of GLP1-R is shown in SEQ ID NO. 15, specifically GTTTTTTTCActccatgtcctcattctggagctggacagggt.

[0082] In the present invention, the GLP1 sequence is shown in SEQ ID NO.4, and the specific sequence is ggatccgccaccatggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagccggatccCGGATCAGGCGCcattctga agggacctttaccagtgatgtaagttcttatttggaaggccaagctgccaaggaattcattgcttggctggtgaaaggcggcggtggcggcggtggttctggcggcggtggttc ttctggcggcggtggtagtgctgaatcgaaatatggtcccccatgtccaccctgtccagctccagaatgaggacatggagTGA. The sequence segment from position 13 to position 84 of the GLP1 sequence of the present invention is the insulin signal peptide expression sequence, and the sequence segment from position 103 to position 294 is the GLP1 polypeptide expression sequence.

[0083] As above, using the 6xPolyAC gene fragment as a template, primer pairs 6xPolyAC-F and 6xPolyAC-R were designed, and PCR amplification was performed to obtain the product 6xPolyAC. The sequence of 6xPolyAC-F is shown in SEQ ID NO. 12, specifically accctgtccagctccagaatgaggacatggagTGAAAAAAAC; the sequence of 6xPolyAC-R is shown in SEQ ID NO. 13, specifically CAACCCACAGGCTGTTTTAAGTTTTGTTTTTTGTTTTTTG.

[0084] As above, using the EVB-IRES 5'arm gene fragment as a template, primer pairs EVB-5-F and EVB-5-R were designed, and PCR amplification was performed to obtain the product EVB-5. The sequence of EVB-5-F is shown in SEQ ID NO. 16, specifically CAAAAAACAAAAAACAAAACTTAAAACAGCCTGTGGGTTG; the sequence of EVB-5-R is shown in SEQ ID NO. 17, specifically TCACCTTATACTCAGGCCTCAATTAAcCCAACAAACAAGTAAACA.

[0085] As above, using the Td 5' homology arm gene fragment as a template, primer pairs Td-5-F and Td-5-R were designed, and PCR amplification was performed to obtain the product Td-5. The sequence of Td-5-F is shown in SEQ ID NO. 18, specifically TGTTTACTTGTTTGTTGGgTTAATTGAGGCCTGAGTATAAGGTGA; the sequence of Td-5-R is shown in SEQ ID NO. 19, specifically GGGCCCTCTAGACTCGAGCTAGAAATCTGATAAATGGAATTAGTC.

[0086] The high-fidelity PCR amplification reaction system is shown in Table 1:

[0087] Table 1 Reaction system for amplifying each fragment product

[0088] Ingredients Dosage 2×PhantaMaxBuffer 25 μL dNTP (10 mM each) 1 μL Upstream primer 2μL Downstream primer 2μL DNA template 1ng PhantaMaxSuper-FidelityDNAPolymerase 1 μL <![CDATA[ddH2O]]> Make up the system to 50 μL

[0089] The high-fidelity PCR amplification reaction procedure is shown in Table 2:

[0090] Table 2 Reaction procedures for amplifying each fragment product

[0091] (3)

[0093] A total of 1 μg of pcDNA3.1-6xHis-N plasmid (Fenghui Biotechnology Co., Ltd.: ZT1845) was taken and double-digested with HindIII and Xho I endonucleases (purchased from NEB) at 37°C for 2 h. The DNA product was recovered using a kit (Novozymes, cat. no.: DC301-01) and used as the vector backbone DNA.

[0094] Then, a One-step cloning kit (Yisheng, catalog number: 10922ES20) was used to carry out the recombination reaction at 50° C. for 15 min according to the recombination reaction system described in Table 3 to complete the recombination reaction.

