CRISPR-Cas13d technology-based crRNA for detecting porcine circovirus type 3, kit and application

Abstract

The invention discloses crRNA for detecting porcine circovirus type 3 based on a CRISPR-Cas13d technology, a kit and application, and belongs to the technical field of molecular biology diagnos.Clinical positive PCV3 samples can be successfully detected, on-site visual detection of PCV3 can be achieved by combining RNA fluorescent reporter molecules for use, only a transilluminator needs to be used for irradiation in the detection process, the detection efficiency is high, and the detection cost is low. A detection result can be judged by observing whether an amplification product in a reaction system shows fluorescence or not. According to the method, the diagnosis cost and time are reduced, the result is visualized, and the method has important significance in improving the detection capability of the PCV3 level in the pig breeding industry and reducing the biological safety risk of the breeding farm.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology diagnostic technology, and specifically to crRNA, a kit, and applications for detecting porcine circovirus type 3 based on CRISPR-Cas13d technology. Background Art

[0002] Porcine circovirus type 3 (PCV3) is a novel circovirus. PCV3 infection is associated with a multifactorial disease syndrome in pigs, including abortion, myocarditis, systemic inflammation, congenital abnormalities, and growth retardation, resulting in significant economic losses for the pig industry. PCV3 infection, in particular, often exacerbates disease in immunosuppressed pigs, leading to increased mortality and economic losses. PCV3 exhibits strong adaptability and transmissibility, but its pathogenic mechanisms remain incompletely understood, making its diagnosis and prevention challenging.

[0003] Traditional PCV3 detection methods primarily include PCR and qPCR. Advanced detection technologies such as LAMP, nanoPCR, RAA, and dPCR have also been developed. However, current methods struggle to balance sensitivity, specificity, operational complexity, cost, and time. This requires a comprehensive approach encompassing effective surveillance, appropriate biosafety measures, timely vaccination, and accurate diagnostic techniques to distinguish between various pathogens. CRIPSR / Cas13d, as a new detection technology, offers feasibility, high specificity, high sensitivity, and reliability, and will enhance our monitoring and control of the virus. This is crucial for improving on-site diagnostic capabilities and enabling early detection and prevention.

[0004] In recent years, the CRISPR-Cas system has garnered widespread attention as an emerging tool for gene editing and nucleic acid detection. CRISPR-Cas13d, an RNA-targeting nuclease, boasts high specificity, minimal off-target effects, and powerful signal amplification. It accurately recognizes target RNA and triggers its "cis-cleavage" and "non-specific trans-cleavage" activities, enabling rapid nucleic acid detection. Compared to traditional detection methods, CRISPR-Cas13d-based detection technologies offer high sensitivity, low cost, and portability, making them particularly suitable for rapid on-site diagnosis.

[0005] Based on this, the present invention designs crRNA, kits and applications for detecting porcine circovirus type 3 based on CRISPR-Cas13d technology to solve the above problems. Summary of the Invention

[0006] In response to the above-mentioned shortcomings of the prior art, the present invention provides crRNA, kits and applications for detecting porcine circovirus type 3 based on CRISPR-Cas13d technology.

[0007] To achieve the above objectives, the present invention is implemented through the following technical solutions: A crRNA for detecting porcine circovirus type 3 based on CRISPR-Cas13d technology, wherein the nucleotide sequence of the crRNA is SEQ ID NO.10, SEQ ID NO.11 or SEQ ID NO.12.

[0008] In order to better achieve the purpose of the present invention, the present invention also provides a reagent for detecting porcine circovirus type 3 based on CRISPR-Cas13d technology, wherein the reagent contains the crRNA.

[0009] In order to better achieve the purpose of the present invention, the present invention also provides a CRISPR-Cas13d detection system for detecting porcine circovirus type 3, wherein the CRISPR-Cas13d detection system includes the crRNA or the reagent.

[0010] Furthermore, it also includes Cas13d protein, ssRNA fluorescent reporter probe, and upstream primers and downstream primers for recombinase polymerase nucleic acid amplification.

[0011] Furthermore, the sequence of the ssRNA fluorescent reporter probe is: 6-FAM-UUUUUU-BHQ1.

[0012] Furthermore, the upstream primer sequence is: 5'TAATACGACTCACTATAGGGAAGATTCCTCTTCGGGTACCAGATCGGATC3'; The downstream primer sequence is: 5'ACCCCATCACCCCGCAAAAATCACGCAAAC3'.

[0013] In order to better achieve the purpose of the present invention, the present invention also provides a kit for detecting porcine circovirus type 3 based on CRISPR-Cas13d technology, wherein the kit includes the crRNA or the reagent or the CRISPR-Cas13d detection system.

[0014] In order to better achieve the purpose of the present invention, the present invention also provides an application of crRNA for detecting porcine circovirus type 3 based on CRISPR-Cas13d technology in the preparation of a product for detecting porcine circovirus type 3.

