Methods and compositions for treating non-ERK MAPK pathway inhibitor resistant cancers
By using BVD-523 to target cancer patients with specific markers, the resistance problem of BRAF and MEK inhibitors in BRAF mutant cancers was solved, and effective treatment and resistance reversal to refractory cancers were achieved, especially in BRAF600 mutation-positive melanomas showed significant resistance reversal effect.
Patent Information
- Application Number
- CN202510671199.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2016-05-20
- Filing Date
- 2017-05-22
- Publication Date
- 2025-08-19
AI Technical Summary
Existing BRAF and MEK inhibitors have poor initial responses and rapid progress due to intrinsic genetic heterogeneity in the treatment of BRAF mutant cancers, and are prone to obtaining drug resistance. New targeted agents are needed to inhibit multiple oncogenic pathway nodes and overcome the adaptability of the cancer genome.
Treatment of refractory or resistant cancers using BVD-523 or a pharmaceutically acceptable salt thereof is confirmed by identifying a patient population with a specific marker and administering an effective amount of the ERK inhibitor BVD-523, including the presence of markers such as switching between RAF isoforms, upregulation of receptor tyrosine kinase or NRAS signaling, reactivation of MAPK signaling, MEK activation mutation, amplification of mutant BRAF and upregulation of STAT3, and treatment with BVD-523 was confirmed.
Effectively inhibit RSK phosphorylation in cancer cells, delay or reverse the progress of cancer, especially in BRAF600 mutation-positive melanoma, it showed significant resistance reversal effect, and had significant anti-tumor activity in both in vitro and in vitro experiments.
Smart Images

Figure CN120501744A_ABST
Abstract
Description
[0001] This application is a divisional application of Chinese invention patent application No. 201780044255.X, filed on May 22, 2017, and entitled “Methods and compositions for treating non-ERK MAPK pathway inhibitor-resistant cancers”.
[0002] CROSS-REFERENCE TO RELATED APPLICATIONS
[0003] This application claims the benefit of U.S. patent application serial number 15 / 161,137, filed on May 20, 2016, which is a continuation-in-part of PCT International Application No. PCT / US2014 / 071749, filed on December 19, 2014, which claims the benefit of U.S. patent application serial number 61 / 919,551, filed on December 20, 2013, all of which are incorporated by reference in their entirety as if fully set forth herein. Technical Field
[0004] The present invention provides, inter alia, methods, pharmaceutical compositions, and kits for treating or ameliorating the effects of cancer in a subject that is refractory or resistant to non-ERK MAPK pathway inhibitor therapy.
[0005] Incorporation by Reference into the Sequence Listing
[0006] This application contains references to amino acid and / or nucleic acid sequences, which are filed concurrently herewith as a 351 KB Sequence Listing text file "0398850pct.txt" created on May 20, 2016. This Sequence Listing is hereby incorporated by reference in its entirety pursuant to 37 CFR §1.52(e)(5). Background Art
[0007] Drug inhibitors targeting components of the mitogen-activated protein kinase (MAPK) signaling pathway have shown clinical efficacy in a variety of cancers, particularly those harboring mutations in the BRAF protein kinase. Both RAF and MEK inhibitors are approved as single agents for advanced metastatic BRAF-mutant melanoma. The activity of BRAF and MEK inhibitors, alone or in combination, has been unpredictable in other cancers, with promising efficacy in BRAF-mutant thyroid and lung cancer and only modest activity in BRAF-mutant colorectal cancer.
[0008] As with other targeted therapies, the pattern of disease response to RAF and MEK inhibitors appears to be influenced by the intrinsic genetic heterogeneity present in the cancer to which the drugs are administered. For example, it has been shown that certain genetic alterations, including PTEN and other changes that activate the PI3K cell growth signaling pathway, can predict poor initial response and / or relatively rapid progression in BRAF mutant melanomas treated with the RAF inhibitor vemurafenib. Similarly, direct mutations in the locus of the MEK gene appear to occur in tumors that progress after treatment with BRAF, MEK, or a combination of drugs. Several other examples from RAS and RAF gene amplification and splicing mutations suggest that acquired drug resistance can occur when oncogenic pleiotropy encounters the selective pressure of targeted drug therapy.
[0009] In view of the foregoing, there is a need for new targeted agents that would ideally inhibit multiple nodes of oncogenic pathways and also be effective in combination by inducing a selective pressure burden that exceeds the adaptive capacity of various cancer genomes. The present application is intended to meet these and other needs. SUMMARY OF THE INVENTION
[0010] One embodiment of the present invention is a method for treating or ameliorating the effects of cancer in a subject that is refractory or resistant to non-ERK MAPK pathway inhibitor therapy. The method comprises administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
[0011] Another embodiment of the present invention is a method for treating or ameliorating the effects of cancer in a subject. The method comprises:
[0012] (a) identifying a patient having a cancer that has become refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or BRAF and MEK inhibitor therapy; and
[0013] (b) administering to the subject having the refractory or resistant cancer an effective amount of an ERK inhibitor, which is BVD-523 or a pharmaceutically acceptable salt thereof.
[0014] Another embodiment of the present invention is a method for treating or ameliorating the effects of cancer in a subject that is refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or both. The method comprises administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
[0015] Another embodiment of the present invention is a method for identifying a subject with cancer who would benefit from therapy with an ERK inhibitor. The method comprises:
[0016] (a) obtaining a biological sample from a subject; and
[0017] (b) screening the sample to determine whether the subject has one or more of the following markers:
[0018] (i) Switching between RAF isoforms,
[0019] (ii) upregulation of receptor tyrosine kinase (RTK) or NRAS signaling,
[0020] (iii) reactivation of mitogen-activated protein kinase (MAPK) signaling,
[0021] (iv) the presence of MEK activating mutations,
[0022] (v) amplification of mutant BRAF,
[0023] (vi) Upregulation of STAT3,
[0024] (vii) mutations in the allosteric pocket of MEK that directly block inhibitor binding to MEK or result in constitutive MEK activity,
[0025] Wherein the presence of one or more of said markers confirms that the subject's cancer is refractory or resistant to BRAF and / or MEK inhibitor therapy, and the subject would benefit from therapy with an ERK inhibitor, said ERK inhibitor being BVD-523 or a pharmaceutically acceptable salt thereof.
[0026] Another embodiment of the present invention is a pharmaceutical composition for treating or ameliorating the effects of cancer in a subject that is refractory or resistant to non-ERK MAPK pathway therapies. The composition comprises a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
[0027] Another embodiment of the present invention is a kit for treating or ameliorating the effects of cancer in a subject that is refractory or resistant to non-ERK MAPK pathway therapies. The kit comprises any pharmaceutical composition according to the present invention, packaged together with instructions for use thereof.
[0028] Another embodiment of the present invention is a method for inhibiting phosphorylation of RSK in cancer cells that are refractory or resistant to non-ERK MAPK pathway inhibitors. The method comprises contacting the cancer cells with an effective amount of BVD-523, or a pharmaceutically acceptable salt thereof, for a period of time sufficient to inhibit RSK phosphorylation in the cancer cells.
[0029] Another embodiment of the present invention is a method of treating a subject having unresectable or metastatic BRAF600 mutation-positive melanoma comprising administering to the subject 600 mg BID of BVD-523 or a pharmaceutically acceptable salt thereof.
[0030] Another embodiment of the present invention is a composition for treating a subject with unresectable or metastatic BRAF600 mutation-positive melanoma, the composition comprising 600 mg of BVD-523 or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable carrier, adjuvant, or vehicle. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0032] Figure 1A-1C Shown is the progress of a dose escalation study in a human malignant melanoma cell line (A375 cells) at month 1. The various treatments (trametinib (type 2 MEK inhibitor), dabrafenib (BRAF inhibitor), and BVD-523 (ERK1 / 2 inhibitor)) are marked as indicated.
[0033] Figure 2A-2H Results of a proliferation assay are shown, tracking changes in sensitivity to increasing agents over the first month. The various treatments (trametinib, dabrafenib, BVD-523, and paclitaxel) are indicated by labels at the top of the graph. The captions on the right side of the graph indicate the various cell types generated in the dose escalation study. For example, "dabrafenib" refers to cells that have been treated with the highest dose of dabrafenib since month 1 of the dose escalation study. Parent refers to control cells that were not treated with the drug. Figure 2A 、 Figure 2C and Figure 2G Normalized to the control, and Figure 2D 、 Figure 2F and Figure 2H Displays the raw data.
[0034] Figures 3A-3D Shown is the progress of the dose escalation study in A375 cells at month 2. The various treatments (trametinib, dabrafenib, and BVD-523) are indicated as labeled.
[0035] Figures 4A-4H Results of a proliferation assay are shown, tracking changes in sensitivity to increasing agents at month 2. The various treatments (trametinib, dabrafenib, BVD-523, and paclitaxel) are indicated by labels at the top of the graph. The captions on the right side of the graph indicate the various cell types generated in the dose escalation study. For example, "dabrafenib" refers to cells that have been treated with the highest dose of dabrafenib starting at month 2 of the dose escalation study. Parent refers to control cells that were not treated with the drug. Figure 4A 、 Figure 4C and Figure 4G Normalized to the control, and Figure 4D 、 Figure 4F and Figure 4H Displays the raw data.
[0036] Figures 5A-5H Show only from Figures 4A-4H Data for parental and BVD-523 cell lines. Treatments (trametinib, dabrafenib, BVD-523, and paclitaxel) are indicated. Figure 5A 、 Figure 5C and 5G Normalized to the control, and Figure 5D 、 Figure 5F and Figure 5H Displays the raw data.
[0037] Figures 6A-6D Shown is the progress of a dose escalation study in a human malignant cell line (A375 cells) at month 3. The various treatments (trametinib, dabrafenib, and BVD-523) are indicated by the labels.
[0038] Figure 7 is a histogram showing the results of a proliferation assay applied to cells grown in DMSO control wells from a dose escalation assay.
[0039] Figures 8A-8D This is a set of line graphs showing proliferation assays at month 3 of the study. The various treatments (trametinib, dabrafenib, BVD-523, and paclitaxel) are indicated by labels at the top of the graph. The captions on the right side of the graph indicate the various cell types generated in the dose-escalation study. For example, "dabrafenib" refers to cells treated with the highest dose of dabrafenib starting at month 3 of the dose-escalation study. Parental refers to untreated control cells.
[0040] Figures 9A-9D Show only from Figures 8A-8D Parental, dabrafenib, and BVD-523 cell line data.
[0041] Figure 10A is a dose matrix showing the % inhibition of trametinib / dabrafenib combination in A375 cells using Alamar Blue cell viability assay. Figure 10B is a dose matrix showing overdose of the trametinib / dabrafenib combination over Bliss. Figure 10C and Figure 10D Shown are the % viability of dabrafenib and trametinib single-agent treatments in A375 cells relative to DMSO-only treated controls using the Alamar Blue cell viability assay. Figure 10EShown are the % viability of dabrafenib and trametinib combination treatment in A375 cells relative to DMSO-only treated controls using the Alamar Blue cell viability assay.
[0042] Figure 11A is a dose matrix showing the % inhibition of the trametinib / dabrafenib combination in A375 cells using the CellTiter-Glo cell viability assay. Figure 11B is a dose matrix showing overdose of the trametinib / dabrafenib combination over Bliss. Figure 11C and Figure 11D Shown are the % viability of dabrafenib and trametinib single-agent treatments in A375 cells relative to DMSO-only controls using the CellTiter-Glo cell viability assay. Figure 11E Shown are the % viability of dabrafenib and trametinib combination treatment in A375 cells relative to DMSO only treated controls using the CellTiter-Glo cell viability assay.
[0043] Figure 12A is a dose matrix showing the % inhibition of the BVD-523 / dabrafenib combination in A375 cells using the Alamar Blue cell viability assay. Figure 12B is a dose matrix showing the overdose of the BVD-523 / dabrafenib combination over Bliss. Figure 12C and Figure 12D Shown are the % viability of dabrafenib and BVD-523 single agent treatments in A375 cells relative to DMSO only treated controls using the Alamar Blue cell viability assay. Figure 12E Shown are the % viability of dabrafenib and BVD-523 combination treatment in A375 cells relative to DMSO-only treated controls using the Alamar Blue cell viability assay.
[0044] Figure 13A is a dose matrix showing the % inhibition of the BVD-523 / dabrafenib combination in A375 cells using the CellTiter-Glo cell viability assay. Figure 13B is a dose matrix showing the overdose of the BVD-523 / dabrafenib combination over Bliss. Figure 13C and Figure 13D Shown are the % viability of A375 cells using the CellTiter-Glo cell viability assay relative to controls treated with DMSO only, dabrafenib, and BVD-523 single agent treatments. Figure 13EShown are the % viability of dabrafenib and BVD-523 combination treatment in A375 cells relative to DMSO-only treated controls using the CellTiter-Glo cell viability assay.
[0045] Figure 14A is a dose matrix showing the % inhibition of trametinib / BVD-523 combination in A375 cells using Alamar Blue cell viability assay. Figure 14B is a dose matrix showing excess of the trametinib / BVD-523 combination over Bliss. Figure 14C and Figure 14D Shown are the % viability of A375 cells using the Alamar Blue cell viability assay relative to DMSO-only controls, BVD-523 and trametinib single-agent treatments. Figure 14E Shown are the % viability of BVD-523 and trametinib combination treatment in A375 cells relative to DMSO-only treated controls using the Alamar Blue cell viability assay.
[0046] Figure 15A is a dose matrix showing the % inhibition of the trametinib / BVD-523 combination in A375 cells using the CellTiter-Glo cell viability assay. Figure 15B is a dose matrix showing excess of the trametinib / BVD-523 combination over Bliss. Figure 15C and Figure 15D Shown are the % viability of A375 cells using the CellTiter-Glo cell viability assay relative to DMSO-only controls, BVD-523, and trametinib single-agent treatments. Figure 15E Shown are the % viability of BVD-523 and trametinib combination treatment in A375 cells relative to DMSO-only treated controls using the CellTiter-Glo cell viability assay.
[0047] Figures 16A-16D A set of images showing Western blot analysis of MAPK signaling in A375 cells after 4 hours of treatment with various concentrations (in nM) of BVD 523, dabrafenib (Dab), and trametinib (Tram). Unless otherwise indicated, 40 μg of total protein was loaded per lane. In this experiment, duplicate samples were collected. Figure 16A and Figure 16B Results from duplicate samples are shown. Figure 16C and Figure 16D The results of duplicate samples are also shown. Figure 16A and Figure 16BIn the , pRSK1 had a relatively weak signal in A375 cells compared to the other markers. A different pRSK1-S380 antibody from CellSignaling (Cat. No. 11989) was tested but did not give a detectable signal (data not shown). Figure 16C and Figure 16D Among them, pCRAF-338 gave the smallest signal.
[0048] Figures 17A-17D A set of images showing Western blot analysis of MAPK signaling in a human colorectal cancer cell line (HCT116 cells) after 4 hours of treatment with various concentrations (in nM) of BVD-523, dabrafenib (Dab), and trametinib (Tram). Unless otherwise stated, 40 μg of total protein was loaded per lane. In this experiment, duplicate samples were collected. Figure 17A and Figure 17B Results from duplicate samples are shown. Figure 17C and Figure 17D The results of duplicate samples are also shown. Figure 17A and Figure 17B In HCT116 cells, pRSK1 levels appeared to be very low and Figure 17C and 17D The pCRAF-338 signal was also very weak.
[0049] Figures 18A-18D A set of images showing Western blot analysis of cell cycle and apoptosis signaling in A375 melanoma cells after 24 hours of treatment with various concentrations (in nM) of BVD-523 ("BVD523"), trametinib ("tram"), and / or dabrafenib ("Dab") as indicated. Unless otherwise indicated, 50 μg of total protein was loaded per lane. In this experiment, duplicate samples were collected. Figure 18A and Figure 18B Results from duplicate samples are shown. Figure 18C and Figure 18D The results of duplicate samples are also shown. Figure 18A and Figure 18B In the ELISA, there is no clear band corresponding to the size of cleaved PARP (89 kDa).
[0050] Figure 19BVD-523 has been shown to treat acquired resistance to targeted drugs in vivo. The patient-derived line, ST052C, was isolated from a BRAFV600E melanoma patient who progressed after 10 months of treatment with MAPK pathway-directed therapy. Ex vivo, ST052C exhibited acquired cross-resistance to dabrafenib at 50 mg / kg daily. Furthermore, BVD-523 was effective in ST052C as a single agent at 100 mg / kg daily.
[0051] Figure 20 is a flow chart showing the dose escalation protocol used herein.
[0052] Figure 21 A schematic diagram of the mitogen-activated protein kinase (MAPK) pathway is shown.
[0053] Figures 22A-22E Results of a single-agent proliferation assay are shown. Figure 22A )、SCH772984( Figure 22B ), dabrafenib ( Figure 22C ), trametinib ( Figure 22D ) and paclitaxel ( Figure 22E ) treatment proliferation results.
[0054] Figures 23A-23O Results are shown for the combination of BVD-523 and dabrafenib. Figure 23A A dose matrix showing the inhibition (%) of the combinations in RKO parental cells is shown. Figure 23B-23C Shows Figure 23A Results of the combined single-agent proliferation assays. Figure 23D Shows Figure 23A The combination of Loewe is excessive, and Figure 23E Shows Figure 23A Bliss overdose in the mid-combination. Figure 23F A dose matrix showing inhibition (%) of the combination in RKO MEK1 (Q56P / +)-clone 1 cells is shown. Figure 23G-23H Shows Figure 23F Results of the combined single-agent proliferation assays. Figure 23I Shows Figure 23F The combination of Loewe is excessive, and Figure 23J Shows Figure 23F Bliss overdose in the mid-combination. Figure 23K A dose matrix showing inhibition (%) of the combination in RKO MEK1 (Q56P / +)-clone 2 cells is shown. Figure 23L-23M Shows Figure 23K Results of the combined single-agent proliferation assays. Figure 23N Shows Figure 23K The combination of Loewe is excessive, and Figure 23O Shows Figure 23K Bliss overdose in the mid-combination.
[0055] Figures 24A-24O Results are shown for the combination of SCH772984 and dabrafenib. Figure 24A A dose matrix showing the inhibition (%) of the combinations in RKO parental cells is shown. Figure 24B-Figure 24C Shows Figure 24A Results of the combined single-agent proliferation assays. Figure 24D Shows Figure 24A The combination of Loewe is excessive, and Figure 24E Shows Figure 24A Bliss overdose in the mid-combination. Figure 24F A dose matrix showing inhibition (%) of the combination in RKO MEK1 (Q56P / +)-clone 1 cells is shown. Figure 24G-24H Shows Figure 24F Results of the combined single-agent proliferation assays. Figure 24I Shows Figure 24F The combination of Loewe is excessive, and Figure 24J Shows Figure 24F Bliss overdose in the mid-combination. Figure 24K A dose matrix showing inhibition (%) of the combination in RKO MEK1 (Q56P / +)-clone 2 cells is shown. Figure 24L-24M Shows Figure 24K Results of the combined single-agent proliferation assays. Figure 24N Shows Figure 24K The combination of Loewe is excessive, and Figure 24O Shows Figure 24K Bliss overdose in the mid-combination.
[0056] Figures 25A-25O Results are shown for the combination of trametinib and dabrafenib. Figure 25A A dose matrix showing the inhibition (%) of the combinations in RKO parental cells is shown. Figure 25B-Figure 25C Shows Figure 25A Results of the combined single-agent proliferation assays. Figure 25D Shows Figure 25A The combination of Loewe is excessive, and Figure 25E Shows Figure 25A Bliss overdose in the mid-combination. Figure 25F A dose matrix showing inhibition (%) of the combination in RKO MEK1 (Q56P / +)-clone 1 cells is shown. Figure 25G-25H Shows Figure 25FResults of the combined single-agent proliferation assays. Figure 25I Shows Figure 25F The combination of Loewe is excessive, and Figure 25J Shows Figure 25F Bliss overdose in the mid-combination. Figure 25K A dose matrix showing inhibition (%) of the combination in RKO MEK1 (Q56P / +)-clone 2 cells is shown. Figure 25L-25M Shows Figure 25K Results of the combined single-agent proliferation assays. Figure 25N Shows Figure 25K The combination of Loewe is excessive, and Figure 25O Shows Figure 25K Bliss overdose in the mid-combination.
[0057] Figure 26A The Lowe volumes of the combinations tested are shown. Figure 26B The Bliss volumes of the combinations tested are shown. Figure 26C Synergy scores for the tested combinations are shown.
[0058] Figures 27A-27I Shown are changes in MAPK and effector pathway signaling in MEK acquired resistance. Isogenic RKO parental and MEK1(Q56P / +) cells were treated with compounds for 4 or 24 hours and then immunoblotted with the indicated antibodies. Dabrafenib is a BRAF inhibitor, and trametinib is a MEK inhibitor. Figure 27A Increased signaling in RKO MEK1 (Q56P / +) cells is shown. Figure 27B-Figure 27C Shown are the results of a 4-hour treatment in Experiment 1 (see Example 7) in RKO parental (27B) and RKO MEK1 (Q56P / +) (27C) cells. Figure 27D-Figure 27E Shown are the results of a 4-hour treatment in Experiment 2 (see Example 7) in RKO parental (27D) and RKO MEK1 (Q56P / +) (27E) cells. Figure 27F-27G Shown are the results of a 4-hour treatment in Experiment 2 (see Example 7) in RKO parental (27F) and RKO MEK1 (Q56P / +) (27G) cells. Figures 27H-27I A summary of the results in RKO parental (27H) and RKO MEK1 (Q56P / +) (27I) cells is shown.
[0059] Figures 28A-28E Results are shown for the combination of BVD-523 and SCH772984. Figure 28A A dose matrix showing inhibition (%) of the combinations in A375 cells is shown. Figure 28B-Figure 28C Shows Figure 28A Results of the combined single-agent proliferation assays. Figure 28D Shows Figure 28A An excess of Loewe in the mix. Figure 28E Shows Figure 28A Bliss overdose in the mid-combination.