[0095] Table 3 Construction of the recombination reaction system of pcDNA3-EVB-IRES-circGLP1

[0096]

[0097] (4)

[0099] After the recombination reaction was completed, the recombinant product was transformed into DH5α competent bacteria (Qingke, catalog number: TSC-C14), and clones were picked on LB plates containing 100 μg / mL ampicillin. The expression plasmid pcDNA3-EVB-IRES-circGLP1 (such as Figure 5 ).

[0100] A small amount of bacterial culture was taken from the successfully constructed plasmid pcDNA3-EVB-IRES-circGLP1 to expand the culture and extract the endotoxin-free plasmid for use in cell experiments.

[0101] 2. Construction of pcDNA3-EVB-IRES-circGLP1-ET Plasmid (1)

[0103] Using the GLP1-ET fragment as a template, primer pairs GLP1-F and GLP1-ET-R were designed, and PCR amplification was performed to obtain the product GLP1-ET. The sequence of GLP1-F is shown in SEQ ID NO. 14, specifically ACTCAATACAGCAAAggatccgccaccatggccctgtggatgcg; the sequence of GLP1-ET-R is shown in SEQ ID NO. 20, specifically TCActccatgtcctcaCGGCCACACCGGGCTCC.

[0104] Using the 6xPolyAC fragment as a template, primer pairs ET-6xPolyAC-F and 6xPolyAC-R were designed, and PCR amplification was performed to obtain the product ET-6xPolyAC. The sequence of ET-6xPolyAC-F is shown in SEQ ID NO. 21, specifically TGAatgaggacatggagTGAAAAAAACAAAA; the sequence of 6xPolyAC-R is shown in SEQ ID NO. 13, specifically CAACCCACAGGCTGTTTTAAGTTTTGTTTTTTGTTTTTTG.

[0105] The high-fidelity PCR amplification reaction system is shown in Table 1, and the high-fidelity PCR amplification reaction procedure is shown in Table 2. (2)

[0107] A total of 1 μg of pcDNA3.1-6xHis-N plasmid was taken and double-digested with HindIII and Xho I endonucleases (NEB) at 37°C for 2 h. The DNA product was recovered using a kit (Novozymes, catalog number: DC301-01) and used as the vector backbone DNA.

[0108] Then, a One-step cloning kit (Yisheng, catalog number: 10922ES20) was used to carry out the recombination reaction at 50° C. for 15 min according to the recombination reaction system described in Table 4 to complete the recombination reaction.

[0109] Table 4 Construction of the recombination reaction system for pcDNA3-EVB-IRES-circGLP1-ET

[0110]

[0111] (3)

[0113] After the recombination reaction was completed, the recombinant product was transformed into DH5α competent bacteria (Beijing Qingke Biotechnology Co., Ltd., Catalog No.: TSC-C14), and clones were picked on LB plates containing 100 μg / mL ampicillin. The expression plasmid pcDNA3-EVB-IRES-circGLP1-ET (such as Figure 6 ).

[0114] A small amount of bacterial culture was taken from the successfully constructed plasmid pcDNA3-EVB-IRES-circGLP1-ET to expand the culture and extract the endotoxin-free plasmid for use in cell experiments.

[0115] 3. Synthesis of GLP1-ET circular RNA (circGLP1-ET) and circGLP1 circular RNA (circGLP1)

[0116] (1) Preparation of linearized plasmid template

[0117] 3 μg of plasmids, pcDNA3-EVB-IRES-circGLP1 and pcDNA3-EVB-IRES-circGLP1-ET, were each treated with Xho I restriction endonuclease (NEB, Cat. No. R0146V) at 37°C for 2 h. Electrophoresis was then performed on 1% agarose gel at 150 V for 30 min. After confirming complete linearization, the linearized plasmids were recovered using a kit (Novagen, Cat. No. DC301-01).

[0118] (2) In vitro transcription

[0119] Using an in vitro transcription kit (Hanhai New Enzyme, Cat. No. HBP001506), prepare the reaction system as described in Table 5. Gently mix all components using a pipette and incubate at 37°C for 16 hours. Then, add 2 μL of DNase I to the reaction system and incubate at 37°C for 30 minutes to digest the linearized plasmid DNA template.