[0015] Furthermore, the product for detecting porcine circovirus type 3 is a kit.

[0016] Furthermore, the kit also includes Cas13d protein, ssRNA fluorescent reporter probe, and upstream primers and downstream primers for recombinase polymerase nucleic acid amplification.

[0017] Compared to existing technologies, the present invention offers the following advantages: 1. It provides an on-site visualization kit for PCV3 detection based on RAA (recombinase polymerase amplification) and CRISPR-Cas13d technology. This kit offers advantages such as high specificity and sensitivity, simple operation, rapid detection, and visual results. It can successfully detect clinically positive PCV3 samples. In combination with an RNA fluorescent reporter, it enables on-site visualization of PCV3. The detection process requires only illumination using a transilluminator, and the result is determined by observing the fluorescence of the amplified product in the reaction system. Furthermore, the kit also supports quantitative detection using a qPCR instrument, enabling rapid determination of results within one hour.

[0018] 2. The detection method developed by this invention, based on RAA and CRISPR-Cas13d technology, can be used for on-site visual detection of PCV3. This will be of great significance for improving the detection capabilities of PCV3 levels in the pig farming industry and reducing biosafety risks on pig farms. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. Those skilled in the art can also derive other drawings based on these drawings without inventive effort.

[0020] Figure 1 The detection results of RAA amplification products of different RAA primer combinations are shown in Figure 2. M is the marker lane, and the rest are the lanes of RAA amplification products of different RAA primer combinations.

[0021] Figure 2 The target gene amplification results for constructing positive plasmids, M is the marker lane, 1 is the PCR negative lane, and 2 is the PCR product lane.

[0022] Figure 3 This is the fluorescence amplification graph for verification of Cas13d protein activity.

[0023] Figure 4 Amplification maps of different types of crRNA.

[0024] Figure 5 The results of Western-blot experiments are shown in Figure 2. M is the protein marker lane, 1 is the negative control lane, and 2 is the purified protein lane.

[0025] Figure 6 The figure shows the results of SDS-PAGE protein experiment, M is the protein marker lane, 1 is the negative control lane, and 2 is the purified protein lane.

[0026] Figure 7 This is the fluorescence amplification spectrum of the PCV3 detection system combining RAA and CRISPR-Cas13d technology. Positive is the positive control sample, Negative is the negative control sample, and 1-4 are test samples.

[0027] Figure 8 This is the visualization result of the PCV3 detection system combining RAA and CRISPR-Cas13d technology, showing the fluorescence of the product under UV / blue light conditions. PC is the positive control sample, NC is the negative control sample, and 1-4 are the test samples.

[0028] Figure 9 This is a specificity test diagram for the PCV3 detection system combining RAA and CRISPR-Cas13d technology.

[0029] Figure 10 This is a sensitivity test chart of the PCV3 detection system combining RAA and CRISPR-Cas13d technology. DETAILED DESCRIPTION

[0030] To make the purpose, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0031] Example 1. Design and synthesis of RAA primers Multiple PCV3 gene sequences were downloaded from GenBank and analyzed using MEGA 7.0 software. Highly conserved regions were identified, and three upstream and three downstream primers were designed. Nine primer pairs were synthesized through permutation and combination. Primer sequences are shown in Table 1. These primers were sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. RAA amplification experiments were then conducted using the same template to test the amplification efficiency of the nine primer pairs. Ultimately, the optimal primer pair was selected for subsequent experiments.

[0032] Table 1 Primer sequences 2. RAA amplification and RAA primer screening The RAA nucleic acid amplification kit from Hangzhou Zhongce Biotechnology Co., Ltd. was used. The primers listed in Table 1 were used to perform the RAA reaction using positive DNA (provided by the Biotechnology Center of Sichuan Agricultural University) as a template. The reaction system is shown in Table 2. The reaction procedure was: 37°C for 20 min. After the reaction was complete, 5 μL was taken for agarose gel electrophoresis. The results were as follows: Figure 1 , according to the amplification results, select the best primer pair: RAA-2F+2R.

[0033] Table 2 RAA reaction system 3. Construction of standard positive plasmid 2× Rapid Taq Master Mix was used to perform PCR amplification with positive DNA, and the upstream and downstream primers were RAA-2F / R. After the reaction, 1% agarose gel electrophoresis was performed to detect the amplification results and verify the success. The amplified product was purified using a universal DNA purification and recovery kit. The purified product was connected to pMD™19 (Simple). According to the DH5α instruction manual, the ligation product was transformed into DH5α competent cells. Finally, a single clone was picked and transferred to LB containing ampicillin resistance. The bacterial solution was verified by PCR, and the positive bacterial solution was used to extract the plasmid using a plasmid extraction kit. 10μL of plasmid was sent for sequencing to ensure that the recombinant plasmid was successfully constructed. Figure 2 The concentration of the plasmid was determined using a micro-UV-Vis spectrophotometer and used as the standard positive plasmid (pMD-19T-PCV3) and frozen for future use.

