Molecular marker related to cattle growth traits and application thereof

Abstract

The invention discloses a molecular marker related to cattle growth traits and application thereof, and belongs to the technical field of molecular biology. The molecular marker provided by the invention is the 123 nucleotide of SEQ ID NO: 1, the type of the nucleotide is G or T, and a Ggt exists at the 38815880 position of a chromosome 14 of a bovine genome; the nucleotide single base of T is mutated, and the mutation is obviously related to the weights of the fourth month, the ninth month and the twelfth month of Chinese Holstein cattle, the body height of the twelfth month of cattle and the chest circumference of the twelfth month of cattle. By detecting the genotype of the cattle to be detected at the SNP site, the early selection of the body weight, the body height and the chest circumference of the cattle can be realized.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and in particular relates to a molecular marker related to cattle growth traits and an application thereof. Background Art

[0002] As dairy cattle genetics and breeding progress, people are increasingly aware of the significant impact of growth traits on economic performance. Many developed dairy countries are beginning to incorporate body conformation traits, such as height, body length, and chest circumference, into their dairy cattle breeding systems, while also considering weight. However, in China, genetic analysis of growth traits is limited to genetic parameter estimation, while research and application in genomic selection for growth traits and functional gene discovery remains largely unexplored.

[0003] Hepatocyte nuclear factor 4 gamma (HNF4G) is an isoform of HNF4 (Hepatocyte nuclear factor 4), a member of the hepatocyte nuclear receptor superfamily. It is a transcription factor whose expression is regulated in multiple tissues. Prediction of HNF4G target genes revealed that 15.6% are related to tissue morphology and development, and 6.5% are involved in lipid and carbohydrate metabolism. HNF4G can promote mammary gland development in dairy cows by activating related target genes and regulating the expression of fatty acid enzyme genes, thereby regulating milk fat metabolism. The bovine HNF4G gene is located on chromosome 14 and contains 12 exons, encoding 408 amino acids.

[0004] Therefore, there is an urgent need to provide a molecular marker related to the aforementioned genes to assist in the study of growth traits. Summary of the Invention

[0005] The technical problem to be solved by the present invention is molecular markers related to cattle growth traits. The technical problem to be solved is not limited to the technical subject described above, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0006] Based on the previous GWAS research results and biological analysis, the present invention carried out polymorphism identification and genetic effect analysis on the discovered important functional candidate genes of HNF4G, in order to obtain molecular markers or causative mutations with important breeding value.

[0007] In order to solve the above technical problems, the present invention provides the following technical solutions: The present invention provides an application of a substance for detecting the polymorphism or genotype of a SNP site in a cattle genome, wherein the SNP site is the 123rd nucleotide of SEQ ID NO: 1, and the nucleotide type thereof is T or G. The application is any of the following: A1) Use of the substance in detecting or assisting in detecting cattle weight; A2) Use of the substance in detecting or assisting in detecting high blood pressure in cattle; A3) Use of the substance in detecting or assisting in detecting breast girth of cattle; A4) Use of the substance in detecting or assisting in detecting SNP polymorphism or genotype; A5) Use of the substance in cattle breeding; A6) Use of the substance in the preparation of a product for detecting or assisting in detecting cattle weight; A7) Use of the substance in the preparation of a product for detecting or assisting in the detection of high blood pressure in cattle; A8) Use of the substance in the preparation of a product for detecting or assisting in the detection of bovine breast girth; A9) Use of the substance in the preparation of a product for detecting or assisting in the detection of SNP polymorphism or genotype; A10) Use of the substance in the preparation of a product for cattle breeding.

[0008] The SNP is also located at nucleotide position 38815880 on chromosome 14 of the bovine genome (NCBI Reference Sequence: NC_037341.1) (corresponding to nucleotide position 123 of the nucleotide sequence SEQ ID NO: 1).

[0009] Those skilled in the art know that SEQ ID NO: 1 is composed of the SNP site (nucleotide 123 of SEQ ID NO: 1) and the nucleotide sequence in its vicinity. The amount of nucleotide sequence near the SNP site should not be used as a limiting factor for the scope of protection of the present invention. It can be 25 bp, 50 bp, 70 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp before and after the SNP site, or any other arbitrary value. Its function is to assist in locating the position of the SNP on chromosome 14 of the bovine genome.