[0120] Table 5 Reaction system for in vitro transcription

[0121] Components Dosage 10×ReactionBufferA 2μL <![CDATA[N 6 -methyladenosine(m 6 A)Solution(10mM)]]> 1 μL ATPSolution (100mM) 1.9 μL GTPSolution (100mM) 2μL CTPSolution (100mM) 2μL UTPSolution (100mM) 2μL The above linearized plasmid 500ng-1μg EnzymeMix 2μL <![CDATA[RNase-freeddH2O]]> Make up to 20 μL

[0122] (3) RNA cyclization and purification in vitro

[0123] (a) Add GTP Solution (100 mM, Sangon, Cat. No. A620332-0250) to the in vitro transcribed RNA to a final concentration of 2 mM and incubate at 55°C for 15 min. (b) Dilute the product to 180 μL with RNase-free ddH2O. (c) Add 20 μL of 3 M sodium acetate (pH 5.2) to the diluted product and mix thoroughly with a pipette. (d) Extract the product with 200 μL of a 1:1 phenol / chloroform mixture. Centrifuge at 12,000 rpm (13,400 × g) for 5 min at room temperature. Transfer the upper aqueous phase to a new RNase-free EP tube. (e) Extract once with an equal volume of chloroform to the aqueous phase. Transfer the upper aqueous phase to a new RNase-free EP tube. (f) Add 2 volumes of anhydrous ethanol, mix well, incubate at -20°C for 30 min, and then centrifuge at 12,000 rpm (13,400 × g) at 4°C for 15 min. (g) Discard the supernatant and add 500 μL of pre-chilled 70% ethanol to wash the RNA pellet. Centrifuge at 12,000 rpm (13,400 × g) at 4°C and discard the supernatant. (h) Uncap and dry for 3 min. Add 20-50 μL of RNase-free ddH2O to dissolve the RNA pellet and store at -80°C. (i) Take the purified RNA sample and digest the linear RNA with RNase R (Hanhai New Enzyme, Catalog No. HBP004600-1) at 37°C for 30 min. The reaction system is shown in Table 6. (j) After RNase R treatment, purify again according to steps (c)-(i) above and store at -80°C.

[0124] Table 6 RNase R digestion reaction system

[0125]

[0126] Example 2

[0127] (1) Electrophoresis detection

[0128] circGLP1 and circGLP1-ET samples were taken and analyzed by non-denaturing agarose gel electrophoresis.

[0129] Prepare 0.5x TBE electrophoresis buffer using DEPC-ddH2O. Pre-soak the electrophoresis tank with nuclease remover overnight and rinse with DEPC-ddH2O the next day. Pre-chill both the electrophoresis tank and the electrophoresis buffer at 4°C. Prepare a 1.5% agarose gel and pre-chill at 4°C. Prepare 500 ng of each circGLP1 and circGLP1-ET sample before and after RNase R treatment and dilute to 5 μL with DEPC-ddH2O. Add 5 μL of 2x RNA Denature Loading Buffer (Biyuntian, Cat. No. R0216) and incubate at 70°C for 10 min. Immediately cool on ice. Load the cooled samples onto a 1.5% agarose gel and run at 180 V for 30 min. After completion, visualize and photograph the gel using a Tanon 2500 imager.

[0130] The results are as follows Figure 1 As shown in the figure, after RNase R treatment, the linear precursor of circular RNA has been basically digested.

[0131] The processed circGLP1 and circGLP1-ET circular RNA samples were denatured.

[0132] (2) Cellular dual-luciferase reporter gene activity detection

[0133] HEK293T cells (Fenghui Biotechnology Co., Ltd., catalog number CL0133) were passaged and evenly plated in a 24-well plate. When the cell confluence reached 70-80%, transfection experiments were performed.