[0034] 4. Protein activity verification and crRNA screening 4.1 Target RNA Preparation The RAA amplification product was purified using a universal DNA purification and recovery kit and transcribed into target ssRNA. In vitro transcription was performed using a high-yield T7 RNA in vitro transcription kit at 37°C for 4 h. Excess DNA template was degraded using RNase-free DNase I, and then purified using a column-based RNA purification kit. After purification and concentration determination, the product was aliquoted and stored at -80°C.

[0035] 4.2 crRNA Preparation Each of the three gDNAs was mixed with an equal volume of the T7 promoter to a final concentration of 10 μM. The mixture was incubated in a 95°C metal bath for 10 minutes and then incubated at room temperature for 30 minutes. The product was transcribed into crRNA in vitro and purified using a column-based RNA purification kit. After purification and concentration determination, the aliquots were stored at -80°C. Primer sequences are shown in Table 3.

[0036] Table 3 gDNA and crRNA sequences 4.3 Protein activity verification and crRNA screening The 2×Cas13d buffer composition is as follows: 80 mM HEPES pH 7.1, 200 mM KCl, 20 mM MgCl2, and 10% glycerol. Prepare a 20 µL reaction using the components listed in Table 4.

[0037] Table 4 Cas13d protein activity verification system In the experiment, three control groups were set up to verify the necessity of each component of the reaction system: Cas13d protein, crRNA and ssRNA template were missing respectively, and RNase-free water was used to replace the missing components. The complete reaction system was named Reaction 1, and the reactions lacking Cas13d protein, crRNA and ssRNA template were named Reaction 2, Reaction 3 and Reaction 4 respectively. The fluorescence signal was detected using a fluorescence quantitative PCR instrument. The experimental results showed that only Reaction 1 produced a fluorescence signal, while no fluorescence values ​​were detected in the other reactions (Reaction 2, Reaction 3 and Reaction 4). Figure 3 ).

[0038] To screen the best crRNA, three different crRNAs were reacted under the same conditions, each reaction was repeated three times, and then the fluorescence value was read. The results showed that crRNA1 had the highest amplification efficiency ( Figure 4 ). Therefore, crRNA1 was selected as the optimal crRNA in subsequent experiments.

[0039] 5. Expression of EsCas13d Protein Dilute the purchased EsCas13d plasmid (pET28a-MH6-EsCas13d) dry powder. Transform the diluted EsCas13d plasmid into B21 competent cells. Plate onto solid culture plates containing kanamycin (Kana), incubate at 37°C, and screen for positive clones. Select positive clones for expansion. Inoculate a verified bacterial suspension into 300 ml of LB medium at a ratio of 1:100. Incubate on a 37°C incubator until the OD 600 nm value reaches 0.4-0.6. Add IPTG to a final concentration of 1 mM to induce protein expression. Adjust the temperature to 18°C ​​and continue incubation on a shaker at 180 rpm for 18 hours. Transfer the suspension to a 50 ml centrifuge tube and centrifuge at 10,000 rpm for 15 minutes at 4°C to collect the cell pellet. Resuspend the cell pellet in an equal volume of PBS and wash by centrifugation three times. Resuspend the concentrated bacteria to 30 ml with PBS, add lysozyme and protease inhibitor PMSF at a ratio of 1:100, and mix well. Use an ultrasonic probe (ф6) to ultrasonically disrupt the cells at 30% power, ultrasonically for 2 seconds, with an interval of 4 seconds, for a total of 40 minutes. Use a His-tag protein purification kit to purify and concentrate the protein in the disrupted cell lysate. The concentration of the purified protein sample was measured. The size and expression of the protein were detected by SDS-PAGE. Western Blot (protein blotting) was used for protein verification, and His-tag antibody was used as the primary antibody for detection. The SDS-PAGE and Western Blot verification results are shown as follows. Figure 5-6 shown.

[0040] 6. Establishment of a porcine circovirus type 3 detection method combining RAA and CRISPR-Cas13d technology and clinical sample testing 6.1. Establishment of detection method The crRNA (crRNA1) screened above was selected for the construction of the RAA-based CRISPR-Cas13d detection method. The RAA reaction was combined with the Cas13d verification system. The product after the first RAA reaction was added to the CRISPR-Cas13d reaction system, as shown in Table 5. The reaction system was 37°C, and the fluorescence value was read every 30 seconds for 60 cycles. The fluorescence signal was detected using a fluorescence quantitative PCR instrument. The experimental results are shown in Figure 5. Figure 7 shown.