[0060] Figures 29A-29F Shown is the discovery and characterization of the novel ERK1 / 2 inhibitor BVD-523 (ulixertinib). Figure 29A BVD-523 was shown to inhibit ERK2 in a reversible ATP-competitive manner. This was demonstrated by inhibition of the IC of ERK2 with increasing ATP concentrations. 50 The linear increase of the value is demonstrated, e.g. Figure 29B shown. Figure 29C Representative plots of dose-response curves are shown. Figure 29D Shows the IC 50 Plotting over time. Figure 29E Shown is the binding of BVD-523 to ERK2 and phospho-ERK2 (pERK2) compared to the negative control protein p38. Figure 29F Shown is the binding of BVD-523 to ERK2 compared to the ERK inhibitors SCH772984 and pyrazolylpyrrole.
[0061] Figures 30A-30D BVD 523 was shown to inhibit cell proliferation and enhance caspase 3 and caspase 7 activities in vitro. Figure 30A BVD-523 was shown to exhibit preferential activity in cells harboring MAPK pathway mutations, as defined by the presence of mutations in RAS family members and RAF. Figure 30B As shown, BVD-523 blocks sensitive cell lines in the G1 phase of the cell cycle. Figure 30C It was shown that BVD-523 induced a concentration- and time-dependent increase in caspase activity in A375, WM266, and LS411N cancer cell lines after 72 hours of exposure. Figure 30D The MAPK pathway and effector proteins are shown to be regulated by BRAF V600E - mutant A375 cells were regulated by acute (4 h) and prolonged (24 h) BVD-523 treatment.
[0062] Figures 31A-31C The antitumor activity of BVD-523 in vivo was demonstrated. Figure 31A )A375 and( Figure 31B ) inhibited tumor growth in Colo205 cell line xenograft models ( aP < 0.0001, compared with vehicle control; CPT-11 was administered only on days 14 and 18). Abbreviations: BID, twice daily; CMC, carboxymethylcellulose; QD, daily; Q4D, every 4 days. Figure 31C It was shown that in Colo205 xenografts, increased ERK1 / 2 phosphorylation correlated with BVD-523 concentration.
[0063] Figure 32A The signaling effects of ERK1 / 2 inhibitors are shown. Using RPPA, the effects on proteins were measured in cell lines (A375, AN3Ca, Colo205, HCT116, HT29, and MIAPaca2) after treatment with the ERK1 / 2 inhibitors BVD-523 (BVD), Vx11e (Vx), GDC-0994 (GDC), or SCH722984 (SCH). Figure 32B The ERK inhibitors BVD-523, GDC-0994, and Vx11e showed differential effects on phospho-ERK (ERK 1 / 2 T202 Y204) compared to SCH722984; phospho-RSK (p90RSK 380) and cyclin D1 were inhibited by the tested ERK inhibitors. Abbreviations: BRAFi, BRAF inhibitor; MEKi, MEK inhibitor. Figure 32C Shown are western blot assays of cellular and nuclear fractions from the RKO cell line after treatment with BVD-523, trametinib, SCH722984, or dabrafenib. Histone H3 (a nuclear-localized protein) and HSP90 (a cytoplasmic-localized protein) were included as positive controls to confirm that the nuclear and cytoplasmic fractions were appropriately enriched; the nuclear fraction had high H3 and the cytoplasmic fraction had higher HSP90.
[0064] Figure 33 Shown are cell line-dependent changes in phospho-ATK levels exhibited by the ERK inhibitors BVD-523, Vx11, GDC-0994, and SCH772984 (SCH). Abbreviation: DMSO, dimethyl sulfoxide.
[0065] Figures 34A-34D BVD-523 was shown to be active in a model of resistance to BRAF / MEK inhibition. V600E The appearance of resistance to BVD-523, dabrafenib, or trametinib in A375 cells. A strict set of "criteria" was applied to determine when the dose could be increased to ensure that the kinetics of resistance acquisition were comparable between treatments. See Example 1. 50 Each point on the plotted line represents a medium change or cell split. Figure 34AAdapting cells to grow in the presence of BVD-523 was shown to be more challenging than with dabrafenib or trametinib. Figure 34B BVD-523 sensitivity was shown to be retained in A375 cells cultured to acquire resistance to combined BRAF (dabrafenib) + MEK (trametinib) inhibition. Figure 34C Cells were treated with compounds for 96 h and used Assessing activity. Q56P Endogenous heterozygous knock-in of BRAF, which is cross-resistant to BRAF (dabrafenib) and MEK (trametinib) inhibitors V600E BVD-523 activity was retained in RKO cells. Figure 34D Shows BRAK V600E -BVD-523 inhibition of pRSK in the mutant cell line RKO in MEK1 Q56P The presence of MEK1 is maintained Q56P Conferring resistance to MEK and BRAF inhibition. Knockdown of the KRAS mutant allele into the SW48 cell line significantly reduced sensitivity to the MEK inhibitors trametinib and selumetinib, while preserving relative sensitivity to BVD-523.
[0066] Figure 35A Figure 2 shows the in vivo activity of BVD-523 in xenografts from patients who relapsed on vemurafenib. Mean tumor volumes (± SEM) are shown for BVD-523 100 mg / kg BID alone, dabrafenib 50 mg / kg BID alone, and BVD-523 100 mg / kg BID plus dabrafenib 50 mg / kg BID. Abbreviations: BID, twice daily; SEM, standard error of the mean.
[0067] Figures 36A-36D The benefit of combined BVD-523 and BRAF inhibition was shown. Figure 36A-Figure 36B The initial tumor volume was 75-144 mm 3 A375 BRAF V600E In a xenograft model of a β-mutant melanoma cell line, the combination of BVD-523 and dabrafenib demonstrated superior antitumor activity compared to treatment with either agent alone. Figure 36C-Figure 36D showed that the tumor volume was larger (700-800mm 3 ). For each study, mean tumor growth (left panel) and Kaplan-Meier survival (right panel) are plotted. Abbreviations: BID, twice daily; QD, once daily.
[0068] Figure 37A It is shown that in SW48 colorectal cells engineered with a KRAS allele, the response to paclitaxel is unchanged compared to controls. Figure 37B Figure 3 shows the combinatorial interaction between BVD-523 and vemurafenib, evaluated using the Loewe Additivity and Bliss Independence models using an 8 × 10 concentration matrix and analyzed with Horizon's Chalice, Bioinformatics Software. Chalice identifies potential synergistic interactions by displaying the calculated excess inhibition exceeding that expected for additive effects in the dose matrix as a heat map and by reporting a quantitative "synergy score" based on the Loewe model. The results suggest that the interaction between BVD-523 and vemurafenib is at least additive and, in some cases, potent in BRAF-bearing cells. V600E The synergistic effect was observed in the mutant melanoma cell lines. Figure 37C showed that the combination of BVD-523 and dabrafenib significantly delayed the onset of BRAF in A375 V600E The onset of acquired resistance in melanoma cells was assessed in response to increasing concentrations of dabrafenib alone or in combination with BVD-523 or trametinib. Strict criteria were applied regarding when the dose could be increased to ensure that the kinetics of adaptation were comparable between treatments. See Example 1.
[0069] Figure 38 Figure 3. BVD-523 inhibits PMA-stimulated RSK1 / 2 phosphorylation in human whole blood. The mean of the BVD-523 concentration data set is indicated by (-). For each concentration of BVD-523, n = 20. Abbreviations: PBMC, peripheral blood mononuclear cells; RSK, ribosomal S6 kinase.
[0070] Figure 39A Steady-state BVD-523 pharmacokinetics (cycle 1, day 15) are shown. The red dashed line indicates the EC 50 200 ng / mL HWB. Abbreviations: AUC, area under the curve; BID, twice daily; C max , maximum concentration; EC 50 , 50% maximal effective concentration; HWB, human whole blood; SD, standard deviation. Figure 39B Pharmacodynamic inhibition of ERK phosphorylation by BVD-523 in human whole blood is shown. Abbreviations: BID, twice daily; pRSK, phospho-RSK; RSK, ribosomal S6 kinase.
[0071] Figure 40AShown are the best radiographic responses in patients treated with BVD-523. Included are all patients with a disease measured by RECIST v1.1 who received >1 dose of study treatment and had >1 tumor assessment during treatment (25 / 27; 2 who did not receive two scans of the target lesions). Response is measured as the sum of the longest diameter of each target lesion and the change from baseline. The dose shown is the dose the patient received when responding. The dotted line represents the threshold value for partial response according to RECIST v1.1. Abbreviations: CRC, colorectal cancer; NET, neuroendocrine tumor; NSCLC, non-small cell lung cancer; NSGCT, non-seminomatous germ cell tumor; PNET, pancreatic NET; PTC, papillary thyroid carcinoma; RECIST v1.1, response evaluation criteria for solid tumors version 1.1; SLD, sum of the longest diameters. Figure 40B Shown is a computed tomography scan of a confirmed partial response in a 61-year-old patient with BRAF-mutant melanoma treated with BVD-523.
[0072] Figure 41 Tumor response and tumor progression are shown. A swimmer plot of tumor response, tumor progression, and treatment duration for patients evaluable for BVD-523 treatment is shown. The origin of the vertical axis corresponds to the randomization date or reference start date. Analysis cutoff date: December 1, 2015. Abbreviation: BID, twice daily. Detailed Description of the Invention
[0073] One embodiment of the present invention is a method for treating or ameliorating the effects of cancer in a subject that is refractory or resistant to non-ERK MAPK pathway inhibitor therapy. The method comprises administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
[0074] As used herein, the terms "treat," "treat," "treat" and grammatical variations thereof refer to subjecting an individual subject to a procedure, regimen, process or remedy in which a physiological response or outcome is desired in the subject (e.g., a patient). In particular, the methods and compositions of the present invention can be used to slow the development of disease symptoms or delay the onset of a disease or condition, or to halt the progression of disease development. However, because every treated subject may not respond to a particular treatment regimen, regimen, process or remedy, treatment does not require that a desired physiological response or outcome be achieved in every subject or subject population (e.g., a patient population). Thus, a given subject or subject population (e.g., a patient population) may fail to respond or respond inadequately to treatment.
[0075] As used herein, the terms "ameliorate," "alleviate," and grammatical variations thereof refer to a reduction in the severity of disease symptoms in a subject.
[0076] As used herein, a "subject" is a mammal, preferably a human. In addition to humans, mammals encompassed within the scope of the present invention include, for example, farm animals, domestic animals, laboratory animals, and the like. Some examples of farm animals include cows, pigs, horses, goats, and the like. Some examples of domestic animals include dogs, cats, and the like. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, and the like.
[0077] In the present invention, BVD-523 corresponds to the compound according to formula (I) and its pharmaceutically acceptable salts:
[0078]
[0079] BVD-523 can be synthesized according to disclosed methods, such as those described in U.S. Patent No. 7,354,939. Enantiomers of BVD-523 and racemic mixtures of the two enantiomers are also included within the scope of the present invention. BVD-523 is an ERK1 / 2 inhibitor whose mechanism of action is believed to be unique and different from the pyrimidine structure used by certain other ERK1 / 2 inhibitors (e.g., SCH772984) and Hatzivassiliou et al. (2012). For example, other ERK1 / 2 inhibitors (e.g., SCH772984) inhibit ERK autophosphorylation (Morris et al., 2013), while BVD-523 allows ERK autophosphorylation while still inhibiting ERK. (See, e.g., FIG18 ).
[0080] As used herein, the words "resistant" and "refractory" are used interchangeably. Being "resistant" to a non-ERK MAPK pathway inhibitor therapy means that the non-ERK MAPK inhibitor has reduced efficacy in treating the cancer.
[0081] As used herein, "non-ERK MAPK inhibitors" refers to any substance that reduces the activity, expression or phosphorylation of proteins or other members of the MAPK pathway (which results in a decrease in cell growth or an increase in cell death), with the exception of ERK1 / 2 inhibitors. As used herein, "ERK1 / 2 inhibitors" refers to those substances that (i) directly interact with ERK1 and / or ERK2, for example by binding to ERK1 / 2 and (ii) reduce the expression or activity of ERK1 and / or ERK2 protein kinases. Thus, inhibitors that act upstream of ERK1 / 2, such as MEK inhibitors and RAF inhibitors, are not ERK1 / 2 inhibitors according to the present invention (but they are non-ERK MAPK inhibitors). Non-limiting examples of ERK1 / 2 inhibitors according to the present invention include AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), BVD-523 (BioMed Valley Discoveries, Inc.), SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), pharmaceutically acceptable salts thereof, and combinations thereof.
[0082] An overview of the mammalian MAPK cascade is shown in Figure 21 The MAPK pathway is reviewed in, for example, Akinleye et al., 2013. In brief, Figure 21 The ERK1 / 2 module in (light purple box), the MAPK 1 / 2 signaling cascade is activated by ligand binding to receptor tyrosine kinases (RTKs). Activated receptors recruit and phosphorylate the adaptor proteins Grb2 and SOS, which then interact with the membrane-bound GTPase Ras and cause its activation. In its activated GTP-bound form, Ras recruits and activates RAF kinases (A-RAF, B-RAF, and C-RAF / RAF-1). Activated RAF kinases activate MAPK 1 / 2 (MKK1 / 2), which in turn catalyze the phosphorylation of threonine and tyrosine residues in the activation sequence Thr-Glu-Tyr of ERK1 / 2. Regarding the JNK / p38 module ( Figure 21Yellow box in the figure), upstream kinases MAP3K, such as MEKK1 / 4, ASK1 / 2 and MLK1 / 2 / 3, activate MAP2K3 / 6 (MKK3 / 6), MAP2K4 (MKK4) and MAP2K7 (MKK7). These MAP2Ks then activate JNK protein kinases, including JNK1, JNK2 and JNK3, as well as p38α / β / γ / δ. To perform their functions, JNK activates several transcription factors, including c-Jun, ATF-2, NF-ATc1, HSF-1 and STAT3. About the ERK5 module ( Figure 21 The kinases upstream of MAP2K5 (MKK5) are MEKK2 and MEKK3. The best-characterized downstream target of MEK5 is ERK5, also known as big MAP kinase 1 (BMK1) because it is twice the size of other MAPKs.
[0083] Non-limiting examples of non-ERK MAPK pathway inhibitors according to the present invention include RAS inhibitors, RAF inhibitors (e.g., inhibitors of A-RAF, B-RAF, C-RAF (RAF-1)), MEK inhibitors, and combinations thereof. Preferably, the non-ERK MAPK pathway inhibitor is a BRAF inhibitor, a MEK inhibitor, and combinations thereof.
[0084] As used herein, "RAS inhibitors" refer to substances that (i) directly interact with RAS, such as by binding to RAS and (ii) reduce the expression or activity of RAS. Non-limiting exemplary RAS inhibitors include, but are not limited to, farnesyl transferase inhibitors (e.g., tipifarnib and lonafarnib), farnesyl-containing small molecules (e.g., salirasib and TLN-4601), DCAI, as disclosed by Maurer (Maurer et al., 2012), Kobe0065 and Kobe2602, as disclosed by Shima (Shima et al., 2013), HBS 3 (Patgiri et al., 2011), and AIK-4 (Allinky).
[0085] As used herein, "RAF inhibitors" refers to those substances that (i) directly interact with RAF, for example, by binding to RAF and (ii) reduce the expression or activity of RAF, such as A-RAF, B-RAF, and C-RAF (RAF-1). Non-limiting exemplary RAF inhibitors, including BRAF inhibitors, include:
[0086] Compound 7 (Li et al.),
[0087] Compound 9 (Same as above),
[0088] Compound 10 (Same as above),
[0089] Compound 13 (Same as above),
[0090] Compound 14 (Same as above),
[0091] Compound 15 (Same as above), Compound 16 (Same as above), Compound 18 (Same as above),
[0092] Compound 19 (Same as above),
[0093] Compound 20 (Same as above),
[0094] Compound 21 (Same as above),
[0095] Compound 22 (Same as above), Compound 23 (Same as above), Compound 24 (Same as above),
[0096] Compound 25 (Same as above),
[0097] Compound 26 (Same as above), Compound 27 (Same as above),
[0098] Compound 28 (Same as above),
[0099] Compound 30 (Same as above),
[0100] Compound 31 (Same as above),
[0101] Compound 32 (Same as above),
[0102] Compound 33 (Same as above), Compound 34 (Same as above), Compound 35 (Same as above),
[0103] Compound 36 (Same as above),
[0104] Compound 37 (Same as above),
[0105] Compound 38 (Same as above),
[0106] Compound 39 (Same as above),
[0107] Compound 40 (Same as above), AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BIIB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 (Cancer Research Institute), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-LaRoche), SB 590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
[0108] As used herein, "MEK inhibitors" refers to substances that (i) directly interact with MEK, such as by binding to MEK, and (ii) reduce the expression or activity of MEK. Thus, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEF inhibitors according to the present invention. Non-limiting examples of MEK inhibitors include anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), the lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2'-amino-3'-methoxyphenyl)-oxaphenanthen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.), RO092210 (Roche), RO4987655 (Hoffmann-La Roche), RO5126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
[0109] In one aspect of this embodiment, substantially all phosphorylation of ribosomal s6 kinase (RSK) is inhibited following administration of BVD-523, or a pharmaceutically acceptable salt thereof. As used herein in the context of RSK phosphorylation, "substantially all" refers to a reduction greater than 50%, preferably greater than 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% reduction.
[0110] In another aspect of this embodiment, the cancer has MAPK activity. As used herein, "MAPK activity" means that proteins downstream of ERK are still active, even if proteins upstream of ERK may not be active. The cancer can be a solid tumor cancer or a blood cancer.
[0111] In the present invention, cancer includes solid and hematological cancers. Non-limiting examples of solid cancers include adrenocortical carcinoma, anal cancer, bladder cancer, bone cancer (e.g., osteosarcoma), brain cancer, breast cancer, carcinoid, carcinoma, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, extrahepatic bile duct cancer, Ewing family of cancers, extracranial germ cell cancer, eye cancer, gallbladder cancer, gastric cancer, germ cell tumors, gestational trophoblastic tumors, head and neck cancer, hypopharyngeal cancer, islet cell carcinoma, kidney cancer, colorectal cancer, laryngeal cancer, leukemia, lip and oral cancer, liver tumor / cancer, lung tumor / cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplasia syndrome, myeloproliferative disorders, nasopharyngeal carcinoma, neuroblastoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer, ovarian germ cell cancer, pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pituitary cancer, plasma cell neoplasms, prostate cancer, rhabdomyosarcoma, rectal cancer, renal cell carcinoma, transitional cell carcinoma of the renal pelvis and ureter, salivary gland cancer, Sézary syndrome, skin cancers (such as cutaneous T-cell lymphoma, Kaposi's sarcoma, mast cell tumor, and melanoma), small intestine cancer, soft tissue sarcomas, stomach cancer, testicular cancer, thymoma, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, vulvar cancer, and Wilms' tumor.
[0112] Examples of hematological cancers include, but are not limited to, leukemias, such as adult / childhood acute lymphoblastic leukemia, adult / childhood acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and hairy cell leukemia, lymphomas, such as AIDS-related lymphoma, cutaneous T-cell lymphoma, adult / childhood Hodgkin lymphoma, mycosis fungoides, adult / childhood non-Hodgkin lymphoma, primary central nervous system lymphoma, Sézary syndrome, cutaneous T-cell lymphoma, and Waldenstrom's macroglobulinemia, and other proliferative disorders, such as chronic myeloproliferative disorders, Langerhans cell histiocytosis, multiple myeloma / plasma cell neoplasms, myelodysplastic syndromes, and myelodysplastic / myeloproliferative neoplasms.
[0113] Preferably, the cancer is selected from colorectal cancer, breast cancer, pancreatic cancer, skin cancer and endometrial cancer. More preferably, the cancer is melanoma.
[0114] In another aspect of this embodiment, the method further comprises administering to the subject at least one additional therapeutic agent effective to treat or ameliorate the effects of the cancer. The additional therapeutic agent can be selected from an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and a combination thereof.
[0115] As used herein, "antibody" includes naturally occurring immunoglobulins and non-naturally occurring immunoglobulins, including, for example, single-chain antibodies, chimeric antibodies (e.g., humanized mouse antibodies) and heterologous conjugate antibodies (e.g., bispecific antibodies). Antibody fragments include those that bind to antigens (e.g., Fab', F(ab')2, Fab, Fv and rIgG). See also, for example, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, J., Immunology, 3rd Ed., WH Freeman & Co., New York (1998). The term antibody also includes bivalent or bispecific molecules, diabodies, triabodies and tetrabodies. The term "antibody" also includes polyclonal and monoclonal antibodies.
[0116] Examples of therapeutic antibodies that can be used in the present invention include rituximab (Rituxan), cetuximab (Erbitux), bevacizumab (Avastin), and ibritumomab (Zevalin).
[0117] Cytotoxic agents according to the present invention include DNA damaging agents, antimetabolites, antimicrotubule agents, antibiotic agents, etc. DNA damaging agents include alkylating agents, platinum-based agents, intercalating agents, and DNA replication inhibitors. Non-limiting examples of DNA alkylating agents include cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozotocin, busulfan, temozolomide, pharmaceutically acceptable salts, prodrugs, and combinations thereof. Non-limiting examples of platinum-based agents include cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin, pharmaceutically acceptable salts, prodrugs, and combinations thereof. Non-limiting examples of intercalating agents include doxorubicin, daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts, prodrugs, and combinations thereof. Non-limiting examples of DNA replication inhibitors include irinotecan, topotecan, amsacrine, etoposide, etoposide phosphate, teniposide, pharmaceutically acceptable salts, prodrugs and combinations thereof. Antimetabolites include folic acid antagonists such as methotrexate and promethotrexate, purine antagonists such as 6-mercaptopurine, dacarbazine and fludarabine, and pyrimidine antagonists such as 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, pharmaceutically acceptable salts, prodrugs and combinations thereof. Antimicrotubule agents include but are not limited to vinca alkaloids, paclitaxel Docetaxel and ixabepilone Antibiotic agents include, but are not limited to, actinomycin, anthracycline, valrubicin, epirubicin, bleomycin, mithramycin, mitomycin, pharmaceutically acceptable salts, prodrugs thereof, and combinations thereof.