[0010] The front and back mentioned herein should be defined in the direction recognized by those skilled in the art, such as the 5'-3' direction.

[0011] The present invention also provides a method for detecting or assisting in detecting cattle weight, cattle height and / or cattle chest circumference, comprising the following steps: detecting the genotype of the aforementioned SNP site in the cattle to be tested, and detecting or assisting in detecting the cattle weight, cattle height and / or cattle chest circumference based on the genotype.

[0012] In the above method for detecting or assisting in detecting cattle weight, height, and / or chest circumference, the weight, height, and / or chest circumference of the tested cattle whose SNP genotype is TT are significantly higher than those of the tested cattle whose genotypes are TG and GG, and the weight, height, and / or chest circumference of the tested cattle whose genotype is TG are significantly higher than those of the tested cattle whose genotype is GG. The TT is a homozygous type of the SNP site being T, the TG is a heterozygous type of the SNP site being G and T, and the GG is a homozygous type of the SNP site being G.

[0013] In the above applications or methods, the detection or auxiliary detection of cattle weight, cattle height and / or cattle chest circumference can specifically be the detection of cattle weight, cattle height and / or cattle chest circumference.

[0014] In the above method, a portion of the bovine genome containing the aforementioned SNP can be amplified by PCR. For example, a PCR product containing SEQ ID NO: 1 is sequenced to detect the type of deoxyribonucleotide at position 123 of SEQ ID NO: 1 to detect the genotype of the SNP site in the bovine genome to be tested.

[0015] The present invention also provides a cattle breeding method, which comprises detecting the genotype of the aforementioned SNP site in the genome of the tested cattle, and selecting the tested cattle whose genotype of the SNP site is TT as a parent for breeding, wherein the TT is the homozygous type of the SNP site being T.

[0016] The present invention also provides a product containing a substance for detecting the polymorphism or genotype of a SNP site in a cattle genome, wherein the SNP site is nucleotide 123 of SEQ ID NO: 1, and the nucleotide type thereof is T or G; the product is any of the following: B1) Products used for testing or assisting in testing cattle weight, height and / or chest circumference; B2) Products used to detect or assist in detecting SNP polymorphisms or genotypes; B3) Products used for cattle breeding.

[0017] In the above applications or products, the substance is any of the following: C1) the substance is a primer composition for amplifying a bovine genomic DNA fragment including the SNP site; C2) the substance is a PCR reagent containing the primer combination described in C1); C3) The substance is a kit containing the primer composition described in C1) or the PCR reagent described in C2).

[0018] The kit may further include conventional reagents for PCR amplification. The kit may further include conventional reagents for sequencing.

[0019] In the above application or product, the primer composition is any one of F1) to F3): F1), a primer set consisting of the single-stranded DNA shown in SEQ ID NO: 2 in the sequence listing and the single-stranded DNA shown in SEQ ID NO: 3 in the sequence listing; F2), a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 1 to 20 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having a nucleotide sequence of positions 387 to 411 of SEQ ID NO: 1 in the sequence listing; F3), a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 2 after one or more nucleotide substitutions and / or deletions and / or additions, and a single-stranded DNA having the same function as SEQ ID NO: 3 after one or more nucleotide substitutions and / or deletions and / or additions; F4), a primer set consisting of the single-stranded DNA shown in SEQ ID NO: 4 in the sequence listing and the single-stranded DNA shown in SEQ ID NO: 3 in the sequence listing; F5), a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 107 to 122 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having a nucleotide sequence of positions 387 to 411 of SEQ ID NO: 1 in the sequence listing; F6), a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 4 by substitution and / or deletion and / or addition of one or several nucleotides, and a single-stranded DNA having the same function as SEQ ID NO: 3 by substitution and / or deletion and / or addition of one or several nucleotides.

[0020] The present invention also provides application of the above product in cattle breeding.

[0021] The present invention also provides a DNA molecule, wherein one chain of the DNA molecule is SEQ ID NO: 1.