[0041] Table 5 PCV3 detection system combining RAA and CRISPR-Cas13d technology 6.2 Visualization of Detection Methods After the reaction system is completed, it is placed in a metal bath for 30 minutes. After the reaction is completed, it is irradiated with a UV transilluminator and found to have fluorescence under blue light or UV light. In contrast, no fluorescence is observed in the negative control group (e.g. Figure 8 shown).

[0042] 6.3 Specificity of the detection method African swine fever virus (ASFV) samples were treated with rapid nucleic acid release agent (DNA type)-II or rapid nucleic acid release agent (RNA type)-II, and genomes of positive samples of porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), porcine epidemic diarrhea virus (PEDV), classical swine fever virus (CSFV), porcine Japanese encephalitis virus (JEV), porcine parvovirus (PPV) and porcine transmissible gastroenteritis (TGEV) (provided by the Biotechnology Center of Sichuan Agricultural University) were used to verify the specificity of the reaction system in combination with negative controls (without adding nucleic acid template). The results are as follows: Figure 9 As shown in the figure, only PCV3 was positive while the others were negative, indicating that the reaction system had good specificity.

[0043] 6.4. Sensitivity of the Detection Method To evaluate the sensitivity of the reaction system, the positive plasmid pMD-19T-gE with different dilution gradients was used as the template, and the template concentration per uL was 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 The results showed that the sensitivity of this method can reach 10 0 The number of copies / μL can still be visualized, and the experimental results are as follows Figure 10 shown.

[0044] 6.5 Clinical Sample Testing In addition to the positive control sample used in step 6.2, 20 additional clinical samples were tested for PCV3. The qPCR (Quantitative Real-Time Polymerase Chain Reaction) method, as specified in the national standard, served as a control. The test results showed that the positive rate was consistent with the national standard qPCR test results.

[0045] This invention provides an on-site visualization kit for PCV3 detection based on RAA (recombinase polymerase amplification) and CRISPR-Cas13d technology. It boasts high specificity and sensitivity, simple operation, rapid detection, and visual results. It can successfully detect clinically positive PCV3 samples. In combination with an RNA fluorescent reporter, it enables on-site visualization of PCV3. The detection process requires only illumination with a transilluminator, and the result is determined by observing the fluorescence of the amplified product in the reaction system. Furthermore, the kit also supports quantitative detection using a qPCR instrument, enabling rapid determination of results within one hour.

[0046] The detection method developed by this invention, based on RAA and CRISPR-Cas13d technology, can be used for on-site visual detection of PCV3. This will be of great significance for improving the detection capabilities of PCV3 levels in the pig farming industry and reducing biosafety risks on pig farms.

[0047] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements will not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A method for detecting crRNA of porcine circovirus type 3 based on CRISPR-Cas13d technology, characterized in that: The nucleotide sequence of the crRNA is SEQ ID NO.10, SEQ ID NO.11 or SEQ ID NO.

12.

2. A reagent for detecting porcine circovirus type 3 based on CRISPR-Cas13d technology, characterized in that The reagent contains the crRNA described in claim 1.

3. A CRISPR-Cas13d detection system for detecting porcine circovirus type 3, characterized in that: The CRISPR-Cas13d detection system includes the crRNA according to claim 1 or the reagent according to claim 2.

4. The CRISPR-Cas13d detection system for detecting porcine circovirus type 3 according to claim 3, characterized in that It also includes Cas13d protein, ssRNA fluorescent reporter probe, and upstream primers and downstream primers for recombinase polymerase nucleic acid amplification.

5. The CRISPR-Cas13d detection system for detecting porcine circovirus type 3 according to claim 4, characterized in that The sequence of the ssRNA fluorescent reporter probe is: 6-FAM-UUUUUU-BHQ1.

6. The CRISPR-Cas13d detection system for detecting porcine circovirus type 3 according to claim 4, characterized in that The upstream primer sequence is: 5'TAATACGACTCACTATAGGGAAGATTCCTCTTCGGGTACCAGATCGGATC3'; The downstream primer sequence is: 5'ACCCCATCACCCCGCAAAAATCACGCAAAC3'.

7. A kit for detecting porcine circovirus type 3 based on CRISPR-Cas13d technology, characterized in that: The kit comprises the crRNA according to claim 1 or the reagent according to claim 2 or the CRISPR-Cas13d detection system according to any one of claims 3 to 6.

8. An application of crRNA for detecting porcine circovirus type 3 based on CRISPR-Cas13d technology according to claim 1 in the preparation of a product for detecting porcine circovirus type 3.

9. The use according to claim 8, characterized in that The product for detecting porcine circovirus type 3 is a kit.

10. The use according to claim 9, characterized in that The kit also includes Cas13d protein, ssRNA fluorescent reporter probe, and upstream primers and downstream primers for recombinase polymerase nucleic acid amplification.

Images