[0134] Each well of HEK293T cells (300,000 cells per well) was first transfected with a dual-luciferase reporter plasmid system consisting of 250 ng of pGL4-miniCMV-CRE plasmid, 250 ng of pcDNA3.1-GLP-1R plasmid, and 20 ng of pRL-TK plasmid. The transfected cells were then divided into a control group (Mork), a positive reference group (Semaglutide), an experimental group (circGLP1), and an experimental group (circGLP1-ET). The control group was treated with 0.8 μL of Lipo8000 reagent. The positive reference group was treated with semaglutide injection (1.5 ml / vial, Novo Nordisk) to a final concentration of 1 pM. For the experimental group, 0.5 μg of circGLP1 sample was added to 0.8 μL of Lipo8000 reagent and 25 μL of DMEM medium. The mixture was gently pipetted and incubated at room temperature for 5 minutes. For the experimental group, 0.5 μg of circGLP1-ET sample was added to 0.8 μL of Lipo8000 reagent and 25 μL of DMEM medium. The mixture was gently pipetted and incubated at room temperature for 5 minutes. After treatment, the mixture was evenly added to each well of cells and cultured for 24-48 hours. The bioluminescence intensity of each group was measured.

[0135] The Dual Luciferase Reporter Gene Assay Kit (Novozyme, Cat. No. DL101-01) was used to wash, lyse, centrifuge, and collect the supernatant of the transfected cells according to the instructions. The bioluminescence intensity was then read using a Promega bioluminescence detector. Figure 2 As shown in the figure, it can be observed that the prepared two circular RNAs, circGLP1 and circGLP1-ET, can significantly activate GLP-1R.

[0136] (III) Hypoglycemic experiment in DIO model mice

[0137] 1. Preparation of circGLP1-ET-LNP and circGLP1-LNP Nanoparticles

[0138] Four lipids, ALC-0315, DSPC, Cholesterol, and DMG-PEG2000 (all products of Avitol), were weighed and dissolved in ethanol to prepare 10 mg / mL (16 mM) stock solutions of each lipid for use. A nanoliposome-ethanol solution was then prepared at a molar ratio of ALC-0315:DSPC:Cholesterol:DMG-PEG2000 = 50:10:38.5:1.5, as shown in Table 7.

[0139] Table 7 Ratio of each component of nanoliposome LNP

[0140]

[0141] Prepare 50 ml of each 100 mM citric acid (molecular weight: 210.14, weigh 1.05 g) and sodium citrate (molecular weight: 294.10, weigh 1.47 g) solution using ultrapure water. Mix 33.0 ml of the citric acid solution and 17.0 ml of the sodium citrate solution, then add DEPC. Let stand for 30 minutes before autoclaving to remove the DEPC. After sterilization, dilute to 100 ml with DEPC water to obtain 50 mM citric acid buffer (pH 4).

[0142] According to the nitrogen-phosphorus ratio N / P=6, it was calculated that the total mass of circRNA that could be encapsulated in every 100 μL of 10 mg / mL nanoliposome-ethanol solution was 43 μg.

[0143] Based on the volume ratio (FRR) of nanoliposome-ethanol solution: citric acid-RNA solution = 3, the total volume of citric acid buffer was 300 μL, and the RNA concentration of the prepared circRNA-citric acid buffer was 0.143 μg / μL.

[0144] Take 100 μL of nanoliposome-ethanol solution and 300 μL of circRNA-citrate buffer, use the microfluidic rapid nanodrug preparation system (Nanomicro Technology, model: NWDPSⅡ40) to prepare nanoliposome LNP, the lipid-ethanol: citric acid-RNA solution volume ratio (FRR) = 3, 200 μL of the front waste liquid, 50 μL of the rear waste liquid, and collect the sample after running the machine.