[0118] Cytotoxic agents according to the present invention also include inhibitors of the PI3K / Akt pathway. Non-limiting examples of inhibitors of the PI3K / Akt pathway include A-674563 (CAS# 552325-73-2), AGL 2263, AMG-319 (Amgen, ThousandOaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS# 857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Diego, CA). Francisco, CA), BML-257 (CAS #32387-96-5), CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS#612847-09-3, CAS#681281-88-9, CAS#75747-14-7, CAS#925681-41-0, CAS#98510-80-6, CCT12893 0 (CAS#885499-61-6), CH5132799 (CAS#1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124(CAS#902779-59-3), GS-1101(CAL-101)(Gilead Sciences), GSK 690693(CAS#937174-76-0), H-89(CAS#127243-85-0), Honokiol, IC87114(Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS#108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS#1032350-13-2), ML-9 (CAS#105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), Perifosine, PHT-427 (CAS#1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-α / δ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-δ inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-δ inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-δ inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-δ inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Intellikine (Intellikine Inc.), PI3-δ / γ inhibitors, Intellikine (Intellikine Inc.), PI3-δ / γ inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-δ / gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-γ inhibitor Evotec (Evotec), PI3-γ inhibitors, Cellzome (Cellzome AG), PI3-γ inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3Kδ / γ inhibitors, Intellikine-1 (Intellikine Inc.), PI3Kδ / γ inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS#677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, TetrahydroCurcumin, TG100-115 (Targegen Inc., San Diego, CA), Triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
[0119] In the present invention, the term "toxin" refers to an antigenic poison or venom of plant or animal origin. An example is diphtheria toxin or a portion thereof.
[0120] As used herein, the term "radionuclide" refers to a radioactive substance that is administered to a patient, for example, intravenously or orally, after which it penetrates into the target organ or tissue through the patient's normal metabolism, where it delivers localized radiation over a short period of time. Examples of radionuclides include, but are not limited to, I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, and Y-90.
[0121] In the present invention, the term "immunomodulator" refers to a substance that changes an immune response by enhancing or reducing the ability of the immune system to produce antibodies or sensitized cells, which recognize and react with the antigen that initiates their production. Immunomodulators can be recombinant, synthetic or natural preparations, and include cytokines, corticosteroids, cytotoxic agents, thymosins and immunoglobulins. Some immunomodulators are naturally present in vivo, and some of them can be used in pharmacological preparations. Examples of immunomodulators include, but are not limited to, granulocyte colony stimulating factor (G-CSF), interferon, imiquimod and cell membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, and synthetic cytosine monophosphate guanosine (CpG).
[0122] As used herein, the term "photoactivated therapeutic agent" refers to compounds and compositions that become active when exposed to light. Certain examples of photoactivated therapeutic agents are disclosed, for example, in U.S. Patent Application Serial No. 2011 / 0152230A1, "Photoactive Metal Nitrosyl Groups for Blood Pressure Regulation and Cancer Therapy."
[0123] In the present invention, the term "radiosensitizer" refers to a compound that makes tumor cells more sensitive to radiotherapy. Examples of radiosensitizers include misonidazole, metronidazole, tirapazamine, and sodium trans-crocetin.
[0124] In the present invention, the term "hormone" refers to a substance released by cells in one part of the body that affects cells in another part of the body. Examples of hormones include, but are not limited to, prostaglandins, leukotrienes, prostacyclins, thromboxanes, amylins, anti-mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, gonadotropin-releasing hormone, glutathione, glutathione-releasing hormone ... Gonadal hormones, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, liptropin, luteinizing hormone, melanocyte-stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, and calcifediol.
[0125] Some compounds interfere with the activity of certain hormones or prevent the production of certain hormones. These hormone-interfering compounds include, but are not limited to, tamoxifen. Anastrozole Letrozole and fulvestrant These compounds are also within the meaning of hormones in the present invention.
[0126] As used herein, "anti-angiogenic" agents refer to substances that reduce or inhibit the growth of new blood vessels, such as inhibitors of vascular endothelial growth factor (VEGF) and inhibitors of endothelial cell migration. Anti-angiogenic agents include, but are not limited to, 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-α, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts, prodrugs, and combinations thereof.
[0127] Another embodiment of the present invention is a method for treating or ameliorating the effects of cancer in a subject. The method comprises:
[0128] (a) identifying a subject having a cancer that has become refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or BRAF and MEK inhibitor therapy; and
[0129] (b) administering to the subject having the refractory or resistant cancer an effective amount of an ERK inhibitor, which is BVD-523 or a pharmaceutically acceptable salt thereof.
[0130] Suitable and preferred subjects are as disclosed herein. In this embodiment, the method can be used to treat a cancer as disclosed above. According to the present invention, the cancer has MAPK activity.
[0131] In one aspect of this embodiment, identifying a subject having a cancer that is refractory or resistant to BRAF and / or MEK inhibitor therapy comprises:
[0132] (a) obtaining a biological sample from a subject; and
[0133] (b) screening the sample to determine whether the subject has become resistant to an inhibitor therapy selected from the group consisting of a BRAF inhibitor therapy, a MEK inhibitor therapy, and a combination thereof.
[0134] In the present invention, biological samples include but are not limited to blood, plasma, urine, skin, saliva and biopsy samples.Biological samples are obtained from subjects by conventional procedures and methods known in the art.
[0135] Preferably, screening for cancers that are refractory or resistant to BRAF inhibitor therapy can include, for example, identifying (i) switching between RAF isoforms, (ii) upregulation of RTK or NRAS signaling, (iii) reactivation of mitogen-activated protein kinase (MAPK) signaling, (iv) the presence of MEK activating mutations, and combinations thereof.
[0136] Switching between RAF isoforms can occur in subjects with acquired resistance to BRAF inhibitor therapy. To detect this switching, BRAF inhibitor-resistant tumor cells can be recovered from the patient and analyzed for ERK and phospho-ERK levels by Western blotting in the presence of a BRAF inhibitor. Comparison with BRAF inhibitor-sensitive cells treated with a BRAF inhibitor can reveal higher levels of phospho-ERK in BRAF inhibitor-resistant tumor cells, indicating that a switch has occurred in which another RAF isoform phosphorylates ERK instead of BRAF. Confirming which RAF isoform has taken over may involve performing sh / siRNA-mediated knockdown of ARAF and CRAF, respectively, in BRAF inhibitor-resistant cells exposed to a BRAF inhibitor, followed by subsequent Western blotting of ERK and phospho-ERK levels. For example, if ARAF knockdown in BRAF inhibitor-resistant cells exposed to a BRAF inhibitor still results in high levels of phospho-ERK, it indicates that CRAF has taken over phosphorylating ERK. Similarly, if CRAF is knocked down in BRAF inhibitor-resistant cells exposed to BRAF inhibitors, and ERK remains highly phosphorylated, it means that ARAF has taken over ERK phosphorylation. RAF isoform switching may also involve simultaneous knockdown of ARAF and CRAF in BRAF inhibitor-resistant cells in the presence of BRAF inhibitors, effectively blocking all RAF-mediated phosphorylation. The resulting reduction in ERK phosphorylation suggests that BRAF inhibitor-resistant cells have the ability to switch between RAF isoforms to phosphorylate ERK (Villanueva et al., 2010).
[0137] Upregulation of RTK or NRAS signaling may also be a cause of BRAF inhibitor resistance. Detection can, for example, first involve using a Western blotting protocol with phospho-specific antibodies to analyze the activation of downstream RAF effectors MEK1 / 2 and ERK1 / 2. If BRAF inhibitor-resistant cells show high activation levels of these proteins in the presence of BRAF inhibitors, it is possible that upregulation of RTK or NRAS is the cause. Compared to BRAF inhibitor-sensitive cells, gene expression profiles (or other related methods) of BRAF inhibitor-resistant cells in the presence of BRAF inhibitors can reveal higher expression levels of KIT, MET, EGFR, and PDGFRβRTK. Real-time quantitative polymerase chain reaction experiments or other similar procedures focusing on any of these genes can confirm higher expression levels, while phospho-RTK arrays (R&D Systems, Minneapolis, MN) can show elevated activation-related tyrosine phosphorylation. Alternatively, NRAS activation can be detected by various gene sequencing protocols. Activating mutations in NRAS, especially Q61K, may indicate that B-RAF signaling has been bypassed. In melanoma cells, activated NRAS uses C-RAF to signal MEK-ERK. Therefore, activated NRAS can achieve a similar bypass pathway in BRAF inhibitor-resistant cells exposed to BRAF inhibitors. These mechanisms can be further confirmed in given BRAF inhibitor-resistant samples by, for example, using sh / siRNA-mediated knockdown of upregulated RTKs or activated NRAS in the presence of BRAF inhibitors. Any significant level of growth inhibition may indicate that the upregulation of RTK or NRAS signaling is the cause of BRAF inhibition in this particular sample (Nazarian et al., 2010).
[0138] Detection of reactivation of MAPK signaling in BRAF inhibitor-resistant cells may indicate another bypass mechanism of BRAF inhibitor resistance. COT and C-RAF have been shown to be upregulated in a BRAF V600E background exposed to BRAF inhibitors. Quantitative real-time RT-PCR, for example, can show increased COT expression in BRAF inhibitor-resistant cells in the presence of BRAF inhibitors. In addition, sh / siRNA-mediated knockdown of COT in BRAF inhibitor-resistant cells in the presence of BRAF inhibitors can reduce the viability of BRAF inhibitor-resistant cells, indicating that these specific cells may be sensitive to COT inhibition and / or combined BRAF inhibitor / MEK inhibitor treatment (Johannessen et al., 2010).
[0139] By activating mutations in MEK1, reactivation of MAPK signaling can also be achieved in a BRAF inhibitor-resistant background. Targeted massively parallel sequencing of genomic DNA from BRAF inhibitor-resistant tumors can reveal activating mutations in MEK1, such as C121S, G128D, N122D, and Y130. Other undocumented mutations in MEK1 can be analyzed by, for example, expressing specific mutations in BRAF inhibitor-sensitive cell lines such as A375. Determining the growth inhibition levels in these cells when exposed to BRAF inhibitors can indicate whether the MEK1 mutation leads to resistance to BRAF inhibitor therapy. To confirm this finding, Western blotting of elevated levels of phospho-ERK1 / 2 in cells expressing ectopic MEK1 mutations can indicate that MEK1 mutations allow BRAF inhibitor-resistant tumors to bypass BRAF and promote phosphorylation of ERK by MEK1 (Wagle et al., 2011).
[0140] According to the present invention, screening for cancers that are refractory or resistant to MEK inhibitor therapy can include, for example, identifying (i) amplification of mutant BRAF, (ii) upregulation of STAT3, (iii) mutations in the allosteric pocket of MEK that directly block inhibitor binding to MEK or result in constitutive MEK activity, and combinations thereof.
[0141] Amplification of mutant BRAF can cause MEK inhibitor resistance. MEK inhibitor resistance is generally associated with high levels of phosphorylated ERK and MEK in the presence of MEK inhibitors, which can be assessed by, for example, Western blotting. Amplification of mutant BRAF in MEK inhibitor-resistant cell lines can be detected by, for example, fluorescence in situ hybridization (FISH) or quantitative PCR of genomic DNA from resistant cell lines. Confirming that BRAF amplification is the main cause of MEK inhibitor resistance may require the use of sh / siRNA targeted by BRAF in resistant cells. If a significant decrease in MEK or ERK phosphorylation is observed, BRAF amplification may be a suitable target for further treatment methods. (Corcoran et al., 2010).
[0142] Identifying STAT3 upregulation can indicate that a particular tumor sample is resistant to MEK inhibitor therapy. Whole-genome expression profiling can reveal that the STAT3 pathway is upregulated in tumors. Other techniques, such as Western blotting of phospho-STAT3 and real-time qPCR of STAT pathway-related genes JAK1 and IL6ST, can reveal upregulated STAT3. Further confirmation that STAT3 upregulation causes MEK inhibitor resistance in a particular sample can include using sh / siRNA against STAT3 in the sample, followed by appropriate Western blotting for MEK and ERK activation, as well as phospho-STAT3 and total STAT3. Growth inhibition studies can show that STAT3 knockdown sensitizes MEK inhibitor-resistant cells to MEK inhibition in advance. Similar effects can be seen if the sample is exposed to a STAT3 inhibitor such as JSI-124. Further confirmation that STAT3 upregulation is the cause of MEK inhibitor resistance in a particular tumor may come from Western blotting of BIM (including BIM-EL, BIM-L, and BIM-SL) expression. BIM expression leads to MEK inhibitor-induced apoptosis, so STAT3 upregulation can reduce BIM levels. STAT3 is known to regulate the expression of miR17-92, which in turn inhibits BIM expression. Upregulated STAT3 could lead to higher levels of miR17-92, which would reduce BIM levels and promote resistance to MEK inhibition. Therefore, real-time qPCR of miR17-92 levels could also help assess whether STAT3 upregulation contributes to MEK inhibition resistance in a given sample (Dai et al., 2011).
[0143] Mutations in the allosteric pocket of MEK that can directly block inhibitor binding to MEK or lead to constitutive MEK activity can be detected by the methods disclosed below. Such mutations have been previously identified by Emery and colleagues (Emery et al., 2009) and Wang and colleagues (Wang et al., 2011). Other mutations may affect MEK1 codons located within or adjacent to the N-terminal negative regulatory helix, such as P124L and Q56P. (Ibid.).
[0144] Methods for identifying mutations in nucleic acids (e.g., the MEK gene identified above) are known in the art. Nucleic acids can be obtained from biological samples. In the present invention, biological samples include, but are not limited to, blood, plasma, urine, skin, saliva, and biopsy samples. Biological samples are obtained from subjects using conventional procedures and methods known in the art.
[0145] Non-limiting examples of methods for identifying mutations include PCR, sequencing, hybridization capture, in-solution capture, molecular inversion probes, fluorescence in situ hybridization (FISH) assays, and combinations thereof.
[0146] Various sequencing methods are known in the art. These include but are not limited to Sanger sequencing (also referred to as dideoxy sequencing) and various sequencing by synthesis (SBS) methods, as disclosed in for example Metzker 2005, by hybridization sequencing, by connecting sequencing (for example, WO 2005021786), by degradation sequencing (for example, U.S. Patent number 5,622,824 and 6,140,053) and nanopore sequencing (which can be commercially available from Oxford Nanopore Technologies, UK) to obtain. In deep sequencing technology, in the sequencing process, the given nucleotides in the sequence are read repeatedly. Deep sequencing technology is disclosed in for example U.S. Patent Publication No. 20120264632 and International Patent Publication No. WO2012125848.
[0147] PCR-based methods for detecting mutations are known in the art and employ PCR amplification, wherein each target sequence in a sample has a corresponding pair of unique sequence-specific primers. For example, the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method allows for rapid detection of mutations after amplification of genomic sequences by PCR. Mutations are distinguished by digestion with specific restriction endonucleases and identified by electrophoresis. See, for example, Ota et al., 2007. Real-time PCR can also be used to detect mutations. See, for example, International Application Publication No. WO2012046981.
[0148] Hybridization capture methods are known in the art and are disclosed in, for example, U.S. Patent Publication No. 20130203632 and U.S. Patent Nos. 8,389,219 and 8,288,520. These methods are based on the selective hybridization of target genomic regions with user-designed oligonucleotides. Hybridization can be with oligonucleotides immobilized on high-density or low-density microarrays (capture on array), or with solution-phase hybridization of oligonucleotides modified with ligands (e.g., biotin), which can then be immobilized on a solid surface, such as beads (capture in solution).
[0149] Molecular inversion probe (MIP) technology is known in the art and is disclosed in, for example, Absalan et al., 2008. The method uses MIP molecules, which are specific "padlock" probes for genotyping (Nilsson et al., 1994). MIP molecules are linear oligonucleotides that contain a specific region, a universal sequence, a restriction site, and a Tag (index) sequence (16-22 bp). MIPs hybridize directly around the target genetic marker / SNP. The MIP method can also use a number of "padlock" probe sets that hybridize in parallel with genomic DNA (Hardenbol et al., 2003). In the case of a perfect match, genomic homologous regions are connected by inverting in configuration (as indicated by the technical name) and generating circular molecules. After the first restriction, all molecules are amplified with universal primers. The amplicons are restricted again to ensure short fragments for hybridization on the microarray. The generated short fragments are tagged and hybridized with the cTag (complementary strand of the index) on the array through the Tag sequence. After the Tag-cTag duplex is formed, a signal is detected.
[0150] Tables 1, 2, and 3 below show the SEQ ID Nos. of representative nucleic acid and amino acid sequences of wild-type BRAF, N-RAS, and MEK1 from various animals in the sequence listing. These sequences can be used in methods for identifying subjects with mutant BRAF, N-RAS, and MEK1 genotypes.
[0151] Table 1 - BRAF sequences
[0152]
[0153]
[0154] Table 2—N-RAS sequences
[0155]
[0156]
[0157] Table 3 - MEK1 Sequences
[0158]
[0159]
[0160] In another aspect of this embodiment, the method further comprises administering at least one additional therapeutic agent, preferably an inhibitor of the PI3K / Akt pathway, as disclosed herein.
[0161] Another embodiment of the present invention is a method for treating or ameliorating the effects of cancer in a subject that is refractory or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or both. The method comprises administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
[0162] Suitable and preferred subjects are as disclosed herein. In this embodiment, the method can be used to treat cancers disclosed above, including those with the mutational background, resistance spectrum, and MAPK activity identified above. Methods for identifying such mutations are also as described above.
[0163] In another aspect of this embodiment, the method further comprises administering to the subject at least one additional therapeutic agent, preferably an inhibitor of the PI3K / Akt pathway, as disclosed herein.
[0164] Another embodiment of the present invention is a method for identifying a subject with cancer who will benefit from therapy with an ERK inhibitor. The method comprises:
[0165] (a) obtaining a biological sample from a subject; and
[0166] (b) screening the sample to determine whether the subject has one or more of the following markers:
[0167] (i) Switching between RAF isoforms,
[0168] (ii) upregulation of RTK or NRAS signaling,
[0169] (iii) reactivation of mitogen-activated protein kinase (MAPK) signaling,
[0170] (iv) the presence of MEK activating mutations,
[0171] (v) amplification of mutant BRAF,
[0172] (vi) STAT3 upregulation,
[0173] (vii) mutations in the allosteric pocket of MEK that directly block inhibitor binding to MEK or result in constitutive MEK activity,
[0174] Wherein the presence of the one or more markers confirms that the subject's cancer is refractory or resistant to BRAF and / or MEK inhibitor therapy, and the subject would benefit from therapy with an ERK inhibitor, the ERK inhibitor is BVD-523 or a pharmaceutically acceptable salt thereof.
[0175] Suitable and preferred subjects are as disclosed herein. In this embodiment, the method can be used to identify subjects suffering from the cancers disclosed above, including those cancers having the mutation background, resistance spectrum and MAPK activity identified above. Methods for identifying such mutations are also as described above.
[0176] In one aspect of this embodiment, the method further comprises administering BVD-523 or a pharmaceutically acceptable salt thereof to a subject having one or more of said markers. Preferably, the method further comprises administering to a subject having one or more of said markers at least one additional therapeutic agent, preferably an inhibitor of the PI3K / Akt pathway, as disclosed herein.
[0177] Another embodiment of the present invention is a pharmaceutical composition for treating or ameliorating the effects of cancer in a subject that is refractory or resistant to non-ERK MAPK pathway therapies. The composition comprises a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
[0178] Suitable and preferred subjects and types of non-ERK MAPK pathway inhibitor therapies are as disclosed herein. In this embodiment, the pharmaceutical composition can be used to treat cancers disclosed above, including those with the mutational background, resistance spectrum, and MAPK activity identified above. Methods for identifying such mutations are also described above.
[0179] In one aspect of this embodiment, the pharmaceutical composition further comprises at least one additional therapeutic agent, preferably an inhibitor of the PI3K / Akt pathway, as disclosed herein.
[0180] Another embodiment of the present invention is a kit for treating or ameliorating the effects of cancer in a subject that is refractory or resistant to non-ERK MAPK pathway therapies. The kit comprises any pharmaceutical composition according to the present invention, packaged together with instructions for use thereof.
[0181] The test kit may also include suitable storage containers, such as ampoules, vials, tubes, etc., for each pharmaceutical composition and other reactants (e.g., buffers, balanced salt solutions, etc.) for administering the pharmaceutical composition to a subject. The pharmaceutical composition and other reactants may be present in the test kit in any convenient form, such as in solution or powder form. The test kit may further include a packaging container, optionally with one or more partitions, for accommodating the pharmaceutical composition and other optional reagents.
[0182] Suitable and preferred subjects and types of non-ERK MAPK pathway inhibitor therapies are as disclosed herein. In this embodiment, the kit can be used to treat cancers disclosed above, including those with mutational backgrounds, resistance profiles, and MAPK activity identified herein. Methods for identifying such mutations are described above.
[0183] In one aspect of this embodiment, the kit further comprises at least one additional therapeutic agent, preferably an inhibitor of the PI3K / Akt pathway, as disclosed herein.
[0184] Another embodiment of the present invention is a method for inhibiting the phosphorylation of RSK in cancer cells that are refractory or resistant to non-ERK MAPK pathway inhibitors. The method comprises contacting the cancer cells with an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof for a period of time sufficient to inhibit RSK phosphorylation in the cancer cells. In this embodiment, "contacting" refers to bringing BVD-523 or a pharmaceutically acceptable salt thereof and optionally one or more additional therapeutic agents into close proximity with the cancer cells. This can be achieved using conventional techniques for delivering drugs to mammals, or in vitro by, for example, providing BVD-523 or a pharmaceutically acceptable salt thereof and optionally other therapeutic agents to a culture medium containing the cancer cells. In ex vivo situations, contact can be achieved by, for example, providing BVD-523 or a pharmaceutically acceptable salt thereof and optionally other therapeutic agents to cancer tissue.