[0022] The present invention further provides an application of a DNA molecule, wherein the nucleotide sequence of one chain of the DNA molecule is SEQ ID NO: 1, and the application is any one of the following: M1) Use of the DNA molecule in detecting or assisting in detecting cattle weight; M2) Use of the DNA molecule in detecting or assisting in detecting high blood pressure in cattle; M3) Use of the DNA molecule in detecting or assisting in detecting breast circumference of cattle; M4) Use of the DNA molecule in detecting or assisting in detecting SNP polymorphism or genotype; M5) Use of the DNA molecule in cattle breeding; M6) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting cattle weight; M7) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting cattle height; M8) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting bovine breast circumference; M9) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting a polymorphism or genotype of a SNP; M10) Use of the DNA molecule in preparing cattle breeding products.

[0023] The present invention also protects the use of any of the above methods in breeding.

[0024] The present invention also protects the application of the specific primer in breeding.

[0025] The present invention also protects the use of the kit in breeding.

[0026] The present invention also protects the primer composition.

[0027] Any of the above breeding is cattle breeding.

[0028] The purpose of the breeding is to select individuals with high cattle weight, high body height and / or high chest girth.

[0029] The purpose of the breeding is to select a group of cattle with high body weight, body height and / or chest girth.

[0030] The purpose of the breeding is to select breeds with high cattle weight, high body height and / or high chest girth.

[0031] The cattle mentioned above are all cattle breeds, and can be specifically Chinese Holstein cattle.

[0032] The weights mentioned above are the weights of cattle at 4, 9 and 12 months of age.

[0033] The body height mentioned above is the body height of cattle at 12 months old.

[0034] The chest circumference mentioned above is the chest circumference of 12-month-old cattle.

[0035] Through research, the present invention discovered a molecular marker, located at nucleotide position 123 of SEQ ID NO: 1, which is either G or T. A single-base mutation, G>T, occurs at position 38815880 on chromosome 14 of the bovine genome. This mutation is significantly correlated with weight, height, and chest circumference at 4, 9, and 12 months of age in Chinese Holstein cattle. By testing the genotype of the cattle at this SNP, early selection for weight, height, and chest circumference can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is the sequencing peak diagram of the rs32 SNP site.

[0037] Figure 2 This is a scatter plot of the Sequenom MassArray typing results for the rs32 locus. DETAILED DESCRIPTION

[0038] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0039] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0040] The following examples were processed using SAS 9.4 statistical software. The experimental results were expressed as least squares mean + standard error. ANOVA was used for significance test. P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated an extremely significant difference.

[0041] Example 1 1. Experimental Methods 1. Phenotypic data The present invention selected 1,152 offspring cows composed of 20 Chinese Holstein bull families from two ranches of Beijing Shounong Animal Husbandry Development Co., Ltd. as the experimental group, and collected a total of 15,683 measurement records of weight, height, body oblique length, and chest circumference, involving birth weight, weaning weight, three-month-old weight, three-month-old height, three-month-old body oblique length, three-month-old chest circumference, four-month-old weight, five-month-old weight, six-month-old weight, six-month-old height, six-month-old body oblique length, six-month-old chest circumference, seven-month-old weight, eight-month-old weight, nine-month-old weight, nine-month-old height, nine-month-old body oblique length, nine-month-old chest circumference, ten-month-old weight, eleven-month-old weight, twelfth-month-old weight, twelfth-month-old height, twelfth-month-old body oblique length, and twelve-month-old chest circumference, a total of 24 growth traits. The descriptive statistics are shown in Table 1. The number of individual measurements ranged from 2 to 24, with an average of 17.03 growth trait phenotypic records per individual. Among them, the average number of daughters of each bull mentioned above is 57, and each cow has three generations of pedigree information.

[0042] Table 1 Descriptive statistics of growth traits of Chinese Holstein cattle

[0043] Note: 1 BW i for i Weight for age ( i = 0, 2~12); HH i for i Height at age (months) i = 3, 6, 9, 12); BL i for i Monthly body length ( i = 3, 6, 9, 12); CG i for i Chest circumference (months) i = 3, 6, 9, 12).