[0145] After sample collection, the ethanol concentration was immediately diluted to below 1% with 30 volumes of PBS solution, and then ultrafiltration and concentration were performed using Milipore 30KD ultrafiltration tubes and centrifuged at 3000xg for 20 minutes. The ultrafiltered samples were stored in PBS containing 2% sucrose and frozen at -80°C.

[0146] 2. Particle Size Characterization and Measurement of circGLP1-ET-LNP and circGLP1-LNP Nanoparticles

[0147] The particle size and Zeta potential of LNP were measured using a dynamic light scattering instrument. Figure 3 As shown, LNPs with a uniform particle size of about 110 nm and a slightly negative Zeta potential were obtained.

[0148] 3. Blood sugar lowering experiment

[0149] Thirty 6-week-old B6 mice (purchased from Weitong Lihua Zhejiang Branch) were used and fed with a high-fat diet (purchased from Shanghai Bopai Biotechnology Co., Ltd., 60% fat, product number D12492). Fresh food was replaced once a week for 3 months. Blood glucose was continuously monitored for 3 days using blood glucose test strips. When blood glucose stabilized to a level of about 9 mmol / L, DIO model mice were obtained and subsequent experiments could be performed. The nanolipid particles circGLP1-ET-LNP and circGLP1-LNP prepared above were respectively taken and intraperitoneally injected as circGLP1-ET-LNP group and circGLP1-LNP group. Each mouse was injected with 200 μL of nanolipid particles circGLP1-ET-LNP and circGLP1-LNP, of which the amount of circRNA was 40 μg. Simultaneously, mice were injected with empty LNPs (200 μL) as a negative control (LNP group). Semaglutide was administered as a positive control (semaglutide group) at a dose of approximately 600 ng / g body weight (15 ng / g body weight). The mice were then monitored for changes in blood glucose and body weight for one week.

[0150] The results are as follows Figure 4 As shown in the figure, after injection of circGLP1-LNP and circGLP1-ET-LNP, the blood glucose of mice remained lower than the initial blood glucose within 96 hours, and their body weight also showed a significant downward trend within a week.

[0151] In summary, it can be seen that the GLP1-ET circular RNA synthesized by the technical solution of the present invention can be used to prepare nucleic acid drugs with long-term hypoglycemic effects. It has a long-term hypoglycemic effect in vivo and performs well in lowering blood sugar and body weight.

[0152] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A gene sequence encoding a GLP-1 analogous polypeptide GLP1-ET, characterized in that: The gene sequence of GLP1-ET is shown in SEQ ID NO.

5.

2. A plasmid for synthesizing circular RNA for use in conjunction with the GLP1-ET gene sequence according to claim 1, characterized in that: The plasmid includes an empty vector and a structural unit, wherein the empty vector is a pcDNA3.1 plasmid, and the structural unit includes a Td 3' homology arm sequence, an EVB-IRES 3' sequence, a target gene sequence containing an ET fragment, a 6xPolyAC sequence, an EVB-IRES 5' sequence, and a Td 5' homology arm sequence.

3. The plasmid according to claim 2, characterized in that The Td 3' homology arm sequence is shown as SEQ ID NO.1, the EVB-IRES 3' sequence is shown as SEQ ID NO.2, the EVB-IRES 5' sequence is shown as SEQ ID NO.3, the 6xPolyAC sequence is shown as SEQ ID NO.6, the Td 5' homology arm sequence is shown as SEQ ID NO.7, and the ET fragment sequence is shown as SEQ ID NO.

25.

4. A plasmid for synthesizing circular RNA containing the GLP1-ET gene sequence according to claim 1, characterized in that: The plasmid is a pcDNA3-EVB-IRES-circGLP1-ET plasmid, which includes an empty vector and a structural unit. The empty vector is a pcDNA3.1 plasmid, and the structural unit includes a Td 3' homology arm sequence, an EVB-IRES 3' sequence, the GLP1-ET gene sequence according to claim 1, a 6xPolyAC sequence, an EVB-IRES 5' sequence, and a Td 5' homology arm sequence.