[0185] Suitable and preferred types of non-ERK MAPK pathway inhibitors are disclosed herein. In this embodiment, affecting cancer cell death can be achieved in cancer cells with various mutation backgrounds, resistance profiles, and MAPK activities as described above. Methods for identifying such mutations are also described above.
[0186] The methods of this embodiment, which can be performed in vitro, ex vivo, or in vivo, can be used to achieve cancer cell death by killing cancer cells, for example, in cells of the cancer types disclosed herein.
[0187] In one aspect of this embodiment, RSK phosphorylation is inhibited by greater than 50%. In another aspect of this embodiment, RSK phosphorylation is inhibited by greater than 75%. In another aspect of this embodiment, RSK phosphorylation is inhibited by greater than 90%. In another aspect of this embodiment, RSK phosphorylation is inhibited by greater than 95%. In another aspect of this embodiment, RSK phosphorylation is inhibited by greater than 99%. In another aspect of this embodiment, RSK phosphorylation is inhibited by 100%.
[0188] In another aspect of this embodiment, the cancer cell is a mammalian cancer cell. Preferably, the mammalian cancer cell is obtained from a mammal selected from humans, primates, farm animals, and domestic animals. More preferably, the mammalian cancer cell is a human cancer cell.
[0189] In another aspect of this embodiment, the contacting step comprises administering BVD-523 or a pharmaceutically acceptable salt to the subject from which the cancer cells were obtained.
[0190] In the present invention, an "effective amount" or "therapeutically effective amount" of a compound or composition disclosed herein is an amount of such a compound or composition that, when administered to a subject, is sufficient to produce a beneficial or desired result as described herein. Effective dosage forms, modes of administration, and dosages can be determined empirically, and making such determinations is within the skill of the art. It will be understood by those skilled in the art that dosage will vary with route of administration, rate of excretion, duration of treatment, characteristics of any other drug being administered, age, size, and species of the mammal (e.g., human patient), and similar factors well known in the medical and veterinary fields. Typically, a suitable dose of a compound or composition according to the present invention will be the amount of such a composition that is the minimum dose effective to produce the desired effect. The effective dose of a compound or composition of the present invention can be administered as two, three, four, five, six, or more sub-doses, administered separately at appropriate intervals throughout the day.
[0191] Suitable non-limiting examples of dosages of BVD-523 and other anticancer agents disclosed herein are from about 1 mg / kg to about 2400 mg / kg per day, such as from about 1 mg / kg to about 1200 mg / kg per day, from 75 mg / kg per day to about 300 mg / kg per day, including from about 1 mg / kg to about 100 mg / kg per day. Other representative dosages of these agents include about 1 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, 200 mg / kg, 250 mg / kg, 30 ...
[0014] The effective dose of BVD-523 and other anticancer agents disclosed herein can be administered as two, three, four, five, six or more sub-doses, administered at appropriate intervals throughout the day.
[0192] BVD-523, other inhibitors, and various other anticancer agents disclosed herein, or pharmaceutical compositions of the present invention can be administered in any desired and effective manner: for oral ingestion, or as ointments or drops for topical application to the eye, or in any appropriate manner for parenteral or other administration, such as intraperitoneal, subcutaneous, topical, intradermal, inhalation, intrapulmonary, rectal, vaginal, sublingual, intramuscular, intravenous, intraarterial, intrathecal, or intralymphatic. In addition, BVD-523, other inhibitors, and various other anticancer agents disclosed herein, or pharmaceutical compositions of the present invention can be administered in combination with other treatments. If desired, BVD-523, other inhibitors, and various other anticancer agents disclosed herein, or pharmaceutical compositions of the present invention can be coated or otherwise protected from gastric or other secretions.
[0193] The pharmaceutical compositions of the present invention comprise one or more active ingredients mixed with one or more pharmaceutically acceptable diluents or carriers and optionally one or more other compounds, drugs, ingredients and / or materials. Regardless of the route of administration selected, the agents / compounds of the present invention are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. See, for example, Remington, The Science and Practice of Pharmacy (21st ed., Lippincott Williams & Wilkins, Philadelphia, PA).
[0194] Pharmaceutically acceptable diluents or carriers are well known in the art (see, for example, Remington, The Science and Practice of Pharmacy (21st ed., Lippincott Williams and Wilkins, Philadelphia, PA) and The National Formulary (American Pharmaceutical Association, Washington, DC) and include sugars (such as lactose, sucrose, mannitol, and sorbitol), starches, cellulose preparations, calcium phosphates (such as dicalcium phosphate, tricalcium phosphate, and dibasic calcium phosphate), sodium citrate, water, aqueous solutions (e.g., saline, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection), alcohols (such as ethanol, propylene alcohol, and benzyl alcohol), polyols (such as glycerol, propylene glycol, and polyethylene glycol), organic esters (such as ethyl oleate and triglycerides), biodegradable polymers (such as polylactide-polyglycolide, poly(orthoesters), and poly(anhydrides)), elastomeric matrices, liposomes, microspheres, oils (such as corn, germ, olive, castor, sesame, cottonseed, and peanut), cocoa butter, waxes (such as suppository waxes), paraffin, silicones, talc, silicates, and the like. Each pharmaceutically acceptable diluent or carrier used in the pharmaceutical compositions of this invention must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Diluents or carriers suitable for a chosen dosage form and intended route of administration are well known in the art, and acceptable diluents or carriers for a chosen dosage form and method of administration can be determined using ordinary skill in the art.
[0195] Optionally, the pharmaceutical compositions of the present invention may contain other ingredients and / or materials commonly used in pharmaceutical compositions. These ingredients and materials are well known in the art and include (1) fillers or extenders, such as starch, lactose, sucrose, glucose, mannitol, and silicic acid; (2) binders, such as carboxymethyl cellulose, alginates, gelatin, polyvinyl pyrrolidone, hydroxypropyl methylcellulose, sucrose, and gum arabic; (3) humectants, such as glycerol; (4) disintegrants, such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium starch glycolate, cross-linked sodium carboxymethyl cellulose, and sodium carbonate; (5) solution retardants, such as paraffin; (6) absorbents such as quaternary ammonium compounds; (7) wetting agents such as cetyl alcohol and glyceryl monostearate; (8) absorption accelerators such as kaolin and bentonite; (9) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols and sodium lauryl sulfate; (10) suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitol esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar and tragacanth; (11) buffering agents; (12) excipients such as lactose, milk sugar, sugar), polyethylene glycol, animal and vegetable fats, oils, waxes, paraffin, cocoa butter, starch, tragacanth gum, cellulose derivatives, polyethylene glycol, silicone, bentonite, silicic acid, talc, salicylates, zinc oxide, aluminum hydroxide, calcium silicate and polyamide powder; (13) inert diluents such as water or other solvents; (14) preservatives; (15) surfactants; (16) dispersing agents; (17) controlled release or absorption delaying agents such as hydroxypropyl methylcellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin and waxes; (18) opacifiers; (19) adjuvants; (20) wetting agents; (21) emulsifying and suspending agents. Floating agents; (22) solubilizers and emulsifiers, such as ethanol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (particularly cottonseed, peanut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofuran alcohol, polyethylene glycol, and fatty acid esters of sorbitan; (23) propellants, such as chlorofluorocarbons and volatile unsubstituted hydrocarbons, such as butane and propane; (24) antioxidants; (25) agents that render the formulation isotonic with the blood of the intended recipient, such as sugars and sodium chloride; (26) thickening agents; (27) coating materials, such as lecithin; (28) sweeteners, flavorings, colorings, aromas, and preservatives. Each such ingredient or material must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. The ingredients and materials suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable ingredients and materials for a selected dosage form and method of administration can be determined using ordinary skill in the art.
[0196] Pharmaceutical compositions of the present invention suitable for oral administration may be in the form of capsules, cachets, pills, tablets, powders, granules, solutions or suspensions in aqueous or non-aqueous liquids, oil-in-water or water-in-oil liquid emulsions, elixirs or syrups, lozenges, boluses, electuaries or pastes. These formulations may be prepared by methods known in the art, for example, by conventional pan coating, mixing, granulation or lyophilization processes.
[0197] Solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules, etc.) can be prepared by, for example, mixing the active ingredient with one or more pharmaceutically acceptable diluents or carriers and optionally one or more fillers, extenders, adhesives, humectants, disintegrants, solution retardants, absorption promoters, wetting agents, absorbents, lubricants and / or colorants. Using suitable excipients, similar types of solid compositions can be used as fillers in soft and hard-filled gelatin capsules. Tablets can be prepared by compression or molding, optionally containing one or more auxiliary ingredients. Compressed tablets can be prepared using suitable adhesives, lubricants, inert diluents, preservatives, disintegrants, surfactants or dispersants. Molded tablets can be prepared by molding in a suitable machine. Tablets and other solid dosage forms, such as dragees, capsules, pills and granules, can optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the art of pharmaceutical formulations. They can also be formulated to provide slow or controlled release of the active ingredient therein. They may be sterilized, for example, by filtration through a bacteria-retaining filter. These compositions may also optionally contain opacifying agents and may be of such composition that they release the active ingredient only or preferentially in a certain part of the gastrointestinal tract, optionally in a delayed manner. The active ingredient may also be in microencapsulated form.
[0198] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. Liquid dosage forms may contain suitable inert diluents commonly used in the art. In addition to inert diluents, oral compositions may also include adjuvants such as wetting agents, emulsifying and suspending agents, sweeteners, flavorings, coloring agents, aromatics, and preservatives. Suspensions may contain suspending agents.
[0199] The pharmaceutical compositions of the present invention for rectal or vaginal administration may be present as suppositories, which can be prepared by mixing one or more active ingredients with one or more suitable non-irritating diluents or carriers that are solid at room temperature but liquid at body temperature and will therefore melt in the rectum or vaginal cavity and release the active compound. Pharmaceutical compositions of the present invention suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing appropriate pharmaceutically acceptable diluents or carriers known in the art.
[0200] Dosage forms for topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, drops, and inhalants. The active agent / compound can be mixed with a suitable pharmaceutically acceptable diluent or carrier under sterile conditions. Ointments, pastes, creams, and gels may contain excipients. Powders and sprays may contain excipients and propellants.
[0201] The pharmaceutical composition of the present invention suitable for parenteral administration can comprise one or more reagent / compound combinations one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions or sterile powders (which can be reconstituted into sterile injectable solutions or dispersions before use), which can contain suitable antioxidants, buffers, solutes or suspensions or thickeners that make the preparation isotonic with the blood of the intended recipient. For example, by using coating materials, by maintaining the required particle size in the case of dispersions, and by using surfactants, suitable fluidity can be maintained. These pharmaceutical compositions can also contain suitable adjuvants, such as wetting agents, emulsifiers and dispersants. It may also be necessary to include isotonic agents. In addition, the absorption of the injectable drug form can be extended by including agents that delay absorption.
[0202] In some cases, in order to prolong the effect of a drug (e.g., a pharmaceutical formulation), it is desirable to slow its absorption from subcutaneous or intramuscular injection. This can be accomplished by using a liquid suspension of a poorly water-soluble crystalline or amorphous material.
[0203] Then, the absorption rate of the active agent / drug depends on its dissolution rate, which in turn depends on crystal size and crystalline form. Alternatively, delayed absorption of parenteral-administered agents / drugs can be achieved by dissolving or suspending the active agent / drug in an oily vehicle. Injectable reservoir forms can be prepared by forming a microcapsule matrix of the active ingredient in a biodegradable polymer. Depending on the ratio of the active ingredient to the polymer and the properties of the specific polymer used, the rate of release of the active ingredient can be controlled. Reservoir injectable formulations are also prepared by embedding the drug in liposomes or microemulsions compatible with body tissues. The injectable material can be sterilized, for example, by filtration through a bacteria-retaining filter.
[0204] The formulations can be present in unit-dose or multi-dose sealed containers (e.g., ampoules and vials) and can be stored in a lyophilized condition, requiring only the addition of a sterile liquid diluent or carrier, such as water for injection, immediately before use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the type described above.
[0205] The present invention provides treatments for cancers that are refractory or resistant to non-ERK MAPK pathway inhibitor therapies and discloses combinations that enhance the effects of ERK inhibitors. Applicants have also shown herein that combinations of different ERK inhibitors also have synergistic effects. Therefore, it is expected that the effects of the combinations described herein can be further improved by using one or more additional ERK inhibitors. Therefore, some embodiments of the present invention include one or more additional ERK inhibitors.
[0206] The present invention also provides a method of treating a subject having unresectable or metastatic BRAF600 mutation-positive melanoma, comprising administering 600 mg BID of BVD-523 or a pharmaceutically acceptable salt thereof to the subject.
[0207] In some embodiments of the invention, the mutation is BRAF V600E mutation.
[0208] The present invention also provides a composition for treating a subject with unresectable or metastatic BRAF600 mutation-positive melanoma, the composition comprising 600 mg of BVD-523 or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable carrier, adjuvant or vehicle.
[0209] The following examples are provided to further illustrate the method of the present invention. These examples are illustrative only and are not intended to limit the scope of the present invention in any way. Example
[0210] Example 1
[0211] Materials and methods
[0212] Cancer cell lines were maintained in cell culture under standard media and serum conditions. For dose escalation studies, A375 cells were split, grown to approximately 40-60% confluence, and then treated with an initial dose of a specific drug. Table 4 shows a summary of the escalating drug treatments.
[0213] Table 4 - Summary of incremental processing
[0214] deal with inhibitors 1 Trametinib (MEKi) 2 Dabrafenib (BRAFi) 3 BVD-523(ERKi) 4 Dabrafenib (BRAFi) + trametinib (MEKi) 5 Dabrafenib (BRAFi) + BVD-523 (ERKi) 6 Trametinib(MEKi)+BVD-523(ERKi)
[0215] Single-agent dose escalation was performed based on Little et al., 2011 and Figure 20The cells are then grown until 70-90% confluent and split. The split ratio is kept as "normal" as possible and reasonably consistent between treatments (e.g., a minimum of 50% of the normal split ratio of the parent). The medium is refreshed every 3-4 days. When the cells reach approximately 40-60% confluence again, the dose is escalated. If the 40-60% window is missed, the cells are split again and dosing is started once they reach 40-60% confluence. Again, the medium is refreshed every 3-4 days. Repeat this process as needed ( Figure 20 ).
[0216] For single-agent treatments, starting concentrations and dose escalation were performed as follows: at approximately IC 50 Initially, increase in small increments, or slightly, double the dose for the first 4-5 doses, increase by the same increment for the next 4 doses, and then increase the concentration 1.5-fold for subsequent doses.
[0217] For combination treatments, starting concentrations and dose escalation were performed as follows: at approximately the IC of each compound. 50 The doses were escalated as per the single agent schedule (i.e., an initial doubling followed by the same increment for the next four doses, followed by a 1.5-fold increase in concentration). Table 5 shows the projected dose escalation using these schedules.
[0218] Table 5 - Projected Dose Escalation - First Month
[0219]
[0220]
[0221] Clonal resistant cell populations were derived from resistant cell banks by limiting dilution.
[0222] Use a proliferation assay to track changes in sensitivity to increasing agents at appropriate time intervals (e.g., monthly, although the timing depends on the availability of sufficient cell numbers). For the proliferation assay, cells are seeded at 3000 cells per well in 96-well plates in drug-free DMEM containing 10% FBS and allowed to adhere overnight before adding compound or vehicle control. Compounds are prepared from DMSO stocks to give a final concentration range such as Figure 2A-2HAs shown. The final DMSO concentration was constant at 0.1%. The test compounds were incubated with cells at 37°C and 5% CO2 in a humidified atmosphere for 96 hours. Alamar blue 10% (v / v) was then added and incubated for 4 hours, and the fluorescent product was detected using a BMG FLUOstar plate reader. The average medium-only background value was derived, and the data were analyzed using a 4-parameter logistic equation in GraphPad Prism. Paclitaxel was used as a positive control.
[0223] The month 1 proliferation assay was initiated on day 28 using cells grown at the concentrations of each reagent shown in Table 6.
[0224] Table 6 - Initial concentrations of drugs used in proliferation assays - Month 1
[0225] cell lines Dab Tram BVD-523 Parents - - - Tram - 2nM - Dab 15nM - - BVD-523 - - 0.48μM Tram+Dab 5nM 1nM - Dab+BVD-523 7.5nM - 0.24 μM Tram+BVD-523 - 1nM 0.16μM
[0226] The month 2 proliferation assay was initiated on day 56 using cells grown at the concentrations of each reagent shown in Table 7.
[0227] Table 7 - Initial concentrations of drugs used in proliferation assays - Month 2
[0228] cell lines Dab Tram BVD-523 Parents - - - Tram - 8nM - Dab 127nM - - BVD-523 - - 0.8μM Tram+Dab 10nM 2nM - Dab+BVD-523 12.5nM - 0.4μM Tram+BVD-523 - 2nM 0.32μM
[0229] At the end of the 3-month increment period, cultures were maintained at the highest concentration for 2 weeks prior to the final round of proliferation assays and possible single-cell cloning. Since proliferation assays / single-cell cloning require actively proliferating cells, spare cultures were also maintained at lower concentrations for treatments where cells were proliferating very slowly at the highest concentration or were only recently incremented (Table 8). For BVD-523 treatments, where cells appeared to have almost completely stopped growing and looked particularly fragile at the highest concentration (1.8 μM), cultures were maintained at lower concentrations for a period of 2 weeks.
[0230] Table 8 - Treatment details for 2 weeks of culture at a fixed concentration
[0231]
[0232] The month 3 proliferation assay used cells grown in the presence of the concentrations of each reagent shown in Table 9.
[0233] Table 9 - Initial concentrations of drugs used in proliferation assays - Month 3
[0234] cell lines Dab Tram BVD-523 Parents - - - Tram - 160nM - Dab 3.2μM - - BVD-523 - - 1.2 μM Tram+Dab 80nM 16nM - Dab+BVD-523 28nM - 0.9μM Tram+BVD-523 - 2.5nM 0.4μM
[0235] For combination research, A375 cells (ATCC) are seeded in 96-well plates in triplicate with a cell density of 3000 cells / well, in DMEM plus 10% FBS, and before adding test compounds or vehicle control, it is adhered overnight. 10x8 dosage matrix test combination is used, and final DMSO concentration is 0.2%. Then carry out the assay incubation period of 96 hours, add Alamar blue 10% (v / v) subsequently and hatch 4 hours, then read on fluorescent plate reader. After reading Alamar blue, culture medium / Alamar blue mixture is flicked and adds the CellTiter-Glo / PBS (1: 1) of 100 μ l, and according to the explanation processing plate of manufacturer (Promega). Subtract only culture medium background value before analytical data. Then apply Bliss addition model.
[0236] In short, using Equation C bliss =A+B-(A×B) Calculate the predicted fractional inhibition value for the combined inhibition, where A and B are the fractional inhibition obtained for drug A alone or drug B alone at a specific concentration. If the combination of the two drugs is exactly additive, then C bliss is the expected fractional inhibition. Subtract C from the experimentally observed fractional inhibition value. bliss The values were calculated to obtain the 'Excess over Bliss' value. Excess over Bliss values greater than 0 indicate synergy, while values less than 0 indicate antagonism. Excess over Bliss values were plotted as a heat map ± SD.
[0237] Single and combined data are also presented as dose-response curves generated in GraphPad Prism (plotted using % viability relative to DMSO-only treated controls).
[0238] For combination studies of interest, Alamar Blue viability assays were performed as described above for combination studies. Alternatively, Caspase-Glo 3 / 7 assays were performed. Briefly, HCT116 cells were seeded in triplicate at a cell density of 5000 cells / well in white 96-well plates in McCoy's 5A plus 10% FBS. A375 cells were seeded at a density of 5000 cells / well in DMEM plus 10% FBS. Cells were allowed to adhere overnight before the addition of test compounds or vehicle control. The final concentration of DMSO was 0.2%, and 800 nM staurosporine was included as a positive control. Assay incubation periods of 24 and 48 hours were used. Then, 5% dapoxetine was added. 3 / 7 50% (v / v), the plate was mixed on an orbital shaker for 5 minutes and incubated at room temperature for 1 hour before reading on a luminescence plate reader. The medium only background value was subtracted before analyzing the data.
[0239] For differential scanning fluorimetry, SYPRO Orange (5,000× solution, Invitrogen) was diluted (1:1,000) in a buffer solution (10 mM HEPES, 150 mM NaCl, pH 7.5). HisX6-tagged proteins included inactive ERK2, active ERK2 (ppERK2), or p38α at a final concentration of 1 μM. The protein / dye solution and compound in 100% DMSO were added to the wells (2% v / v final DMSO concentration) to the desired final concentration, mixed, and placed in the RT-PCR instrument. Next, a melting curve was performed from 25-95°C at a rate of 1°C per minute, and the melting temperature (Tm) of each protein was determined in the absence or presence of compound. The change in Tm (ΔTm) in the presence of various drug concentrations is presented.
[0240] For the Ki determination of ERK1, activated ERK1 (10 nM) was incubated with various concentrations of compound in 2.5% (v / v) DMSO at 30°C in 0.1 M HEPES buffer (pH 7.5), 10 mM MgCl2, 2.5 mM phosphoenolpyruvate, 200 μM nicotinamide adenine dinucleotide (NADH), 150 μg / mL pyruvate kinase, 50 μg / mL lactate dehydrogenase, and 200 μM Erktide peptide for 10 minutes. The reaction was initiated by the addition of 65 μM ATP. The reduced absorbance (340 nm) was monitored and the IC was determined. 50 as a function of inhibitor concentration.
[0241] For the Ki determination of ERK2, the inhibitory activity of BVD-523 against ERK2 was determined using a radiometric assay with the final concentrations of 100 mM HEPES (pH 7.5), 10 mM MgCl2, 1 mM dithiothreitol (DTT), 0.12 nM ERK2, 10 μM myelin basic protein (MBP), and 50 μM 33 P-γ-ATP. All reaction components except ATP and MBP were premixed and aliquoted (33 μL) into a 96-well plate. Dilutions up to 500-fold were prepared using stock solutions of compounds in DMSO; a 1.5 μL aliquot of DMSO or inhibitor in DMSO was added to each well. 33 The reaction was initiated with P-γ-ATP and MBP (33 μL). After 20 minutes, the reaction was quenched with 20% (w / v) trichloroacetic acid (TCA) (55 μL) containing 4 mM ATP, transferred to a GF / B filter plate, and washed three times with 5% (w / v) TCA. Ultimate Gold TMAfter addition of scintillant (50 μL), samples were counted in a Packard TopCount. From activity versus concentration titration curves, Ki values were determined by fitting the data to the equation for competitive tight binding inhibition kinetics using Prism software version 3.0.