[0044] 2. Polymorphism detection of candidate genes 2.1 Primer design According to the cattle HNF4G Primers were designed using Primer 3.0 (http: / / primer3.wi.mit.edu / ), Primer Premier 5, and Oligo 6.0 software based on the gene sequence information in GeneBank (ID: 404168). A total of 13 primer pairs were designed, covering the entire coding region, portions of the flanking introns, and 2000 bp each of the upstream and downstream regulatory regions. Larger exons were amplified in segments to avoid affecting sequencing results. The primer sequences are shown in Table 2 below. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0045] Table 2 HNF4GGene PCR amplification primer sequence information

[0046] 2.2 Pooled sequencing and PCR amplification Twenty Chinese Holstein bulls were randomly divided into two groups. DNA from each group was diluted to a concentration of 50 ng / μL and mixed into two pools of DNA. The HNF4G gene was amplified by PCR using the two pools of DNA from these 20 bulls as templates (see Tables 3 and 4 for the reaction system and conditions). The purified PCR products were then sequenced in the pool on an ABI3730XL sequencer. Sequencing maps and sequences were analyzed using Chromas, DNAMAN, and NCBI BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). The location of the SNP and the type of mutation were identified by sequence alignment.

[0047] Table 3 PCR reaction system

[0048] Table 4 PCR reaction conditions

[0049] 2.3 Genotyping technology Based on the type of base mutation site to be typed and the sequence characteristics, the present invention uses MALDI-TOF-MS (matrix-assisted laser desorption tandem time-of-flight mass spectrometry) detection technology to perform genotyping on the different mutation sites screened by the mixed pool sequencing in the validation population. The MALDI-TOF-MS (matrix-assisted laser desorption tandem time-of-flight mass spectrometry) detection method is as follows: 1) Primer design and synthesis Based on the sequence information for each locus, specific primers (5'-ACGTTGGATGGAGATATATTGGACTTGTG-3' / 5'-ACGTTGGATGCACCAATGCTGGCAATTTTC-3') and a single-base extension primer (5'-cctccCTCAGTCTCAAGCCCT-3', SEQ ID NO: 4, where lowercase letters indicate equilibrium Tm values and are mismatched with the genomic sequence) were designed for multiplex PCR reactions using AssayDesigner 3.1 software from Sequenom (USA). The software automatically calculated PCR product length, Tm value, primer information, and extension product molecular weight. Primers for multiplex PCR should not only ensure high detection rates for individual loci but also ensure that multiple PCR reactions do not interfere with each other. The optimal primer combination was selected based on the different design strategies. The final concentrations of amplification primers were 100 μM, and those of extension primers were 500 μM.

[0050] 2) Multiplex PCR reaction The multiplex PCR reaction system was as follows: ddH2O (HPLC grade) 1.8μL, 10× PCR Buffer 0.5μL, MgCl2 (25mM) 0.4μL, dNTP Mix (25mM) 0.1μL, Primer Mix (0.5μM) 1μL, and HotStar Taq (5U / μL) 0.2μL. 4μL of the mixed reagents was added to each well of a 384-well plate. The template was added in a volume of 1μL to ensure a total reaction volume of 5μL.

[0051] The PCR reaction program was as follows: 94°C for 15 minutes; 94°C for 20 seconds, 56°C for 30 seconds, 72°C for 1 minute, 45 cycles; 72°C for 3 minutes; and storage at 4°C. After the PCR reaction, perform electrophoresis. Add 2 μL of loading buffer and 1 μL of PCR product at a voltage of 110 V and a current of 75 mA. Observe the results after 40 minutes. If the results are positive, proceed to the SAP reaction.

[0052] 3) SAP reaction Add 2 μL of shrimp alkaline phosphatase (SAP, Sequenom) digestion solution (1.53 μL ddH2O (HPLC grade), 0.17 μL hME buffer, and 0.474 U of SAP) to the PCR product to remove unused dNTPs and ensure the accuracy of the next single-base extension. The reaction procedure is: 37°C for 40 min, 85°C for 5 min, and storage at 4°C.