5. The method for constructing a plasmid for synthesizing circular RNA according to claim 4, characterized in that: The method comprises the following steps: performing PCR amplification reaction using the Td 3' homology arm sequence, the EVB-IRES 3' sequence, the GLP1-ET gene sequence, the 6xPolyAC sequence, the EVB-IRES 5' sequence and the Td 5' homology arm sequence as templates to obtain PCR amplification products, then performing a recombination reaction with the linearized vector obtained after enzyme digestion, and obtaining the GLP1-ET circular RNA after transformation and verification; The primer pair for the Td 3' homology arm sequence includes Td-3-F and Td-3-R, the sequence of Td-3-F is shown in SEQ ID NO.8, and the sequence of Td-3-R is shown in SEQ ID NO.9; The primer pair for the EVB-IRES 3' sequence includes EVB-3-F and EVB-3-R, the sequence of EVB-3-F is shown in SEQ ID NO.10, and the sequence of EVB-3-R is shown in SEQ ID NO.11; The primer pair for the GLP1-ET gene sequence includes GLP1-F and GLP1-ET-R, the sequence of GLP1-F is shown in SEQ ID NO. 14, and the sequence of GLP1-ET-R is shown in SEQ ID NO. 20; The primer pair for the 6xPolyAC sequence includes ET-6xPolyAC-F and 6xPolyAC-R, the sequence of the ET-6xPolyAC-F is shown in SEQ ID NO.21, and the sequence of the 6xPolyAC-R is shown in SEQ ID NO.13; The primer pair for the EVB-IRES 5' sequence includes EVB-5-F and EVB-5-R, the sequence of EVB-5-F is shown in SEQ ID NO.16, and the sequence of EVB-5-R is shown in SEQ ID NO.17; The primer pair for the Td 5' homology arm sequence includes Td-5-F and Td-5-R. The sequence of Td-5-F is shown in SEQ ID NO. 18, and the sequence of Td-5-R is shown in SEQ ID NO.

19.

6. A method for synthesizing GLP1-ET circular RNA in vitro using the plasmid according to claim 4, characterized in that: The steps include: (1) The pcDNA3-EVB-IRES-circGLP1-ET plasmid was digested to obtain a linearized vector; (2) performing an in vitro transcription reaction on the linearized vector described in step (1), followed by digestion to obtain transcribed RNA; (3) The transcribed RNA of step (2) is circularized by intron-mediated in vitro self-splicing, and purified to obtain the GLP1-ET circular RNA.

7. The method according to claim 6, characterized in that The reaction system of in vitro transcription in step (2) includes the following components: 10× Reaction Buffer A 2 μL, N 6 -methyladenosine(m 6 A) Solution 1 μL, ATP solution 1.9 μL, GTP solution 2 μL, CTP solution 2 μL, UTP solution 2 μL, linearized vector 500 ng-1 μg, Enzyme Mix 2 μL, add RNase-free ddH2O to 20 μL; Step (2) adding DNaseI for digestion reaction, wherein the amount of DNaseI added is 1-3 μL; The temperature of the digestion reaction is 36-38° C., and the time of the digestion reaction is 25-35 min.

8. GLP1-ET circular RNA obtained by the method for synthesizing GLP1-ET circular RNA in vitro according to claim 6.

9. A nanolipid particle circGLP1-ET-LNP comprising the GLP1-ET circular RNA according to claim 8, characterized in that The preparation method comprises the following steps: The GLP1-ET circular RNA is mixed with a citric acid buffer to obtain a circRNA-citric acid buffer, and then the nanoliposome-ethanol solution and the circRNA-citric acid buffer are mixed in a volume ratio of (2-4):1 to obtain the product.

10. Use of the GLP1-ET circular RNA according to claim 8 or the nanolipid particle circGLP1-ET-LNP according to claim 9 in the preparation of a long-acting hypoglycemic nucleic acid drug.

Images