[0242] IC for ERK2 50 Activity was determined by a standard coupled enzyme assay. Final concentrations were as follows: 0.1 M HEPES (pH 7.5), 10 mM MgCl2, 1 mM DTT, 2.5 mM phosphoenolpyruvate, 200 μM NADH, 50 μg / mL pyruvate kinase, 10 μg / mL lactate dehydrogenase, 65 μM ATP, and 800 μM peptide (ATGPLSPGPFGRR). All reaction components except ATP were premixed with ERK and aliquoted into the assay plate wells. BVD-523 in DMSO was introduced into each well, maintaining a constant DMSO concentration per well. The BVD-523 concentration range was 500-fold for each titration. The assay plate was incubated at 30°C for 10 minutes in the plate reader of a spectrophotometer (Molecular Devices), and the reaction was then initiated by the addition of ATP. The change in absorbance at 340 nm was monitored as a function of time; the initial slope corresponds to the reaction rate. The rate versus concentration of the BVD-523 titration curve was fitted to the equation for competitive tight binding inhibition kinetics to determine the Ki value or a 3-parameter fit to determine the IC using Prism software version 3.0. 50 .
[0243] For apoptosis assay, cells were plated at 2 × 10 4Cells were seeded in 96-well plates and allowed to adhere overnight or grow to 50% confluence. Cells were treated with serially diluted BVD-523 in culture medium (final volume 200 μL, concentration range 4-0.25 μM) and incubated in a 37°C CO2 incubator for 48 hours. Cells were washed with 100 μL of PBS and 60 μL of radioimmunoprecipitation assay buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1.0% [w / v] NP-40, 0.5% [w / v] sodium deoxycholate, 1% [w / v] SDS) was added, followed by incubation at 4°C for 10 minutes to lyse the cells. 30-μ L lysate aliquots are added to the caspase assay buffer (120mM HEPES, 12mM EDTA, 20mM dithiothreitol, 12.5 μ g / mL AC-DEVD-AMC caspase substrate) of 100 μ L, and incubated at room temperature for 4 hours to overnight. Plate (excitation wavelength 360nm, emission wavelength 460nm) is read in a fluorometer. The total protein content of remaining 30 μ L lysates is analyzed using BioRad protein assay kit (sample to working reagent ratio is 1:8). Final normalized caspase activity is derived as the fluorescence unit of every μ g protein, and is converted into the multiple increase of caspase activity compared with the DMSO control.
[0244] To measure antitumor activity in A375 xenografts, xenografts were initiated with A375 cells maintained by serial subcutaneous transplantation in female athymic nude mice. Each test mouse received an A375 tumor fragment (1 mm 3 Once the tumor reaches the target size (80-120 mm 3 ), the animals were randomly divided into treatment and control groups, and drug treatment was started.
[0245] To evaluate BVD-523 monotherapy, BVD-523 in 1% (w / v) carboxymethylcellulose (CMC) was administered orally (po) at a BID dose of 5, 25, 50, 100, or 150 mg / kg. Oral temozolomide was administered as a positive reference compound at 75 or 175 mg / kg once daily (QD) for a total of five treatments (QD×5).
[0246] The efficacy of BVD-523 in combination with dabrafenib was evaluated in mice randomly divided into 9 groups of 15 and 1 group of 10 (i.e., Group 10). Dabrafenib was administered orally at 50 or 100 mg / kg QD and BVD-523 was administered orally at 50 or 100 mg / kg BID, alone and in combination, until the end of the study; a vehicle-treated and temozolomide-treated (150 mg / kg QD×5) control group was also included. Combination dosing was stopped on day 20 to monitor tumor regrowth. Animals were monitored individually and when each tumor reached 2000 mm 3 Euthanasia was performed when the endpoint volume reached 1008 mm or on the last day (day 45), whichever came first, and the median time to endpoint (TTE) was calculated. This combination was also evaluated in the later A375 model, where 228-1008 mm 3 Larger tumors within the range. Here, mice are randomly divided into 1 group of 14 (Group 1) and 4 groups of 20 (Groups 2-5). On the 1st day, administration was started with dabrafenib plus BVD-523 (25mg / kg dabrafenib+50mg / kg BVD-523 or 50mg / kg dabrafenib+100mg / kg BVD-523), and each agent was given orally BID until the end of the study. The study includes a 50-mg / kg dabrafenib and a 100-mg / kg BVD-523 monotherapy group and a vehicle-treated control group. Tumors were measured twice a week. Combination administration was stopped at day 42 to monitor tumor regrowth until the end of the study (Day 60). Treatment results are determined by %TGD, which is defined as the percentage increase in the median TTE of treated mice versus control mice, and the differences between the groups are analyzed by log-rank survival analysis. For TGI analysis, the initial (i) and final (f) tumor measurements were used to calculate and report the % TGI value for each treatment (T) group versus control (C): % TGI = 1-Tf-Ti / Cf-C. Mice were also monitored for CR and PR responses. Animals with CR at the end of the study were additionally classified as TFS.
[0247] To measure BVD-523 activity in Colo205 xenografts, human Colo205 cells were cultured in RPMI 1640 supplemented with 10% (v / v) fetal bovine serum (FBS), 100 units / mL penicillin, 100 μg / mL streptomycin (Invitrogen), and 2 mM L-glutamine. Cells were cultured for fewer than four passages before implantation. On day 0, female athymic nude mice (19-23 g) were injected subcutaneously with 2 × 10 6 Colo205 cells to the right dorsal axillary region.
[0248] will have an approximate tumor volume of 200 mm 3Mice were randomly divided into 6 experimental groups. A vehicle control, i.e., 1% CMC (w / v), was prepared weekly. BVD-523 was suspended in 1% (w / v) CMC at the desired concentration and homogenized on ice at 6,500 rpm for 50 minutes. BVD-523 suspensions were prepared weekly and administered orally BID at a total daily dose of 50, 100, 150, and 200 mg / kg (n=12 / group) in an 8 or 16 hour dosing schedule for 13 days. The vehicle control (n=12) was administered using the same dosing schedule. CPT-11 was administered as a positive reference compound (n=12). Each 1 mL of CPT-11 injection contained 20 mg irinotecan, 45 mg sorbitol, and 0.9 mg lactic acid. CPT-11 was administered intraperitoneally at 100 mg / kg / day every 4 days for 2 consecutive doses.
[0249] To measure ERK1 / 2 isotope-labeled internal standard (ITIS) mass spectra in Colo205 xenografts, frozen tumors were lysed in 10 volumes of ice-cold lysis buffer (10 mM TRIS-HCl, pH 8.0, 10 mM MgCl2, 1% (v / v) Triton X-100, Complete TM The cells were lysed in 4% paraformaldehyde (5% dapoxetine) (Protease inhibitor cocktail [Roche, catalog number 1836170], Phosphatase inhibitor cocktail I [Sigma, catalog number P-2850], Phosphatase inhibitor cocktail II [Sigma catalog number 5726] and benzonase [Novagen catalog number 70664]). The lysate was clarified by centrifugation (100,000 × g, 4°C, 60 minutes) and the supernatant was adjusted to 2 mg / mL with lysis buffer. ERK1 was immunoprecipitated using agarose coupling and pan-anti-ERK1 (Santa Cruz Biotechnology catalog number sc-93ac) antibody. The immunoprecipitated proteins were resolved by SDS-PAGE and stained with SYPRO Ruby (Invitrogen), and the ERK bands were cut with a razor. The gel slices were washed in 300 μL of 20 mM NH4HCO3, cut into small pieces, and placed in a Page Eraser Tip (The Nest Group catalog number SEM0007). The gel fragments were reduced and alkylated before trypsin digestion. Tryptic fragments were separated in 75 μL of 50% (v / v) acetonitrile, 0.2% (v / v) trifluoroacetic acid, and the resulting samples were concentrated to 0-10 μL in a SpeedVac.
[0250] For ITIS analysis, digested samples were spiked with heavy-atom labeled peptide standards and fractionated phosphorylation was quantified by coupled liquid chromatography-tandem mass spectrometry (MS). HPLC was performed using a Rheos 2000 binary pump from Flux Instruments (providing nanoscale flow after a 1:750 split), an LC Packings Inertsil nano prepacked column (C18, 5 mm, Nanocapillary chromatography was performed using a 500 nm ionizer (30 mm ID × 1 mm) and a New Objective PicoFrit AQUASIL decomposing column (C18, 5 mm, 75 / 15 mm ID × 10 cm), which also served as an electrospray ionization (ESI) emitter. An Applied Biosystem API 3000 mass spectrometer coupled to a nano-ESI source was used for MS analysis. An in-house manufactured gas nozzle connected to the nebulizing gas source was used to facilitate stable nanoflow spraying. Data were acquired in multiple reaction monitoring (MRM) mode: nebulizing gas, 3; curtain gas, 7; collision gas, 5; ion spray voltage, 2150 V, exit potential, 10 V; Q1 / Q3 resolution, low / unit; and a dwell time of 65 msec for all MRM transitions. All raw MS data were processed using a combination of the Analyst software suite from Applied Biosystems and custom tools.
[0251] To assess drug sensitivity in a cell line model of acquired resistance, the drug sensitivity of dose-escalating A375 cells and isogenic RKO cells was assessed in a 96-hour proliferation assay. RKO isogenic cells (McCoy's 5A with 10% [v / v] FBS) or dose-escalating A375 cells (DMEM with 10% FBS) were seeded into 96-well plates and allowed to adhere overnight before adding compound or vehicle control. Note that dose-escalating A375 cells were seeded in the absence of inhibitor. Compounds were prepared from 0.1% (v / v) DMSO stocks to give the final concentrations shown. Test compounds were incubated with cells at 37°C in a humidified atmosphere of 5% CO2 for 96 hours. For RKO cells, the addition of The cells were plated with a 4-well plate reader (Promega) and luminescence was detected using a BMG FLUOstar plate reader. For the A375 assay, 10% (v / v) Alamar blue (ThermoFisher) was added and incubated for 4 hours before detecting the fluorescent product using a BMG FLUOstar. The average culture medium background value was subtracted and the data were analyzed using a 4-parameter logistic equation in GraphPad Prism.
[0252] The IC of ERK1 was measured in a final reaction volume of 25 μL. 50ERK1 (human) (5-10 mU) was mixed with 25 mM Tris (pH 7.5), 0.02 mM ethylene glycol tetraacetic acid, 250 μM peptide, 10 mM magnesium acetate and γ- 33 The cells were incubated with P-ATP (specific activity approximately 500 cpm / pmol, concentrated as needed). The reaction was initiated by adding Mg-ATP. After a 40-minute incubation at room temperature (RT), the reaction was terminated by adding 5 μL of 3% (w / v) phosphoric acid solution. 10 μL of the reaction was then spotted onto a P30 filter pad, washed three times for 5 minutes in 75 mM phosphoric acid, then washed once in methanol, dried, and scintillation counted.
[0253] RKO MEK1 Q56P isogenic cells were generated by Horizon Discovery (Cambridge, UK; #HD106-019) using a recombinant AAV-mediated gene targeting strategy. Briefly, rAAV virus was produced after transfection of appropriate targeting vectors and helper vectors in HEK293T cells, purified using an AAV purification kit (Virapur, San Diego, USA), and titrated using qPCR. Parental homozygous RKO cells (homozygous wild type of MEK1) were then infected with rAAV virus, and clones that had integrated the selection cassette were identified and amplified by G418 selection. Correctly targeted clones were identified by PCR and sequencing, which were heterozygous for the MEK1 Q56P point mutation knock-in single isogenic gene.
[0254] Isogenic SW48 cell lines heterozygous for knock-in mutant KRAS (De Roock et al., 2010, JAMA, 304, 1812-1820) were obtained from Horizon Discovery (catalog numbers: HD 103-002, HD 103-006, HD 103-007, HD 103-009, HD 103-010, HD 103-011, HD 103-013). For proliferation assays, cells were seeded into 96-well plates in McCoy's 5A medium supplemented with 10% FBS and allowed to adhere overnight before adding compound or vehicle control. Test compounds were incubated with cells at 37°C in a 5% CO2 atmosphere for 96 hours. Viability was then assessed using Alamar blue.
[0255] A proprietary KinaseProfiler assay was performed at Upstate Discovery and uses radioactive detection similar to that used by Davies et al. to characterize the selectivity of BVD-523 for a panel of 70 kinases.
[0256] Drug sensitivity analysis was performed using high-throughput screening as part of the drug sensitivity genomics in cancer project as previously described ( Yang et al., 2013 ).
[0257] For Western blot analysis, A375 cells were seeded onto 10 cm culture dishes in Dulbecco's modified Eagle's medium plus 10% (v / v) FBS. Cells were allowed to adhere overnight before adding test compounds or vehicle. For experiments using RKO cells, these cells were seeded into 6-well plates or 10 cm culture dishes with McCoy's 5A+10% (v / v) FBS. The cells were then processed with the desired concentration and duration. The cells were harvested by trypsinization, precipitated and quickly frozen. Lysates were prepared with RIPA buffer supplemented with a mixture of protease and phosphatase inhibitors (Roche), clarified by centrifugation at 11,000 rpm for 10 minutes, and quantified by the bicinchoninic acid assay. Samples were resolved by SDS-PAGE, blotted onto polyvinylidene difluoride membranes, and probed with antibodies against the indicated targets (i.e., pRB[Ser780], catalog #9307; CCND1, catalog #ab6152; BCL-xL, catalog #2762; PARP, catalog #9542; DUSP6, catalog #3058S).
[0258] For reverse phase protein analysis (RPPA), A375, MIAPaCa-2, HCT116, Colo205, HT-29, and AN3Ca cells (ATCC) were plated at 80% confluence, allowed to recover overnight (MIAPaCa-2 cells were plated at 30% confluence and allowed to recover for 3 days), and then treated with 10 μM of each compound (i.e., BVD-523, SCH722984, GDC-0994, or Vx-11e) at 37°C for 6 hours. Control wells were treated with 0.1% (v / v) DMSO for 6 hours before generating cell lysates. Samples were then analyzed using reverse phase protein microarray technology (Theranostics Health).
[0259] For analysis of pERK IHC in Colo205 xenografts, xenograft tumors were treated overnight in 70% to 100% graded ethanol, washed in two changes of xylene, infiltrated with paraffin, and embedded in paraffin blocks. 5-μm sections were then cut and placed on positively charged slides and baked at 60°C for at least 30 minutes, but no longer than 1 hour. A single section from each animal and dose group was probed with anti-phospho-p42 / p44 MAPK antibody (pERK [1:100], CST; catalog number 9101; lot number 16), counterstained with hematoxylin, and then analyzed microscopically using a Zeiss Axioplan 2 microscope. An isotype control (rabbit, Zymed laboratories, catalog number 08-6199, lot number 40186458) was used as a negative control.
[0260] For FACS analysis, cells are scraped and precipitated at 1,500rpm for 5 minutes, then resuspended in the buffer of 1mL and frozen at-70 ℃.Frozen cells are thawed and centrifuged again, then resuspended in the buffer A of 0.25mL (trypsin in spermine tetrahydrochloride decontamination buffer) for 10 minutes, to disaggregate cell mass and digest cell membrane and cytoskeleton.In the dark, add buffer B (trypsin inhibitor and ribonuclease I in buffer, 0.2mL) 10 minutes.The cell nucleus of the DNA dyeing obtained is filtered and analyzed by FACS.Based on the existence of n and 2n DNA (or higher) content, analyze histogram to determine the ratio of cell in G1, S and G2 / M phase of cell cycle.
[0261] To measure in vitro combination activity, five thousand G-361 cells were seeded into triplicate 96-well plates containing McCoy's 5A and 10% (v / v) FBS and allowed to adhere overnight. A 10×8 dose matrix was used to test the vemurafenib / BVD-523 combination. Compounds were incubated with cells at 37°C in a humidified atmosphere of 5% CO2 for 72 hours. CellTiter-Glo reagent was added according to the manufacturer's instructions, and luminescence was detected using an MBG FLUOstar plate reader. Interactions were determined for the dose matrix using the Loewe additivity and Bliss independence models using Horizon's Chalice combination analysis software.
[0262] For the generation of compound resistance in vitro by dose escalation, A375 parental cells (ATCC CRL-1619) were grown to ∼40–60% confluence in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated FBS and penicillin / streptomycin and then treated with an initial dose of BVD-523, trametinib, or dabrafenib, alone or in combination, at the IC of each compound.50 or slightly lower than the IC of each compound 50 For combination studies, the initial dose was the IC 50 Half of the dose was added. Cells were grown until approximately 70-90% confluence and split; the medium was refreshed every 3-4 days. When cells again reached approximately 40-60% confluence, the dose was escalated by the same increment (equal to the starting concentration), followed by a 1.5-fold increase in concentration, and then a further 2-fold increase if cells continued to adapt rapidly. (For example, the first six doses of dabrafenib escalation were: 5, 10, 15, 20, 25, and 37.5 nM). This process was repeated as needed.
[0263] Figure 30A The cell viability assay was performed by a resazurin (Alamar blue) metabolism assay after 5 days of drug administration in whole serum under high glucose conditions. The cells were seeded in a 384-well microplate at approximately 15%-50% confluence in a medium containing 10% FBS and penicillin / streptavidin plus high glucose (18-25mM). The optimal cell number for each cell line was determined to optimize growth during drug administration. For adherent cell lines, after overnight incubation, the cells were treated with 9 concentrations of each compound (2-fold dilution series) using a liquid handling robot and returned to the incubator for measurement at a 96-hour time point. For suspension cell lines, the cells were treated with the compound immediately after plating and returned to the incubator for a 96-hour time point. The cells were then stained with 55 μg / ml resazurin (Sigma) prepared in glutathione-free medium for 4 hours. For resazurin, the fluorescence signal intensity was quantified using a fluorescence plate reader at excitation and emission wavelengths of 535 / 595nm. All screening panels were subjected to stringent quality control measures. Effects on cell viability were measured and curve fitting algorithms were applied to the raw data sets to derive multiparametric descriptions of drug responses, including half-maximal inhibitory concentration (IC 50 ). IC 50 IC in μM 50 The natural logarithm of (LN_IC 50 ; EXP returns the IC in μM 50 ). This allows for extrapolation of IC in cases where very high values are produced. 50 If necessary, by connecting the IC 50 Values were clamped to the maximum tested concentration (and the minimum tested concentration for lower values), restricting the data to the concentration range tested.
[0264] BVD-523 was tested for efficacy in patient-derived xenografts (AT052C) representing BRAF-positive patients that have become clinically refractory to vemurafenib. V600EMelanoma tumors from patients. Tumor fragments were harvested from host animals and implanted into immunodeficient mice. The average tumor volume at the start of the study was approximately 170 mm. 3 At this time, the animals were randomly divided into 4 groups, including a control group (1% [v / v] CMC oral BID×31) and 3 treatment groups (BVD-523 [100 mg / kg], dabrafenib [50 mg / kg], or BVD-523 / dabrafenib [100 / 50 mg / kg], n=10 / group); all treatment drugs were administered orally on a BID×31 schedule.
[0265] IC of BVD-523 for inhibition of PMA-stimulated RSK1 phosphorylation in human whole blood samples 50 The IC of BVD-523 for inhibition of PMA-stimulated RSK1 phosphorylation was determined in 10 healthy donors (age 22-61 years). 50 Values were calculated using an 8-point concentration curve ranging from 10 μM to 5 nM BVD-523. Controls consisted of 3 unstimulated samples and 3 PMA-stimulated samples per donor. Phospho-RSK (pRSK) and total RSK levels were determined, and data were calculated using the pRSK / RSK levels for each sample.
[0266] 30 ml of blood was drawn from each donor into sodium heparin vacuum tubes. 1 mL of whole blood was added to each of 22 2-mL microtubes per donor. The microtubes were labeled with the donor number (1 to 10) and the subsequent treatment name: "A" for PMA stimulation only (maximum), "B" for samples containing BVD-523 that received PMA stimulation; and "C" for unstimulated samples (minimum). Dimethyl sulfoxide (DMSO) was added to all tubes in Groups A and C to a final concentration of 0.1%. The samples were then gently shaken at room temperature.
[0267] BVD-523 (10 mM in 100% DMSO) was serially diluted into 100% DMSO in 3-fold dilutions. These serially diluted BVD-523 samples in 100% DMSO were then diluted 10-fold in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and penicillin / streptomycin / glutamine, and 10 μL of each of these working solutions was added per mL of blood for each specified BVD-523 concentration. Each concentration of BVD-523 was run in duplicate, with two 1 mL blood samples each, resulting in 16 total samples for a complete 8-point concentration curve. The samples were then gently shaken at room temperature for at least 2 hours but no longer than 3 hours.
[0268] Human whole blood samples from groups A and B from all donors were stimulated with PMA at a final concentration of 100 nM for 20 minutes at room temperature. Samples in group C were not treated with PMA but were shaken and processed like all other samples.
[0269] After completing the PMA treatment of each sample, peripheral blood mononuclear cells were isolated from human whole blood. 1 mL of blood from each sample was gently layered on 0.75 mL of room temperature Histopaque 1077 in a 2 mL microcentrifuge tube. The sample was centrifuged at 16,000 × g for 2 minutes in an Eppendorf microcentrifuge. The interface and upper layer were removed and added to a tube containing 1 mL of cold Dulbecco's phosphate buffered saline (DPBS). These samples were then centrifuged at 16,000 × g for 30 seconds to precipitate the cells. The buffer supernatant was removed by suction and the precipitate was resuspended in 1 mL of cold DPBS. The precipitate of each sample was then reprecipitated as described above. The buffer was removed by suction and the precipitate was lysed as shown below.