[0053] 4) Single base extension reaction and detection Single-base extension reaction system: ddH2O 0.619μL, iPLEX Buffer Plus 0.20μL, iPLEXTermination mix 0.20μL, iPLEX Extend Primer Mix 0.94μL, iPLEX Enzyme 0.041μL. Reaction conditions: 94°C for 30s; 94°C for 5s, 52°C for 5s, 40 cycles; 80°C for 5s, 5 cycles; 72°C for 3 min; storage at 4°C. Cation exchange resin was added to the terminated reaction for desalting and introduction into the assay. Samples were entered into a spreadsheet, plate preparation was performed, samples were applied, MassARRAY analysis was performed, quality control was performed, and final data collection was performed.

[0054] 2.4 Data Statistical Analysis 2.4.1 Original phenotypic processing After collecting the raw phenotypic data, we first reviewed the data. Because the original data was often confusing, we reclassified the growth traits by age based on the recorded age ± 15 days. For example, the 3-month-old weight was calculated based on the weight of the 75-105-day-old, the 4-month-old weight was calculated based on the weight of the 106-135-day-old, and so on.

[0055] Secondly, phenotypic outliers were removed, and the removal standard was the mean ± 3 standard deviations. However, the probability density plots of some traits still did not conform to the normal distribution law after removing the outliers, so the bestNormalize R package was used for multiple normal transformations, and finally all traits conformed to the normal distribution.

[0056] 2.4.2 Calculation of gene frequency and genotype frequency Gene frequency refers to the ratio of the number of a gene to the total number of genes in a population, while genotype frequency refers to the ratio of the number of individuals with a certain genotype to the total number of individuals in a population. Gene frequency and genotype frequency are important parameters for describing the genetic characteristics of a population structure. The calculation formula is as follows (assuming that A and B are two alleles at a locus)

[0057]

[0058]

[0059]

[0060]

[0061] Where p is the gene frequency of allele A, q is the gene frequency of allele B, H is the genotype frequency of genotype AA, R is the genotype frequency of genotype BB, and D is the genotype frequency of genotype AB. AA, AB, and BB are the numbers of each genotype in the population.

[0062] 2.4.3 Single marker analysis Genotype association analysis was conducted on 921 Chinese Holstein cows using SAS9.4 software. The association analysis used a single-trait mixed linear animal model. The specific model is as follows: G

[0063] Where: Y1 is the observed value of birth weight; Y2 is the observed value of 24 growth traits except birth weight; μ is the population mean of each observation; f is the fixed effect of field; y is the fixed effect of birth year; s is the fixed effect of birth season; p is the fixed effect of maternal parity; b is the coefficient of the covariate; W0 is birth weight; a is the individual additive genetic effect vector; G is the genotype / haplotype combination effect; and e is the random residual effect vector.

[0064] also, , where G array is the kinship matrix obtained through gene marker sites, and A array is the kinship matrix calculated through pedigree.

[0065] 2.4.3 Analysis of allele genotype effects SAS9.4 software was used to perform significance tests on the SNP additive effect, dominant effect, and allele substitution effect of the association analysis results of 921 Chinese Holstein dairy cows. The calculation formula is as follows:

[0066]

[0067]

[0068] Where a is the additive effect, d is the dominant effect, and α is the allele substitution effect; XAA, XAB, and XBB are the least square means of the growth traits of the corresponding genotypes.

[0069] 2. Results and Analysis 1. PCR amplification and identification of mutant bases Using DNA from two pools of 20 bulls as templates, 13 pairs of primers were successfully designed to amplify the entire coding region of the HNF4G gene, parts of the flanking intronic regions, and 2000 bp of the upstream and downstream regulatory regions for genetic polymorphism detection. PCR amplification products were synthesized and sent to Sangon Biotech (Shanghai) Co., Ltd. for forward and reverse sequencing. Sequencing results were compared with the reference sequence, and a significant SNP mutation, rs32 (G / T), was identified in the HNF4G gene (nucleotides 38696402 to 38831341 of NC_037341.1), located at nucleotide 38815880 on chromosome 14 of the bovine genome (NC_037341.1) (corresponding to nucleotide 123 of SEQ ID NO: 1).

[0070] The results showed that one important SNP site was identified in the HNF4G gene of Chinese Holstein cattle. The specific information is shown in Table 5: Table 5 HNF4G gene SNP site information

[0071] The primers for identifying the rs32 SNP site are as follows: 1) The primer sequences for SNP1 identification are: F:5'-GTGTCCACTTCCATGGTGTTTAC-3' (SEQ ID NO:2); R: 5'-GGATAAGTGAAGAAGAAAACCAATT-3' (SEQ ID NO: 3).