[0270] Complete lysis buffer consisted of Meso Scale Discovery Tris lysis buffer, 1X Halt protease inhibitor cocktail, 1X phosphatase inhibitor cocktail 2, 1X phosphatase inhibitor cocktail 3, 2 mM phenylmethanesulfonyl fluoride, and 0.1% sodium dodecyl sulfate. Lysis buffer was kept on ice and prepared fresh for each sample set. The final cell pellet was lysed by adding 120 μL of complete lysis buffer. Samples were vortexed until the cell pellet disappeared and then snap-frozen on dry ice. Samples were stored at -20°C prior to measurement of pRSK and total RSK by ELISA.
[0271] For the pRSK ELISA (PathScan), the thawed lysate was combined with sample diluent (provided in the ELISA kit) in a 1:1 ratio: 120 μL of lysate was added to 120 μL of sample diluent in a round-bottom 96-well plate. This combination was then transferred to the pRSK microwells at 100 μL per well. For the total RSK ELISA (PathScan), 20 μL of lysate that had been diluted 1:1 in sample diluent was further diluted in 200 μL of sample diluent in a round-bottom 96-well plate. This combination was then transferred to all RSK microwells at 100 μL per well. The plates were sealed with a plate seal and incubated at 4°C for 16 to 18 hours, which is the time that optimal detection of the target protein is shown. Both ELISAs were developed according to the kit instructions.
[0272] Patients ≥18 years of age were eligible to participate if they had incurable, histologically confirmed metastatic or advanced malignancy; an Eastern Cooperative Oncology Group performance status of 0 or 1; adequate renal, hepatic, bone marrow, and cardiac function; and a life expectancy of ≥3 months. Patients could have received up to 2 prior lines of chemotherapy for their metastatic disease. Exclusion criteria were known uncontrolled brain metastases; gastrointestinal disease that could impair study drug absorption; history or current signs / risk of retinal vein occlusion or central serous retinopathy; and concomitant therapy with medications known to be strong inhibitors of CYP1A2, CYP2D6, and CYP3A4 or strong inducers of CYP3A4. All participants provided informed consent before the start of any study procedures.
[0273] Patients who received at least one dose of BVD-523 were included in the analysis using SAS (version 9.3) software. The cutoff date was December 1, 2016. This study is registered with ClinicalTrials.gov, number NCT01781429.
[0274] The present invention provides data from an open-label, multicenter Phase I study to evaluate the safety, pharmacokinetics, and pharmacodynamics of escalating doses of BVD-523 in patients with advanced malignancies. The dosing regimen combines accelerated titration and a standard cohort 3+3 dose escalation regimen, which together are used to identify the MTD and RP2D of BVD-523 in patients with advanced solid tumors. One to six patients in each treatment group are assigned to sequentially receive higher oral doses of BVD-523 on a BID schedule (12-hour intervals) over a 21-day cycle, starting with a dose of 10 mg BID. BVD-523 is administered continuously BID over a 21-day cycle at the following doses: 10 mg (n=1); 20 mg (n=1); 40 mg (n=1); 75 mg (n=1); 150 mg (n=1); 300 mg (n=4); 600 mg (n=7); 750 mg (n=4); and 900 mg (n=7).
[0275] Patients receive BID oral doses until disease progression, unacceptable toxicity, or clinical observation that meets another exit criterion. Dose escalation occurs in increments of up to 100% in a single patient cohort until 1 patient experiences ≥ grade 2 toxicity (excluding alopecia or diarrhea). The cohort is then expanded to at least 3 patients per cohort, with subsequent dose escalation increments reduced from up to 100% to a maximum of 50%. When at least 1 patient experiences DLT in a 3-patient cohort, up to 3 additional patients are treated at that dose level. When more than 1 DLT occurs in ≤ 6 patients, the dose level is defined as a non-tolerable dose and dose escalation is stopped. Dose escalation within the patient is allowed, provided that the patient receiving the highest current dose has been observed for at least 3 weeks and less than 2 of the 6 patients assigned a given dose have reported dose-limiting side effects. Patients experiencing DLT or unacceptable toxicity interrupt their treatment until toxicity returns to ≤ grade 1. BVD-523 treatment is then resumed at the next lower dose level tested or with a 20% to 30% dose reduction (compared to capsule dose comparison).
[0276] The primary objective of the Phase I study is to determine the safety and tolerability of BVD-523 by determining dose-limiting toxicities, MTD, and RP2D. Secondary objectives include determining the pharmacokinetic characteristics of BVD-523 in patients with advanced malignancies and investigating any preliminary clinical effects on tumor response as assessed by physical or radiographic examination using RECIST v1.1. Exploratory objectives include evaluating biomarkers of efficacy and studying the effects of 18 Preliminary clinical effects on tumor response assessed by F-FDG-PET are shown.
[0277] For the purpose of determining the MTD, DLT, and RP2D, the MTD was defined as the highest dose cohort in which ≤33% of patients experienced a BVD-523-related DLT within the first 21 days of treatment. A DLT was defined as BVD-523-related toxicity within the first 21 days of treatment, resulting in ≥grade 4 hematologic toxicity lasting for >1 day; grade 3 hematologic toxicity with complications (e.g., thrombocytopenia with bleeding); grade ≥3 non-hematologic toxicity, excluding untreated nausea, vomiting, constipation, pain, and rash (if the AE persisted despite adequate treatment, these became DLTs); or treatment interruption of more than 3 days in cycle 1 (or inability to enter cycle 2 lasting >7 days) due to BVD-523-related toxicity.
[0278] The RP2D can be as high as the MTD and is determined in discussions with clinical investigators, medical monitors, and sponsors. The rationale supporting the RP2D includes observations related to pharmacokinetics, pharmacodynamics, and any cumulative toxicities observed after multiple cycles.
[0279] Regarding safety assessments, an AE is defined as any adverse medical event in a patient administered a medicinal product that is not necessarily causally related to BVD-523 and is coded using the MedDRA coding dictionary. An SAE is any adverse medical event occurring at any dose that results in death, is life-threatening, requires hospitalization or prolongs existing hospitalization, or causes persistent or significant disability / incapacity or congenital anomaly / birth defect. The severity of AEs is graded according to the National Cancer Institute Common Terminology Criteria for Adverse Events, Rating Scale, 4th Edition.
[0280] Safety assessments were performed at baseline on Days 8, 15, 22, 29, 36, and 43, and in patients continuing treatment, every 3 weeks or thereafter if clinically indicated. Each assessment included a physical examination and clinical laboratory studies. An electrocardiogram was repeated if clinically significant and at the investigator's discretion. AEs were judged by the investigator to be related to study drug and followed until resolved or stabilized, or the AE was judged to be no longer clinically significant.
[0281] For pharmacokinetic analysis, the pharmacokinetic population is composed of patients who receive at least one dose of BVD-523 and have evaluable pharmacokinetic data of plasma and / or urine. Before administration, blood samples were collected at 0.5 (± 5 minutes), 1 (± 5 minutes), 2 (± 10 minutes), 4 (± 10 minutes), 6 (± 10 minutes), 8 (± 10) and 12 (± 2 hours) hours after the morning dose on the 1st day (the 2nd visit; baseline / treatment start) and the 15th day (the 4th visit; steady state). On the 22nd day, before dose administration, a final blood sample was collected for pharmacokinetic analysis. Urine samples were collected at intervals of 1 to 6 hours and 6 to 12 ± 2 hours before and after administration on the 1st and 15th days. BVD-523 and metabolites of plasma and urine samples were analyzed using the LC / MS / MS method of validation. Standard pharmacokinetic parameters were obtained with a non-compartmental method using Phoenix WinNonlin (Pharsight). The relationship between dose and exposure was calculated using standard least-squares regression analysis.
[0282] For pharmacodynamic confirmation of target inhibition by BVD-523, targeted ERK inhibition by BVD-523 was determined by detecting pRSK as a target biomarker in human whole blood samples obtained from patients with advanced solid tumors (N=27) who received different doses of BVD-523 (10-900 mg BID) during a Phase I study. The activity of BVD-523 was expressed as the percentage activity (pRSK) of PMA-stimulated blood incubated with BVD-523 from four time points (before baseline, 4 hours after baseline, before day 15, and 4 hours after day 15).
[0283] To measure antitumor response, tumor measurements based on physical examination occurred at baseline and on the first day of each treatment cycle. CT and other assessments were performed every 2 to 3 cycles. Outcomes were assessed according to RECIST v1.1: CR was defined as disappearance of all target lesions; PR was defined as a ≥30% reduction in the sum of the longest diameters of target lesions, compared to baseline measurements; and stable disease was defined as neither sufficient shrinkage to qualify as a PR nor sufficient increase to qualify as progressive disease, compared to baseline measurements. 18 F-FDG-PET scanning to observe tumor 18 F-glucose uptake was used to assess metabolic responses.
[0284] Example 2
[0285] Dose escalation and proliferation assays - first month
[0286] Dose escalation progression - first month
[0287] A375 cells were dose-escalated using BVD-523, dabrafenib, and trametinib as single agents or in combination. During the first month, the dose was increased in small increments. Aside from a significant decrease in growth rate, the cells generally tolerated the escalation well, and the dose was planned to be escalated more aggressively using larger increments in month 2. Figures 1A-1C Showing progress in month 1 of the dose-escalation study.
[0288] Proliferation assay results - first month
[0289] Proliferation assays were performed to assess the response of the increasing cell lines versus the parental cell line to treatment with BVD-523, dabrafenib, and trametinib.
[0290] Figures 2A-2H Shown are the results of normalized and raw proliferation assays from month 1 of the study. Note the differences in maximum signal in the DMSO control between the different treatments ( Figure 2D 、 Figure 2F and Figure 2H ) indicate differential growth rates between treatments. These differences may affect the response of the cell lines to inhibitors in proliferation assays.
[0291] Table 10 shows the IC at month 1 of the study. 50 data.
[0292] Table 10-IC 50 Data - Month 1
[0293]
[0294] *Par = parental cell line
[0295] Early hints were that cells grown in the presence of increasing doses of dabrafenib or trametinib, either as single agents or in combination, showed reduced responses to both agents in proliferation assays.
[0296] In the early stages of month 2, the growth rate of cells in dabrafenib-only treatment increased significantly relative to the early stages of month 1. This increased the rate of progression and indicated that resistance was becoming apparent.
[0297] Example 3
[0298] Dose escalation and proliferation assays - month 2
[0299] Dose escalation progression - month 2
[0300] The second month of the study found that most treatments entered a phase where the dose was increased in larger increments (1.5-fold) compared to the initial gentle escalation phase. Single-agent escalation was fastest for dabrafenib and trametinib, with cells growing at concentrations equivalent to 100x the parental cell IC. 50 ( Figure 3A and Figure 3B Single-agent escalation of BVD-523 was slower than that of dabrafenib and trametinib ( Figure 3C ).See Figure 3D For comparison of single agent boosting, BVD-523 boosted cells had a more "fragile" appearance and a greater number of floating cells compared to dabrafenib and trametinib boosted populations.
[0301] Combination agent escalation resulted in slower progression than single-agent treatment. The BVD-523 / trametinib combination was particularly effective in preventing cell progression.
[0302] Proliferation assay results - second month
[0303] Proliferation assays of cell populations treated with single-agent dabrafenib and trametinib showed modest shifts in the dose-response curves, suggesting that additional escalation periods would be beneficial for further enrichment of resistant cells. Interestingly, in the proliferation assays, there was evidence that cells exposed to BVD-523 grew less well after inhibitor withdrawal, potentially indicating a level of addiction.
[0304] Figures 4A-4H Shown are the results of normalized and raw proliferation assays from month 2 of the study. Note the differences in maximum signal in the DMSO control between the different treatments ( Figure 4D 、 Figure 4F and Figure 4H) indicate differential growth rates between treatments. These differences may affect the response of the cell lines to inhibitors in proliferation assays.
[0305] Figures 5A-5H Shown are the results of normalized and raw proliferation assays from month 2 of the study, focusing on parental and BVD-523 line data only.
[0306] Table 11 shows the IC at month 2 of the study. 50 Data. Relative IC 50 Determined by 4-parameter curve fitting in Prism.
[0307] Table 11-IC 50 Data - Month 2
[0308]
[0309] *Par = parental cell line
[0310] Example 4
[0311] Dose escalation and proliferation assays - month three
[0312] Dose escalation progression - month 3
[0313] Figures 6A-6C Single and combination agent escalation through month 3 of the study are shown. Figure 6D Comparisons of single agent increments are shown.
[0314] Proliferation assay results - third month
[0315] Figure 7 Growth assessment during the proliferation assay in DMSO control wells is shown. Figures 8A-8D Results from month 3 of the study are shown. Figures 9A-9D Results are shown for month 3 of the study, focusing on single-treated cell lines.
[0316] Table 12 shows the IC at month 3 of the study. 50 Data. Relative IC 50 Determined by 4-parameter curve fitting in Prism. IC was not determined for the cell lines ramped with trametinib due to lack of growth during the assay period. 50 Value (ND: not performed).
[0317] Table 12-IC 50 Data - Month 3
[0318]
[0319] *Par = parental cell line
[0320] Figure 19 Single and combination agent escalation through month 3 of the study is shown. Cell line variants were obtained that could be administered to dabrafenib or trametinib at concentrations greater than the IC of these agents in parental A375 cells. 50 In contrast, cell lines resistant to BVD-523 could only be maintained at concentrations below the parental IC 50 Sensitivity testing showed that dabrafenib- or trametinib-resistant cell lines remained relatively sensitive to BVD-523; the IC of BVD-523 in resistant cell lines was 10 times that of 50 The “shifted” increase was greater than the corresponding IC after dabrafenib or trametinib treatment. 50 Likewise, when treated with dabrafenib or trametinib at concentrations equal to their IC in the parental A375 line, the increase was more modest. 50 More complete cell growth inhibition was observed when the resistant cell line was treated with a 10-fold higher dose of BVD-523. Overall, the pattern of resistance and cross-sensitivity suggests that BVD-523 may remain effective in the setting of acquired resistance.
[0321] Example 5
[0322] Combined study results
[0323] As expected, A375 cells carrying the BRAF(V600E) mutation were sensitive to dabrafenib. Figures 11A-11E 、 Figures 13A-13E and Figures 15A-15E ) compared to the single reagent IC calculated using Alamar Blue. 50 value( Figures 10A-10E 、 Figures 12A-12E and Figures 14A-14E ) are generally slightly lower for dabrafenib and BVD-523. In the 72-hour CellTiter-Glo assay, the published IC 50 The values for the Bliss assay were 28 ± 16 nM and 5 ± 3 nM, respectively (Greger et al., 2012; King et al., 2013)—values consistent with the single-agent results reported here. There was some evidence that all treatments had a window of synergy. Variability between triplicates was minimal; however, there was some evidence of edge effects, which may explain the apparent enhanced growth observed in some treatments compared to the no-drug control (e.g., particularly evident in the trametinib / BVD-523 combination). This makes interpretation of the Bliss assay more challenging, as it may lead to an artificial increase in the level of synergy in some treatments.
[0324] The combination assay was repeated on A375 cells. Single agent BVD-523, trametinib, and dabrafenib potencies were consistent with those reported in previous studies disclosed herein.
[0325] Taken together, the combined data show that MEK- and BRAF-resistant cells can be overcome by treatment with the ERK inhibitor BVD-523.
[0326] Example 6
[0327] BVD-523 alters markers of MARK kinase activity and effector functions
[0328] For Western blot studies, HCT116 cells (5 × 10 6 ) were seeded into 10 cm culture dishes in McCoy's 5A plus 10% FBS. A375 cells (2.5×10 6 ) were seeded into 10cm culture dishes in DMEM plus 10% FBS. Before adding a specified amount of test compound (BVD-523) or vehicle control, cells were allowed to adhere overnight. Before separating whole-cell protein lysates, cells were treated for 4 or 24 hours, as described below. Cells were harvested, precipitated and quickly frozen by trypsin digestion. Lysates were prepared with RIPA (radioimmunoprecipitation assay) buffer, clarified by centrifugation and quantified by bicinchoninic acid assay (BCA) assay. 20-50 μg of protein was resolved by SDS-PAGE electrophoresis, blotted on a PVDF membrane, and probed using the antibodies detailed in Table 13 (for 4 hour processing) and Table 14 (for 24 hour processing).
[0329] Table 13 - Antibody Details
[0330]
[0331]
[0332]
[0333] Table 14 - Antibody Details
[0334]
[0335]
[0336] Figures 16A-16D 、 Figures 17A-17D and Figures 18A-18BWestern blot analysis of cells treated with various concentrations of BVD-523 is shown as follows: 1) MAPK signaling components in A375 cells after 4 hours; 2) cell cycle and apoptosis signaling in A375 cells treated with varying amounts of BVD-523 for 24 hours; and 3) MAPK signaling in HCT-116 cells treated for 4 hours. The results demonstrate that both acute and chronic treatment of RAF and RAS mutant cancer cells with BVD-523 in vitro affect substrate phosphorylation and effector targets of ERK kinases. The concentrations of BVD-523 required to induce these changes are generally in the low micromolar range.
[0337] Changes in several specific activity markers were noteworthy. First, the abundance of the slow-migrating isoform of the ERK kinase increased after BVD-523 treatment; modest changes were observed acutely and increased after prolonged treatment. While this may indicate an increase in the enzymatically active, phosphorylated form of ERK, it is still noteworthy that multiple proteins directly and indirectly regulated by ERK remained "off" after BVD-523 treatment. First, the RSK1 / 2 proteins showed reduced phosphorylation at residues that are strictly dependent on ERK for protein modification (T359 / S363). Second, BVD-523 treatment induced complex changes in the MAPK feedback phosphatase DUSP6: the slow-migrating protein isoform was reduced after acute treatment, while total protein levels were greatly reduced after prolonged BVD-523 treatment. Both findings are consistent with reduced activity of the ERK kinase, which controls DUSP6 function through post-translational and transcriptional mechanisms. Overall, despite an increase in cellular forms of ERK, which are generally considered active, it appears that cellular ERK enzymatic activity may be completely inhibited following acute or chronic treatment with BVD-523.
[0338] Consistent with these observations, effector genes requiring MAPK pathway signaling were altered following treatment with BVD-523. G1 / S cell cycle apparatus are regulated at the post-translational and transcriptional levels by MAPK signaling, and cyclin D1 protein levels were greatly reduced following prolonged BVD-523 treatment. Similarly, gene expression and protein abundance of apoptotic effectors generally require intact MAPK signaling, and total levels of Bim-EL were increased following prolonged BVD-523 treatment. However, as described above, PARP protein cleavage and increased apoptosis were not noted in the A375 cell background; this suggests that other factors may influence whether changes in BVD-523 / ERK-dependent effector signaling translate into definitive events, such as cell death and cell cycle arrest.
[0339] Consistent with the cellular activity of BVD-523, marker analysis indicated that ERK inhibition altered multiple molecular signaling events in cancer cells, rendering them susceptible to both reduced cell proliferation and survival.
[0340] In short, Figures 16A-16D 、 Figures 17A-17D and Figures 18A-18D BVD-523 was shown to inhibit the MAPK signaling pathway and may compare more favorably to RAF or MEK inhibition in this setting.
[0341] Finally, the properties of BVD-523 may make it a preferred agent for use as an ERK inhibitor compared to other agents with similar activity. Kinase inhibitor drugs are known to display unique and specific interactions with their enzymatic targets, and drug efficacy is strongly influenced by the direct mode of inhibition as well as susceptibility to adaptive changes that occur after treatment. For example, inhibitors of ABL, KIT, EGFR, and ALK kinases are only effective when their cognate targets are present in either active or inactive configurations. Similarly, some of these inhibitors are uniquely sensitive to secondary genetic mutations or post-translational adaptive changes in their protein targets. Finally, RAF inhibitors exhibit varying potency against RAF kinases present in certain protein complexes and / or subcellular localizations. In summary, since ERK kinases are similarly known to exist in a variety of diverse, variable, and complex biochemical states, it seems likely that BVD-523 may interact with and inhibit these targets in a manner that is different and highly preferred than other agents.
[0342] Example 7
[0343] Effects of BVD-523 and benchmark ERK, BRAF, and MEK inhibitors on viability and MARK signaling
[0344] Single-reagent proliferation assay
[0345] Cells were seeded in 96-well plates at the density shown in Table 15 in McCoy's 5A containing 10% FBS and allowed to adhere overnight before adding compounds or vehicle control. Compounds were prepared from DMSO stocks to give the desired final concentration. The final DMSO concentration was constant at 0.1%. Test compounds were incubated with cells at 37°C, 5% CO2 in a humidified atmosphere for 96 hours. Addition of 5% FBS was performed according to the manufacturer's instructions. The reagents were added (Promega, Madison, WI), and luminescence was detected using a BMG FLUOstar plate reader (BMG Labtech, Ortenberg, Germany). The average medium-only background was subtracted and the data were analyzed using a 4-parameter logistic equation in GraphPad Prism (GraphPad Software, La Jolla, CA).
[0346] Combined proliferation assay
[0347] Cells were seeded into triplicate 96-well plates at the density shown in Table 15 in McCoy's 5A containing 10% FBS and allowed to adhere overnight before adding test compounds or vehicle control. Combinations were tested using a 10x8 dose matrix. The final DMSO concentration was constant at 0.2%.
[0348] The test compounds were incubated with the cells at 37°C in a humidified atmosphere of 5% CO2 for 96 hours. The cells were stained with Hoechst stain and fluorescence was detected as described above. The data were analyzed after subtracting the average medium-only background value.
[0349] Using Chalice TM Combination analysis software (Horizon Discovery Group, Cambridge, MA) determined combinatorial interactions for the dose matrix using the Loewe additivity and Bliss independence models as described in the user manual (available at chalice.horizo ndiscovery.com / chalice-portal / documentation / analyzer / home.jsp). Synergy was determined by comparing the experimentally observed inhibition level for each combination point to the expected value for addition, which was obtained from the single agent responses along the edge of the matrix. Potential synergistic interactions were identified by showing the calculated excess inhibition over that predicted for addition in the dose matrix as a heat map and by reporting a quantitative 'synergy score' based on the Loewe model. Single agent data from the combination assay panel were presented as TM Dose-response curves were generated in .
[0350] Table 15 - Cell line seeding density
[0351]
[0352] Western blotting
[0353] Cells were seeded into 6-well plates (Experiment 1) or 10 cm dishes (Experiment 2) at the density shown in Table 15 in McCoy's 5A containing 10% FBS and allowed to adhere overnight before adding the compound or vehicle control. Test compounds were added and incubated with the cells at 37°C, 5% CO2 in a humidified atmosphere for 4 or 24 hours. Cells were harvested by trypsinization, pelleted by centrifugation, and quickly frozen on dry ice.
[0354] Lysates were prepared using RIPA buffer (50 mM Tris-HCl, pH 8.0; 150 mM sodium chloride; 1.0% Igepal CA-630 (NP-40); 0.5% sodium deoxycholate; 0.1% sodium dodecyl sulfate; 1× Complete EDTA-free protease inhibitor cocktail (Roche, Nutley, NJ; cat. 05 892 791 001); 1× phosSTOP phosphatase inhibitor cocktail (Roche Nutley, NJ; cat. 04 906 837 001)) and cleared by centrifugation at 11,000 rpm in a benchtop centrifuge for 10 minutes.
[0355] According to the manufacturer's instructions (Pierce TM Total protein in lysates was quantified by BCA assay (BCA Protein Assay Kit; Thermo Scientific, Waltham, MA; cat. no. 23225), boiled in sample buffer (NuPAGE LDS sample buffer; (Invitrogen, Carlsbad, CA; cat. NP0007)), and stored at -80°C.
[0356] Equal amounts of protein (40 μg) were resolved on NuPAGE 4-12% Bis-Tris gels (Invitrogen, Carlsbad, CA; catalog number WG1402BOX) and blotted onto PVDF membranes using an iBlot gel transfer stack (Invitrogen, Carlsbad, CA, catalog number IB4010-01) on an iBlot gel transfer apparatus (Invitrogen Carlsbad, CA) according to the manufacturer's instructions.
[0357] Blots were probed using the antibodies and blocking conditions detailed in Table 16. Pierce TMWestern blots were developed with ECL2 Western Blotting Substrate (Thermo Scientific, Waltham, MA; Cat. No. 80196) and imaged using a FluorChem M Western Blot Imager (ProteinSimple, San Jose, CA).
[0358] Table 16 - Antibodies and Western Blot Conditions
[0359]
[0360]
[0361] The MEK1(Q56P) mutation exemplifies a class of clinically relevant MEK1 / 2 activating mutations that are known to upregulate the MAPK pathway and drive acquired resistance to BRAF or MEK inhibitors.
[0362] This study used a pair of RKO BRAF(V600E) cell lines, isogenic for the presence or absence of a MEK1(Q56P) activating mutation, to assess the role that activating MEK mutations have in response to the novel ERK inhibitor BVD-523 versus other benchmark MAPK inhibitors.
[0363] By using after 96 hours Cellular ATP levels were quantified to assess the effect on cell viability. Single agent assays demonstrated that double mutant BRAF(V600E)::MEK1(Q56P) cells exhibited significantly reduced sensitivity to inhibition by benchmark clinical BRAF (e.g., dabrafenib) or MEK (e.g., trametinib) inhibitors relative to parental BRAF(V600E) cells, demonstrating that this isogenic model is suitable for recapitulating the acquired resistance known to be associated with this mutation in the clinic (Table 17).
[0364] Table 17 - Single Reagent IC 50 value
[0365]
[0366]
[0367] nd = not determined, only partial dose response obtained
[0368] In contrast, the response to BVD-523 was identical in both parental and double mutant cells, indicating that BVD-523 is insensitive to this mechanism of acquired resistance.
[0369] These results were identical in two independently derived double-mutant BRAF(V600E)::MEK1(Q56P) cell line clones, confirming that these differences in response compared to parental cells are specifically related to the presence of the MEK1 mutation and not to unrelated clonal artifacts ( Figures 22A-22E Similar results were observed using a second, mechanistically distinct, benchmark ERK inhibitor (SCH772984), supporting the view that these observations are specifically related to inhibition of ERK and not due to off-target effects.
[0370] Chalice using Loewe additivity or Bliss independence models with Horizon TM Combination analysis software, also evaluated the effects of BVD-523 in combination with BRAF inhibitors (e.g., dabrafenib) across a concentration matrix in these cell lines (Figure 23- Figure 23O and Figures 24A-24O The presence of potential synergistic interactions was then assessed by displaying the calculated excess inhibition over what would be expected to be additive in the dose matrix as a heat map, and by calculating a 'volume fraction' showing whether the overall response to the combination was synergistic (positive values), antagonistic (negative values), or additive (-0).
[0371] The results showed that the BVD-523::dabrafenib combination was primarily additive in both parental and mutant cell lines. In contrast, the combination of a MEK inhibitor (trametinib) plus dabrafenib, while primarily additive in the parental cell line, showed strong synergy in the double mutant BRAF(V600E)::MEK1(Q56P) cell line ( Figures 25A-25O ). The Loewe volume, Bliss volume and synergy scores of the test combinations are shown in Tables 18-20, respectively, and Figures 26A-26C The diagram is shown in the figure.
[0372] Table 18-Loewe volume
[0373]
[0374]
[0375] Table 19 - Bliss Volume
[0376]
[0377] Table 20 - Synergy Scores
[0378]
[0379] Significant effects on the MAPK pathway were assessed by Western blotting. Basal ERK phosphorylation levels (DMSO samples) were significantly upregulated in the MEK1(Q56P)-expressing line relative to the parental line, further confirming that this isogenic model faithfully recapitulates the expected phenotype of expression of a MEK-activating acquired resistance mutation.
[0380] In parental BRAF(V600E)RKO cells, reduced levels of RSK1 / 2 phosphorylation were observed after acute treatment with pharmacologically active concentrations of RAF, MEK, and ERK kinase inhibitors. In contrast, isogenic double mutant BRAFV600E::MEK1Q56P cells did not exhibit reduced RSK phosphorylation after treatment with BRAF or MEK inhibitors, while BVD-523 remained effective at similar concentrations ( Figures 27A-27I ). Dashed lines indicate trametinib-treated samples (plus matching DMSO controls) and blots are from separate experiments with BRAFi- and BVD-523-treated samples.
[0381] Following prolonged inhibitor treatment, changes in effector gene signaling were observed that were consistent with a pattern of cell growth inhibition. In the parental RKO line, reduced levels of phosphorylated pRB were observed following prolonged treatment with MEK and ERK inhibitors. At the level of pRB regulation, the MEK1 mutant line appeared insensitive to treatment with low concentrations of MEK inhibitors, while higher concentrations remained effective. Crucially, the potency of BVD-523 against pRB activity did not appear to be strongly affected by the MEK mutation. Surprisingly, despite effective inhibition of upstream signaling in both the parental and MEK mutant backgrounds, RAF inhibitor treatment did not affect pRB status.
[0382] Together, these results show that BVD-523 is not susceptible to acquired resistance driven by MEK-activating mutations, such as MEK1(Q56P). Furthermore, they suggest that the interaction between BVD-523 and BRAFi (e.g., dabrafenib) in combination is additive, regardless of the presence of MEK-activating mutations.
[0383] Example 8
[0384] Combinatorial interactions between ERK inhibitors
[0385] RAF mutant melanoma cell line A375 cells were cultured in DMEM containing 10% FBS and seeded into 96-well plates in triplicate at an initial density of 2000 cells per well. The combinatorial interaction between the ERK inhibitors BVD-523 and SCH772984 was analyzed after 72 hours as described in Example 4 above. Viability was determined using a BMG FLUOstar plate reader (BMG Labtech, Ortenberg, Germany).
[0386] Visualization of the Loewe and Bliss 'overdose inhibition' heat map indicates that the combination of BVD-523 and SCH772984 is primarily additive, with a window of potential synergy in the mid-range dose range ( Figures 28A-28E ).
[0387] Together, these results suggest that the interaction between BVD-523 and SCH772984 is at least additive and, in some cases, synergistic.
[0388] Example 9
[0389] Targeting MAPK signaling pathways in cancer: Promising activity with the novel selective ERK1 / 2 inhibitor BVD-523 (Ulixertinib)
[0390] Cancer treatment strategies have evolved from classical cytotoxicity-based approaches to agents that counteract the effects of genetic lesions that drive aberrant signaling essential for tumor proliferation and survival. For example, in addition to constitutively activating mutations in pathway components such as RAS and BRAF (Gollob et al., 2006), the ERK module of the mitogen-activated protein kinase (MAPK) signaling cascade (RAS-RAF-MEK-ERK) (Cargnello and Rouxx 2011) can involve several receptor tyrosine kinases (e.g., EGFR and ErbB-2). Through aberrant activation of ERK signaling, genetic alterations in RAS or BRAF lead to rapid tumor growth, increased cell survival, and resistance to apoptosis (Poulikakos et al., 2011, Corcoran et al., 2010, Nazarian et al., 2010, Shi et al., 2014, Wagle et al., 2011). Activating mutations in the RAS family members KRAS and NRAS account for approximately 30% of all human cancers, with a particularly high incidence in pancreatic cancer (Kanda et al., 2012) and colorectal cancer (Arrington et al., 2014). Constitutive activating mutations in the BRAF gene, which normally encodes valine at amino acid 600, have been observed in melanoma, thyroid cancer, colorectal cancer, and non-small cell lung cancer (Hall et al., 2014). Cancers carrying mutations that result in alterations in the downstream components ERK and MEK have also been reported (Ojesina et al., 2014, Arcila et al., 2015). Alterations in the activation of the MAPK pathway are also common in cases of resistance to targeted therapies (Groenendijk et al., 2014). Therefore, targeting the terminal master kinases of the MAPK pathway (ERK1 / 2) is a promising strategy for tumors with alterations in this pathway activation (e.g., BRAF, NRAS, and KRAS).
[0391] Three MAPK pathway-targeting drugs have been approved by the U.S. Food and Drug Administration (FDA) for single-agent treatment of BRAF-positive patients. V600 Unresectable or metastatic cutaneous melanoma with a BRAF mutation: The BRAF inhibitors vemurafenib and dabrafenib and the MEK inhibitor trametinib. In addition, the combination of dabrafenib and trametinib is also approved for this indication (Queirolo et al., 2015 and Massey et al., 2015). Another MEK inhibitor, cobimetinib, is approved for this indication as part of a combination regimen with a BRAF inhibitor. Clinical experience with these agents has confirmed that the MAPK pathway is a therapeutic target. V600In phase III trials of patients with mutant melanoma, single-agent vemurafenib and dabrafenib demonstrated superior response rates (approximately 50% vs. 5-19%) and median progression-free survival (PFS, 5.1-5.3 months vs. 1.6-2.7 months), exceeding that of cytotoxic chemotherapy (dacarbazine) (Chapman et al., 2011 and Hauschild et al., 2012). In addition, clinical applications of concomitant BRAF-plus-MEK targeted therapies have demonstrated that simultaneous targeting of different nodes in the MAPK pathway can enhance the magnitude and duration of response. First-line use of BRAF plus MEK-targeted agents (dabrafenib / trametinib or cobimetinib / vemurafenib) further improved median overall survival compared to single-agent BRAF inhibition (Robert et al., 2015, Long et al., 2015, Larkin et al., 2014). Therefore, for patients with BRAF V600 Combined BRAF- / MEK-targeted therapy is a valuable treatment option for patients with metastatic melanoma harboring these mutations.
[0392] Although improvements in clinical outcomes have been observed with BRAF- / MEK-inhibitor combination therapy, durable benefit is limited by the eventual development of acquired resistance and subsequent disease progression, with median PFS ranging from approximately 9 to 11 months (Robert et al., 2015, Long et al., 2015, Larkin et al., 2014, and Flaherty et al., 2012). The genetic mechanisms of acquired resistance to single-agent BRAF inhibition have been intensively studied, and resistance mechanisms have been identified including splice variants of BRAF (Poulikakos et al., 2011), BRAF V600EAmplification (Corcoran et al., 2010), MEK mutation (Wagle et al., 2014), NRAS mutation and RTK activation (Nazarian et al., 2010 and Shi et al., 2014). Resistance mechanisms in the context of BRAF- / MEK-inhibitor combination therapy are beginning to emerge and mirror the mechanisms of resistance to BRAF single agents (Wagle et al., 2014 and Long et al., 2014). These genetic events all share the ability to reactivate ERK signaling. In fact, reactivated MAPK pathway signaling, as measured by ERK transcriptional targets, is common in tumor biopsies from patients with BRAF inhibitor resistance (Rizos et al., 2014). In addition, ERK1 / 2 reactivation has been observed in the absence of genetic mechanisms of resistance (Carlino et al., 2015). Therefore, the quest to achieve lasting clinical benefits has focused researchers on evaluating other agents targeting the downstream MAPK component ERK1 / 2. Inhibiting ERK may provide important clinical benefits for patients with acquired resistance to BRAF / MEK inhibition. The ERK family of kinases has shown promise as therapeutic targets in preclinical cancer models, including those resistant to BRAF or MEK inhibitors (Morris et al., 2013 and Hatzivassiliou et al., 2012). However, the potential use of ERK1 / 2 inhibitors extends beyond acquired resistance in melanoma.
[0393] Targeting ERK1 / 2 is a reasonable strategy in any tumor type with known drivers of MAPK, not just BRAF / MEK therapy for relapsed patients. Because ERK1 and ERK2 are located downstream of the pathway, they represent a particularly attractive therapeutic strategy in the MAPK cascade that can avoid upstream resistance mechanisms. Here, the preclinical characteristics of BVD-523 (ulixertinib) in MAPK pathway-dependent cancer models are reported, including drug-naive and BRAF / MEK therapy acquired resistance models. The results of the Phase I dose-finding study of BVD-523 are included as a companion publication to this journal. See Examples 17-24.
[0394] In the present invention, BVD-523 is shown to be a potent, highly selective, reversible, small-molecule ATP-competitive inhibitor of ERK1 / 2 with anticancer activity in vitro and in vivo.
[0395] BVD-523 (ulixertinib) was identified and characterized as a novel, reversible, ATP-competitive ERK1 / 2 inhibitor with high efficacy and ERK1 / 2 selectivity. BVD-523 caused decreased proliferation and increased caspase activity, most pronounced in cells harboring mutations in the MAPK (RAS-RAF-MEK) pathway. V600E In xenograft studies, BVD-523 demonstrated dose-dependent growth inhibition and tumor regression. Interestingly, despite increased phosphorylation of ERK1 / 2, BVD-523 inhibited target substrate phosphorylation. BVD-523 also demonstrated antitumor activity in models of acquired resistance to single-agent and combined BRAF / MEK targeted therapies. BRAF inhibition was also demonstrated when BVD-523 was used in combination with BRAF inhibition. V600E "These studies suggest that BVD-523 may have potential as a treatment for ERK-dependent cancers, including those whose tumors have acquired resistance to other therapies targeting upstream nodes in the MAPK pathway."
[0396] Example 10
[0397] Discovery and preliminary characterization of a novel ERK1 / 2 inhibitor, BVD-523 (Ulixertinib)
[0398] Following extensive optimization of leads initially identified using high-throughput small-molecule screening (Aronov et al., 2009), the novel adenosine triphosphate (ATP)-competitive ERK1 / 2 inhibitor BVD-523 (ulixertinib) ( Figure 29A BVD-523 is a potent ERK inhibitor with a Ki of 0.04 ± 0.02 nM for ERK2. It is shown to be a reversible competitive inhibitor of ATP, as the IC of ERK2 inhibition is 50 The value increases linearly with the increase of ATP concentration ( Figure 29B and Figure 29C For incubation times ≥ 10 min, IC 50 remained almost constant, indicating that BVD-523 rapidly equilibrated and bound to ERK2 ( Figure 29D BVD-523 is also a tight binding inhibitor of recombinant ERK1 (Rudolph et al., 2015), showing Ki < 0.3 nM.
[0399] Calorimetric studies were used to demonstrate the binding of BVD-523 to ERK2 and compared with data generated using the ERK inhibitors SCH772984 and pyrazolylpyrrole (Arovov et al., 2007). All compounds bound to and stabilized inactive ERK2 at increasing concentrations, as indicated by positive ΔTm values ( Figure 29E The 10 to 15 degree shift in ΔTm observed with BVD-523 and SCH-772984 is consistent with compounds having low nanomolar binding affinities (Fedorov et al., 2012). BVD-523 exhibits strong binding affinity to both phosphorylated active ERK2 (pERK2) and inactive ERK2 ( Figure 29F A stronger affinity for pERK2 was observed compared to inactive ERK2. BVD-523 did not interact with the negative control protein p38α MAP kinase ( Figure 29F ).
[0400] In addition to ERK1 and ERK2, BVD-523 showed excellent selectivity for ERK1 / 2 kinases based on a biochemical counterscreen against 75 kinases. In all assays, the ATP concentration was approximately equal to the K m Kinases that were inhibited by >50% by 2 μM BVD-523 were retested to generate K i Value (or apparent K i ; Table 21). Twelve of the 14 kinases had a K < 1 μM i BVD-523 exhibited >7000-fold selectivity for ERK2 across all tested kinases except ERK1, with ERK1 inhibited with a Ki of <0.3 nM (10-fold). Thus, BVD-523 is a highly potent and selective inhibitor of ERK1 / 2.
[0401] Table 21 - BVD-523 shows selectivity for ERK1 and ERK2 kinases.
[0402]
[0403]
[0404] Example 11
[0405] BVD-523 preferentially inhibits cell proliferation and enhances caspase-3 / 7 activity in vitro in cancer cell lines harboring MAPK pathway-activating mutations
[0406] BVD-523 cell viability was evaluated in a panel of approximately 1,000 cancer cell lines of diverse lineages and genetic backgrounds ( Figure 30A(Table 22). Cell lines were classified as MAPK wild-type (wt) or mutant based on the absence or presence of mutations in RAS family members and BRAF. Although some MAPK-wt cell lines were sensitive to BVD-523, BVD-523 generally preferentially inhibited proliferation in cells with altered MAPK pathways.
[0407] Next, we characterized the effects of BVD-523 treatment on the growth and survival of sensitive cells. V600E Fluorescence activated cell sorting (FACS) analysis was performed on the mutant melanoma cell line UACC-62. The treated cells arrested in the G1 phase of the cell cycle in a concentration-dependent manner. Figure 30B ).
[0408] In addition, caspase-3 / 7 activity was analyzed as a measure of apoptosis in various human cancer cell lines. A concentration- and cell line-dependent increase in caspase-3 / 7 was observed after 72 h of treatment with BVD-523 ( Figure 30C ). BVD-523 treatment of BRAF V600 BVD-523 resulted in significant caspase-3 / 7 induction in a subset of cell lines with mutant MAPK activation (A375, WM266, and LS411N). This is consistent with previous observations that BVD-523 preferentially inhibits proliferation in MAPK pathway-mutant cancer cell lines ( Figure 30A ).
[0409] To further characterize the mechanism of action and the effect on BVD-523-induced signaling, BRAF V600E - mutant A375 melanoma cells were evaluated for the levels of various effector proteins and MAPK-related proteins ( Figure 30D ). Phospho-ERK1 / 2 levels increased in a concentration-dependent manner after 4 and 24 hours of BVD-523 treatment. Although a prominent concentration-dependent increase in pERK1 / 2 was observed with 2 μM BVD-523 treatment, phosphorylation of the ERK1 / 2 target RSK1 / 2 was reduced at both 4 and 24 hours, consistent with sustained inhibition. Total protein levels of DUSP6, a distal marker of ERK1 / 2 activity, were also attenuated at 4 and 24 hours. After 24 hours of treatment with BVD-523, the apoptosis marker BIM-EL increased in a dose-dependent manner, while cyclin D-1 and pRB were attenuated at 2 μM. All effects were consistent with targeted ERK1 / 2 inhibition.
[0410] Example 12
[0411] BVD-523 in BRAF V600EMutant cancer cell line xenograft models show in vivo anti-tumor activity
[0412] Based on our in vitro findings that BVD-523 reduced proliferation and induced apoptosis in a concentration-dependent manner, we administered BVD-523 by oral gavage to demonstrate in vivo antitumor activity in models that are MAPK / ERK pathway-dependent. Xenograft models of melanoma (cell line A375) and colorectal cancer (cell line Colo205) were used, both of which carry BRAF V600E mutation.
[0413] In A375 cell line xenografts, BVD-523 efficacy was compared with the control cytotoxic alkylating agent temozolomide after 14 days of treatment. BVD-523 demonstrated significant dose-dependent antitumor activity starting at 50 mg / kg twice daily (BID). Figure 31A Doses of 50 and 100 mg / kg BID significantly attenuated tumor growth, with tumor growth inhibition (TGI) of 71% (P=0.004) and 99% (P<0.001), respectively. Seven partial regressions (PRs) were noted in the 100 mg / kg BID group; no regression responses were found in any other group. The observed efficacy was superior to that of temozolomide, which, when administered at 75 and 175 mg / kg, resulted in modest, dose-dependent TGIs of 34% (P>0.05) and 78% (P=0.005), respectively.
[0414] In addition, BVD-523 showed antitumor efficacy in the Colo205 human colorectal cancer cell line xenograft model ( Figure 31B ). BVD-523 again demonstrated significant dose-dependent tumor regression at doses of 50, 75, and 100 mg / kg BID, with mean tumor regressions T / Ti (T = end of treatment, Ti = start of treatment) of -48.2%, -77.2%, and -92.3%, respectively (all P < 0.0001). No regression was observed at the lowest dose of BVD-523 (25 mg / kg BID); however, significant tumor growth inhibition was observed with a T / C (T = treatment, C = control) of 25.2% (P < 0.0001). Although poorly tolerated, the positive control chemotherapeutic agent irinotecan (CPT-11) demonstrated significant antitumor activity, inhibiting Colo205 tumor growth with a T / C of 6.4% (P < 0.0001). However, even at its maximum tolerated dose in mice, CPT-11 was less effective than BVD-523 at doses of 50, 75, or 100 mg / kg BID.