[0072] The PCR amplified product obtained a nucleotide sequence of SEQ ID NO: 1, with a fragment length of 410 bp.

[0073] The sequence of SEQ ID NO: 1 is as follows: 5'-GTGTCCACTTCCATGGTGTTTACTTATTGCAGGGGCAGAAAAAAGAGATATATTGGACTTGTGTTATTTTCAATGACAGATTAATAATAATGTTTTTAATAATAGATCTCAGTCTCAAGCCCTKGTGCGAGCGCTGACATAAATGTTAAGAAAATTGCCAGCATTGGTGATGTCTGTGAATCCATGAAACAGCAGCTCCTAGTCTTG GTGGAATGGGCTAAATATATCCCTGCCTTGTGAGTTACCACTGGACGATCAGGTATATAAGAGATTACAAAACTTTAAAAAGTGTTTTTTGA0ACTTTGCTAAGTTTGTGTGTTCTTTTAGTTATATTTGTAGTTTATTTTCTATATGTGACAAAGGTTAAATGGTCTTATGAGAGAAAATTGGTTTTCTTCTTCACTTATCC-3'.

[0074] The K is G or T.

[0075] It can be seen from this that the genotype of the cattle to be tested can be defined according to the following rules: GG genotype: If the PCR product obtained by amplifying the genomic DNA of the cattle to be tested using upstream primer F (SEQ ID NO: 2) and downstream primer R (SEQ ID NO: 3) contains only a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 123rd nucleotide of SEQ ID NO: 1 is G, and does not contain a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 123rd nucleotide of SEQ ID NO: 1 is T, then the aforementioned SNP genotype of the cattle to be tested is GG.

[0076] TT genotype: If the PCR product obtained by amplifying the genomic DNA of the cattle to be tested using upstream primer F (SEQ ID NO: 2) and downstream primer R (SEQ ID NO: 3) does not contain a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 123rd nucleotide of SEQ ID NO: 1 is G, and only contains a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 123rd nucleotide of SEQ ID NO: 1 is T, then the aforementioned SNP genotype of the cattle to be tested is TT.

[0077] GT genotype: If the PCR product obtained by amplifying the genomic DNA of the cattle to be tested using upstream primer F (SEQ ID NO: 2) and downstream primer R (SEQ ID NO: 3) contains both a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 123rd nucleotide of SEQ ID NO: 1 is G, and a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 123rd nucleotide of SEQ ID NO: 1 is T, then the aforementioned SNP genotype of the cattle to be tested is GT.

[0078] 2. Genotyping results of the rs32 mutation site in the validation population Based on the type and sequence characteristics of the base mutation site to be typed, this study selected MALDI-TOF-MS (matrix-assisted laser desorption tandem time-of-flight mass spectrometry) detection technology to genotype the rs32 mutation site screened by the above-mentioned mixed pool sequencing in a validation population of 1,152 Chinese Holstein cattle. The samples were obtained from the Shandong Branch and Henan Branch of Beijing Shounong Animal Husbandry Development Co., Ltd.

[0079] The typing results of the rs32 SNP site are as follows Figure 2 shown.

[0080] The above typing results show the distribution of three different genotypes detected using the Sequenom MassArray method. As can be seen from the figure above, no typing peaks at other sites appear in the two homozygous typing. All samples cluster close to the horizontal and vertical axes. In contrast, heterozygotes show amplification products at two points with equal efficiency, and the final cluster appears at approximately 45 degrees.

[0081] According to the genotype definition rules in "1. PCR amplification and identification of mutant bases", the MALDI-TOF-MS typing results (partial) of the rs32 SNP are shown in Table 6 below.

[0082] Table 6 Partial typing results of rs32 SNP locus

[0083] 3. Analysis of genetic effects of gene polymorphism and growth traits 3.1 Single-marker association analysis results Association analyses were conducted between the rs32 locus and 24 growth traits of Chinese Holstein cattle, including birth weight, weaning weight, body weight from 3 to 12 months of age, and body dimensions (height, length, and chest circumference) at 3, 6, 9, and 12 months of age. Multiple comparisons were used to analyze the effects of different genotypes on growth. The results of the association analyses are shown in Tables 7 to 9. The results of the multiple comparisons are P values after Bonferroni correction.

[0084] The results show that: The rs32 SNP locus was significantly associated with weight at 4, 9, and 12 months of age, height at 12 months of age, and chest circumference at 12 months of age in Chinese Holstein cattle. The weight of the TT genotype at 4, 9, and 12 months of age was significantly or extremely significantly higher than that of the GG genotype, with increases of 4.9 kg, 7.2 kg, and 9.7 kg, respectively (Tables 7 and 8). The height and chest circumference of the TT genotype at 12 months of age were extremely significantly higher than those of the GG genotype, with increases of 1.7 cm and 2.9 cm, respectively (Table 9). The phenotypic variance contributions of weight, height, and chest circumference at 12 months of age were 0.0069, 0.0147, and 0.0416, respectively.

[0085] Table 7 HNF4G Association analysis between genes and birth weight and weight at 3-6 months of age (least squares mean + standard error)

[0086] Note: * P <0.05, indicating significant differences; ** P <0.01, indicating that the difference is extremely significant. a 、 b and c Different superscripts in the same column indicate significant differences; A、C and B Different superscripts in the same column indicate extremely significant differences.

[0087] Table 8 HNF4G Association analysis between genes and weight at 7-12 months of age (least squares mean + standard error)

[0088] Note: * P <0.05, indicating significant differences; ** P <0.01, indicating that the difference is extremely significant. a 、 b and c Different superscripts in the same column indicate significant differences; A、C and B Different superscripts in the same column indicate extremely significant differences.

[0089] Table 9 HNF4G Association analysis between genes and body size at 9 and 12 months of age (least squares mean + standard error)

[0090] Note: * P <0.05, indicating significant differences;** P <0.01, indicating that the difference is extremely significant. a 、 b and c Different superscripts in the same column indicate significant differences; A、C and B Different superscripts in the same column indicate extremely significant differences.

[0091] Table 10 HNF4G Phenotypic variance and contribution rate of growth traits at gene rs32 SNP site

[0092] 3.2 Tests for additive, dominance, and substitution effects of alleles SAS 9.4 software was used to test the significance of SNP additive effects, dominance effects, and allele substitution effects for 24 growth traits and the genotypes of the 7 SNPs on the FRZB gene obtained in the 921 Chinese Holstein cattle. The basic calculation formula is as follows: a=(AA-BB) / 2; d=AB-(AA+BB) / 2; α=a+d(qp); Where a is the additive effect, d is the dominant effect, and α is the allele substitution effect; AA, AB, and BB are the least square means of the milk production traits of the corresponding genotypes; p is the frequency of allele A, and q is the frequency of allele B.

[0093] The results of the additive, dominance, and allele substitution effects are shown in Tables 11 and 12. The results showed that the rs32 SNP locus had significant or extremely significant additive and substitution effects on body weight at 4, 9, and 12 months of age, and had a significant effect on height and chest circumference at 12 months of age.

[0094] Table 11 HNF4G Results of tests on additive, dominant and substitution effects of gene alleles for weight traits

[0095] Note: * P <0.05, indicating significant differences; ** P <0.01, indicating that the difference is extremely significant.

[0096] Table 12 HNF4G Results of tests on additive, dominant and substitution effects of gene alleles on body size

[0097] Note: * P <0.05, indicating significant differences; ** P <0.01, indicating that the difference is extremely significant.

[0098] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. Use of a substance for detecting polymorphism or genotype of a SNP site in a cattle genome, characterized in that: The SNP site is the 123rd nucleotide of SEQ ID NO: 1, and the nucleotide type is G or T. The application is any of the following: A1) Use of the substance in detecting or assisting in detecting cattle weight; A2) Use of the substance in detecting or assisting in detecting high blood pressure in cattle; A3) Use of the substance in detecting or assisting in detecting breast girth of cattle; A4) Use of the substance in detecting or assisting in detecting SNP polymorphism or genotype; A5) Use of the substance in cattle breeding; A6) Use of the substance in the preparation of a product for detecting or assisting in detecting cattle weight; A7) Use of the substance in the preparation of a product for detecting or assisting in the detection of height in cattle; A8) Use of the substance in the preparation of a product for detecting or assisting in detecting bovine breast circumference; A9) Use of the substance in the preparation of a product for detecting or assisting in the detection of SNP polymorphism or genotype; A10) Use of the substance in preparing cattle breeding products.

2. The use according to claim 1, characterized in that The substance is any of the following: C1) a primer combination for amplifying a bovine genomic DNA fragment including the SNP site; C2) a PCR reagent containing the primer combination described in C1); C3) A kit containing the primer composition described in C1) or the PCR reagent described in C2).

3. A method for detecting or assisting in detecting cattle weight, cattle height and / or cattle chest circumference, characterized in that: The method comprises the following steps: detecting the genotype of the SNP site in claim 1 in the tested cattle, and detecting or assisting in detecting the cattle's weight, height and / or chest circumference according to the genotype.

4. A method for cattle breeding, characterized in that The method comprises detecting the genotype of the SNP site in claim 1 in the genome of the tested cattle, and selecting the tested cattle whose genotype of the SNP site is TT as a parent for breeding, wherein the TT is a homozygous type of the SNP site T.

5. A product containing a substance for detecting polymorphism or genotype of a SNP site in a cattle genome, characterized in that: The SNP site is the 123rd nucleotide of SEQ ID NO: 1, and the nucleotide type is T or G; the product is any of the following: B1) Products used to prepare for or assist in testing cattle weight; B2) Products used to prepare for or assist in the detection of cattle height; B3) Products used to prepare for or assist in testing the breast girth of cattle; B4) Products used to detect or assist in detecting SNP polymorphisms or genotypes; B5) Products used for cattle breeding.

6. The product according to claim 5, characterized in that The substance is any of the following: C1) a primer combination for amplifying a bovine genomic DNA fragment including the SNP site; C2) a PCR reagent containing the primer combination described in C1); C3) A kit containing the primer combination described in C1) or the PCR reagent described in C2).

7. The product according to claim 6, characterized in that The primer composition is any one of F1) to F3): F1), a primer set consisting of the single-stranded DNA shown in SEQ ID NO: 2 in the sequence listing and the single-stranded DNA shown in SEQ ID NO: 3 in the sequence listing; F2), a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 1 to 23 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having a nucleotide sequence of positions 387 to 411 of SEQ ID NO: 1 in the sequence listing; F3), a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 2 after one or more nucleotide substitutions and / or deletions and / or additions, and a single-stranded DNA having the same function as SEQ ID NO: 3 after one or more nucleotide substitutions and / or deletions and / or additions; F4), a primer set consisting of the single-stranded DNA shown in SEQ ID NO: 4 in the sequence listing and the single-stranded DNA shown in SEQ ID NO: 3 in the sequence listing; F5), a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 107 to 122 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having a nucleotide sequence of positions 387 to 411 of SEQ ID NO: 1 in the sequence listing; F6), a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 4 by substitution and / or deletion and / or addition of one or several nucleotides, and a single-stranded DNA having the same function as SEQ ID NO: 3 by substitution and / or deletion and / or addition of one or several nucleotides.

8. Application, characterized in that, The application is the application of the product described in any one of claims 5 to 7 in cattle breeding.

9. A DNA molecule, characterized in that One strand of the DNA molecule is SEQ ID NO:

1.

10. Use of DNA molecules, characterized in that The nucleotide sequence of one strand of the DNA molecule is SEQ ID NO: 1, and the application is any one of the following: M1) Use of the DNA molecule in detecting or assisting in detecting cattle weight; M2) Use of the DNA molecule in detecting or assisting in detecting high blood pressure in cattle; M3) Use of the DNA molecule in detecting or assisting in detecting breast circumference of cattle; M4) Use of the DNA molecule in detecting or assisting in detecting SNP polymorphism or genotype; M5) Use of the DNA molecule in cattle breeding; M6) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting cattle weight; M7) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting cattle height; M8) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting bovine breast circumference; M9) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting a polymorphism or genotype of a SNP; M10) Use of the DNA molecule in preparing cattle breeding products.

Images