[0415] To establish a relationship between pharmacokinetics and pharmacodynamics, BVD-523 plasma concentrations were compared with pERK1 / 2 levels measured in tumors by immunohistochemistry and isotope-labeled internal standard mass spectrometry over a 24-hour period following a single 100 mg / kg oral dose of BVD-523 ( Figure 31C In untreated tumors, ERK1 / 2 phosphorylation was low (0 hours). Following treatment with BVD-523, ERK1 / 2 phosphorylation steadily increased from 1 hour post-dose to a maximum level 8 hours post-dose, then returned to pre-dose levels after 24 hours. This increase in pERK1 / 2 correlated with BVD-523 drug plasma concentrations. The in vivo observation of increased pERK1 / 2 with BVD-523 treatment is consistent with earlier in vitro findings ( Figure 30D ).
[0416] Example 13
[0417] Despite increased ERK1 / 2 phosphorylation, BVD-523 leads to ERK1 / 2 substrate inhibition
[0418] To examine the effects of BVD-523 on signaling relative to other known ERK1 / 2 inhibitors (SCH772984, GDC-0994, and Vx-11e) (Morris et al., 2013 and Liu et al., 2015), a large-scale reverse phase protein array (RPPA) of approximately 40 proteins was used in multiple cell lines sensitive to ERK inhibition. Cell lines with common alterations in BRAF and RAS were assayed: BRAF V600E Mutation lines A375, Colo205, and HT29; KRAS G12C -Mutant cell line MIAPACa-2;KRAS G13D - mutant cell line HCT116; and cells with atypical HRAS F82L Changes in mutant AN3Ca protein levels are shown as percentage changes compared to the dimethyl sulfoxide (DMSO)-treated parental control ( Figure 32A and Table 23). All ERK inhibitors elicited qualitatively similar protein effects, with the exception of phosphorylation of ERK1 / 2 (pERK1 / 2 [ERK1 / 2-T202, -Y204]); SCH7722984 inhibited pERK1 / 2 in all cell lines, whereas BVD-523, GDC-0994, and Vx-11e significantly increased pERK1 / 2. Phospho-p90 RSK (pRSK1) and cyclin D1, proximal and distal targets of pERK1 / 2, respectively, were similarly inhibited by all tested inhibitors, regardless of the extent of ERK1 / 2 phosphorylation ( Figure 32BThese independent findings with BVD-523 are consistent with studies showing that phosphorylation of the ERK1 / 2 substrate RSK1 / 2 remains inhibited despite significantly elevated pERK1 / 2 by Western blotting in A375 cells ( FIG32D ), as well as protein binding studies demonstrating that BVD-523 binds to and stabilizes pERK1 / 2 and inactive ERK1 / 2 ( Figure 29E and Figure 29F Therefore, measuring increased pERK1 / 2 levels can be considered a clinical pharmacodynamic biomarker for BVD-523, while quantifying the inhibition of ERK1 / 2 targets such as pRSK1 and DUSP6 may also serve a similar purpose.
[0419] Additional protein changes were noted in this RPPA dataset ( Figure 32A ). Reduced pS6-ribosomal protein appears to be another pharmacodynamic marker of ERK1 / 2 inhibition, as demonstrated in all cell lines with all compounds ( Figure 32B Furthermore, the significant induction of pAKT appeared to be a cell line dependent observation, with each ERK1 / 2 inhibitor inducing pAKT in the cell lines A375 and AN3CA cells ( Figure 33 Interestingly, the extent of inhibition of the survival marker pBAD appeared to vary between compounds, with GDC-0994 only modestly inhibiting pBAD compared to other ERK1 / 2 inhibitors tested ( Figure 32A ).
[0420] Next, we investigated how BVD-523 affects BRAF. V600E - Cellular localization of ERK1 / 2 and its downstream target pRSK in mutant RKO colorectal cell lines ( Figure 32C In resting cells, ERK1 / 2 is localized in the cytoplasm, and upon stimulation, pERK1 / 2 migrates to target organelles, particularly the nucleus where transcriptional targets are activated (Wainstein et al., 2016). In DMSO-treated control cells, pERK1 / 2 is evident in both nuclear and cytoplasmic fractions, due to the presence of BRAF in this cell line. V600E, which may reflect MAPK pathway activity. Treatment with BVD-523 resulted in elevated pERK1 / 2 in the nucleus and cytoplasm and a modest increase in total nuclear ERK1 / 2 compared to DMSO-treated cells, suggesting that compound-induced pERK1 / 2 stabilization stimulates some nuclear translocation. Although pERK1 / 2 was increased in both compartments, pRSK levels were lower in the cytoplasmic and nuclear compartments compared to DMSO controls. Comparator MAPK signaling inhibitors (i.e., trametinib, SCH7722984, dabrafenib) inhibited phosphorylation of ERK1 / 2 and RSK, as reflected by lower levels in the nuclear and cytoplasmic compartments. These data again indicate that the BVD-523-associated increase in pERK1 / 2 is evident in both the cytoplasm and the nucleus; however, this does not imply activation of target substrates. This is consistent with Figure 30D and Figure 32A The data presented in .
[0421] Example 14
[0422] BVD-523 shows activity in in vitro models of BRAF and MEK inhibitor resistance
[0423] The emergence of resistance to BRAF and MEK inhibitors limits their clinical efficacy. Here, experiments sought to model and compare in vitro the development of resistance to BRAF (dabrafenib), MEK (trametinib), and ERK1 / 2 (BVD-523) inhibition. Within a few months, BRAF V600E -mutant A375 cells were cultured in increasing concentrations of each inhibitor. Drug-resistant A375 cell lines were readily obtained after growth in high concentrations of trametinib or dabrafenib, whereas developing a cell line resistant to BVD-523 proved challenging ( Figure 34A Taken together, these in vitro data suggest that, at concentrations that produce similar target inhibition, the delayed onset of resistance to BVD-523 compared with dabrafenib or trametinib may translate into durable responses in the clinic.
[0424] Reactivation and dependence on ERK1 / 2 signaling are common features of acquired resistance to BRAF / MEK inhibition (Morris et al., 2013 and Hatzivassiliou et al., 2012); therefore, the activity of BVD-523 in an in vitro model of acquired resistance was evaluated. First, a dabrafenib and trametinib combination-resistant A375 population was obtained using the increasing concentration method described. The IC values of dabrafenib, trametinib, and BVD-523 in the BRAF / MEK combination-resistant population are shown in Table 24. 50 and compared with the parent A375 IC 50 Fold change. BVD-523IC 50There was a modest shift (2.5-fold) in the efficacy of BVD-523, while dabrafenib and trametinib shifted more significantly (8.5-fold and 13.5-fold, respectively) (Table 24). The cytotoxic agent paclitaxel was tested as a control, and only a modest change in efficacy was observed. These data support the study of BVD-523 in the context of BRAF / MEK therapy resistance, although the resistance mechanism in this cell population remains to be characterized.
[0425] Table 24 - BVD-523 activity in models of BRAF / MEK inhibition
[0426]
[0427] To further investigate the tractability of ERK1 / 2 inhibition in models with known mechanisms of BRAF inhibitor resistance, AAV-mediated gene targeting was used to generate a pair of RKO BRAF V600E - mutant cell lines that are not specific for MEK1 Q56P The presence or absence of engineered heterozygous knock-ins of activating mutations is isogenic (Trunzer et al., 2013 and Emery et al., 2009). Q56P MEK1 / 2 mutations, including BRAF1 / 2, are associated with acquired resistance to single-agent BRAF and combination BRAF / MEK therapy in patients (Wagle et al., 2011, Wagle et al., 2014, Emery et al., 2009, and Johnson et al., 2015). Single-agent assays demonstrate that MEK1 / 2 mutations are associated with acquired resistance to single-agent BRAF and combination BRAF / MEK therapy in patients (Wagle et al., 2011, Wagle et al., 2014, Emery et al., 2009, and Johnson et al., 2015). V600E ::MEK1 wt cells, double mutant BRAF V600E ::MEK1 Q56P The cells showed significantly reduced sensitivity to the BRAF inhibitors vemurafenib and dabrafenib and the MEK inhibitor trametinib ( Figure 34B In contrast, responses to BVD-523 were not significantly different between the parental and MEK1 Q56P These results were similar in 2 independently derived double mutant BRAF cells, indicating that BVD-523 is insensitive to this mechanism of acquired resistance. V600E ::MEK1 Q56P The cell line clones were confirmed with one, thus validating the results with MEK1 Q56P The presence of the mutation was specifically associated with ERK1 / 2 rather than an unrelated clonal artifact (data not shown). Similar results were observed with a second ERK1 / 2 inhibitor (SCH772984) with a different mechanism, supporting the expectation that these observations are specifically associated with mechanistic inhibition of ERK1 / 2 rather than due to off-target compound effects.
[0428] To further characterize the effect of BVD-523 on BRAF V600E ::MEK1 Q56P Mechanistic role of MAPK pathway signaling in cell lines, assessed by Western blotting for protein levels ( Figure 34C ). In parental BRAF V600E In RKO cells, reduced pRSK1 / 2 levels were observed after 4 h of treatment with pharmacologically active concentrations of BRAF (vemurafenib), MEK (trametinib), or ERK1 / 2 (BVD-523) inhibitors. V600E ::MEK1 Q56P Cells did not show reduced RSK phosphorylation after treatment with BRAF or MEK inhibitors, whereas BVD-523 still effectively inhibited pRSK1 / 2 to levels comparable to parental RKO. V600E ::MEK1 Q56P In the Figure 3, 24 hours of BVD-523 treatment resulted in a decrease in pRB, indicating a G0 / G1 arrest.
[0429] Acquired KRAS mutations are also known drivers of resistance to MAPK pathway inhibitors. To understand the susceptibility of BVD-523 to this resistance mechanism, we used an isogenic panel of clinically relevant KRAS mutations in the colorectal cell line SW48. Sensitivity to BVD-523 was compared with that of the MEK inhibitors selumetini and trametinib. Figure 34D Sensitivity to paclitaxel was unchanged ( Figure 37A While several mutant KRAS alleles confer robust to moderate resistance to MEK inhibition, most alleles did not alter sensitivity to BVD-523, and when a shift in sensitivity was observed, it did not reach the extent seen with trametinib or selumetinib. Taken together, these data suggest that BVD-523 is more effective than MEK inhibitors in this regard.
[0430] Example 15
[0431] BVD-523 shows in vivo activity in a BRAF inhibitor-resistant patient-derived melanoma xenograft model
[0432] In order to confirm and expand the anti-tumor effect of BVD-523 observed in the in vitro model of BRAF- / MEK-acquired resistance, a BRAF-resistant xenograft model derived from a patient resistant to vemurafenib was used. BVD-523 was administered at 100 mg / kg BID for 28 days by oral gavage, including alone and in combination with 50 mg / kg BID of dabrafenib (Figure 35). As expected, single agent dabrafenib showed the lowest anti-tumor activity (22% TGI). Compared to the vehicle control, BVD-523 activity was significant (P≤0.05), with a TGI of 78%. In this model, combining BVD-523 with dabrafenib resulted in a TGI of 76% (P≤0.05); therefore, in this BRAF acquired resistance model, the combination did not gain further benefit compared to single agent BVD-523.
[0433] Example 16
[0434] Combination therapy with BVD-523 and a BRAF inhibitor provides promising antitumor activity
[0435] Patients with BRAF mutant cancers may acquire resistance to combined BRAF / MEK therapy (Wagle et al., 2014), necessitating consideration of other combination approaches within the MAPK pathway. V600E The antiproliferative effects of BVD-523 in combination with the BRAF inhibitor vemurafenib were evaluated in the α-mutant melanoma cell line G-361. As expected, both single-agent BVD-523 and vemurafenib were active, and modest synergism was observed when combined ( Figure 37B This suggests that BVD-523 combined with BRAF inhibitors is effective in patients with BRAF V600E In addition, continuous culture of BRAF inhibitors plus BVD-523 in melanoma cell lines harboring BRAF mutations was at least additive and potentially synergistic. V600E In contrast, the development of acquired resistance to dabrafenib alone occurred relatively rapidly ( Figure 37C Even resistance to the combined dabrafenib and trametinib emerged before dabrafenib plus trametinib.
[0436] The benefits of combined BRAF and ERK inhibition may not be fully realized in in vitro combination studies where concentrations are not tolerable. V600E -Efficacy was assessed in vivo in xenografts of the mutant human melanoma cell line A375. Due to the remarkable response to the combination treatment, dosing in the combination group was stopped on day 20 to monitor tumor regrowth and restarted on day 42 ( Figure 36A ). Tumors were measured twice weekly until the study was terminated on day 45. The median time to endpoint (TTE) for the control was 9.2 days, and the maximum possible tumor growth delay (TGD) of 35.8 days was defined as 100%. Temozolomide treatment resulted in a TGD of 1.3 days (4%) and no regression. 50 and 100 mg / kg dabrafenib monotherapy produced a TGD of 6.9 days (19%) and 19.3 days (54%), respectively, showing a significant survival benefit (P<0.001) and 1 PR in the 100 mg / kg group. 100 mg / kg BVD 523 monotherapy resulted in a TGD of 9.3 days (26%), showing a significant survival benefit (P<0.001) and 2 durable complete responses. The combination of dabrafenib and BVD-523 each produced a maximum possible 100% TGD, with notable regression responses and statistically higher overall survival compared to their corresponding monotherapies (P < 0.001). The lowest dose combination produced a notable 7 / 15 tumor-free survivors (TFS), and the three higher dose combinations produced a total of 43 / 44 TFS, consistent with curative or near-curative activity ( Figure 36B In conclusion, the combination of dabrafenib and BVD-523 resulted in a greater number of TFs and superior efficacy to either agent alone.
[0437] Based on BVD-523, gadabrafenib has a median of approximately 75-144 mm 3 To investigate the activity of the combination therapy in an A375 xenograft model with a starting tumor volume of 700-800 mm, follow-up experiments were performed to determine the efficacy of the combination therapy in “late stage” A375 xenografts (mean starting tumor volume, 700-800 mm). 3 ) in the efficacy ( Figure 36C ). The median TTE for controls was 6.2 days, which determined a maximum possible TGD of 53.8 days, which was defined as 100% TGD for the 60-day study. BVD-523 100 mg / kg monotherapy produced negligible TGD (0.7 days, 1%), with no significant survival difference compared to the control group (P>0.05). The distribution of TTE and 2 PRs suggests that there may be a subset of responders to treatment with BVD-523 alone. Dabrafenib 50 mg / kg monotherapy was effective, with a TGD of 46.2 days (86%) and a significant survival benefit compared to the control group (P<0.001). This group had 5 PRs and 5 CRs in 11 evaluable mice, including 3 TFSs ( Figure 36D). The two combinations of dabrafenib and BVD-523 produced the largest 100% TGD and a significant survival benefit compared to the control group (P < 0.001). Although there were differences in regression activity, each combination produced a 100% regression response in the evaluable mice. The 25-mg / kg dabrafenib and 50-mg / kg BVD-523 combination had 2 PRs and 8 CRs with 6 / 10 TFS, while the 50-mg / kg dabrafenib and 100-mg / kg BVD-523 combination had 11 / 11 TFS at day 60 ( Figure 36D Overall, these data support the use of BVD-523 in combination with frontline BRAF-targeted therapy in the setting of BRAF. V600 This research supports the fundamental principle of the proposed mutation in melanoma, and it is possible that this could extend to other tumor types carrying this alteration.
[0438] discuss
[0439] BVD-523 is a potent, highly selective, and reversible small-molecule ATP-competitive inhibitor of ERK1 / 2 that is active in both in vitro and in vivo cancer models. In vitro, BVD-523 demonstrated potent inhibition of several human tumor cell lines, particularly those harboring activating mutations in the MAPK signaling pathway, consistent with its mechanism of action. BVD-523 caused changes in downstream target and effector proteins, including inhibition of direct ERK1 / 2 substrates (pRSK) and total DUSP6 protein levels. These findings are consistent with previous studies of other ERK1 / 2 inhibitors, which demonstrated potent suppression of pRSK by ERK1 / 2 inhibition (Morris et al., 2013 and Hatzivassiliou et al., 2012). Interestingly, BVD-523 treatment resulted in a significant increase in ERK1 / 2 phosphorylation both in vitro and in vivo. Similar to our findings, an increase in pERK1 / 2 was reported with the ERK1 / 2 inhibitor Vx11e; conversely, pERK1 / 2 inhibition occurred with SCH772984 (Morris et al., 2013). Although differences in pERK1 / 2 levels were observed among the various ERK1 / 2 inhibitors tested, downstream effectors (i.e., pRSK1 and total DUSP6) were similarly inhibited. These findings suggest that quantification of ERK1 / 2 target substrates, such as pRSK1, can serve as a reliable biomarker of efficacy for BVD-523-mediated inhibition of ERK1 / 2 activity.
[0440] Although BRAF (dabrafenib, vemurafenib) and MEK (trametinib, cobimetinib) inhibitors have validated the MAPK pathway as a therapeutic target, especially in patients with BRAF V600In patients with BRAF mutations, antitumor responses are limited by the emergence of acquired resistance and subsequent disease progression. Resistance has been attributed to upregulation and activation of compensatory signaling molecules (Nazarian et al., 2010, Villanueva et al., 2010, Johannessen et al., 2010, and Wang et al., 2011), amplification of target genes (Corcoran et al., 2010), and activating mutations in pathway components (e.g., RAS, MEK) (Wagle et al., 2011, Emery et al., 2009, and Wang et al., 2011). Reactivation of the ERK1 / 2 pathway is a common consequence of acquired resistance mechanisms. When BRAF is introduced, the ERK1 / 2 pathway is activated and the ERK1 / 2 pathway is activated. V600E -mutant melanoma cell line A375, MEK Q56P Confer resistance to MEK and BRAF inhibition (Wagle et al., 2011). In contrast, BVD-523 Q56P Its potent inhibitory activity was retained in cell lines, indicating that ERK1 / 2 inhibition is effective in the context of upstream activation changes that can occur in response to BRAF / MEK treatment. As further evidence of the role of BVD-523 in acquired resistance, the efficacy of BVD-523 was evident in a xenograft model of tumor samples from patients whose disease progressed on vemurafenib; the BRAF inhibitor dabrafenib was ineffective in this model. These data support the role of targeting ERK1 / 2 in the context of BRAF / MEK resistance and complement previously published findings (Morris et al., 2013 and Hatzivassiliou et al., 2012). To further characterize resistance to inhibitors of the MAPK pathway, the emergence of resistance to BVD-523 itself was investigated. It was found that single-agent treatment of cancer cells with BVD-523 was persistent and more challenging to develop resistance compared to other agents targeting upstream MAPK signaling components (i.e., dabrafenib, trametinib). This may indicate that acquiring resistance to ERK1 / 2-targeted agents is more difficult to achieve than acquiring resistance to BRAF or MEK therapy, possibly due to the fact that BVD-523 preferentially targets the more conserved active conformation of the ATP binding site. However, in vitro studies with other ERK1 / 2 inhibitors have identified specific mutants in ERK1 / 2 that drive resistance (Jha et al., 2016 and Goetz et al., 2014); these specific mutations have not been identified in clinical samples from patients who relapsed after ERK1 / 2 inhibitors.
[0441] The potential clinical benefits of ERK1 / 2 inhibition with BVD-523 extend beyond the context of patients resistant to BRAF / MEK therapy. Because ERK1 / 2 is a downstream master node in this MAPK pathway, its inhibition is attractive in many cancer settings where tumor growth is dependent on MAPK signaling. Approximately 30% of all cancers carry RAS mutations; therefore, targeting downstream ERK1 / 2 with BVD-523 is a reasonable therapeutic approach for these cancers. In addition, findings from Hayes et al. suggest that prolonged ERK1 / 2 inhibition in KRAS mutant pancreatic cancer is associated with senescence-like growth inhibition (Hayes et al., 2016). However, in the case of RAS mutations, a combination approach may be required to maximize and persist the attenuation of MAPK signaling. For example, MEK inhibition in KRAS mutant colorectal cancer cells leads to an adaptive response of ErbB family activation, which suppresses the response to MEK inhibition (Sun et al., 2014). Similar context-specific adaptive responses may occur following ERK1 / 2 inhibition with BVD-523. Optimal treatment combinations for various genetic profiles and cancer histologies are the subject of ongoing research. V600 In addition to RAS mutations, other MAPK-driven alterations are emerging. For example, novel RAF fusions and atypical non-V600 BRAF mutations that promote RAF dimerization activate the MAPK pathway (Yao et al., 2015). Inhibition of BRAF has been shown to V600 BRAF inhibitors targeting mutant monomeric proteins, such as vemurafenib and dabrafenib, are inactive in atypical RAF alterations that drive MAPK signaling in a dimerization-dependent manner (Yao et al., 2015). However, targeting downstream ERK1 / 2 in these tumors with BVD-523 may be a novel approach to address this unmet medical need.
[0442] In BRAF V600 In the setting of BRAF-mutant melanoma tumors, combined BRAF and MEK inhibition exemplifies how agents targeting different nodes of the same pathway can improve therapeutic response and duration. V600Combination studies in BRAF-mutant xenografts provide support for the use of a combination therapy with BVD-523 and a BRAF inhibitor. This combination has shown superior benefits relative to single-agent treatment, including results consistent with a cure response. The clinical efficacy and tolerability of the combined BRAF / BVD-523 therapy remain to be determined. It would not be unreasonable to expect that the BRAF / ERK1 / 2 combination would be at least as effective as the targeted BRAF / MEK combination. Furthermore, in vitro observations that acquired resistance to BVD-523 is more challenging than with other MAPK pathway inhibitors suggest that the BRAF / BVD-523 inhibitor combination has the potential to provide a more durable response.
[0443] Significant progress has also been made using immunotherapies against melanoma. The US FDA has approved various immune checkpoint inhibitors for the treatment of advanced melanoma, including the cytotoxic T-lymphocyte antigen-4-targeted agent ipilimumab and the programmed death-1 inhibitors pembrolizumab and nivolumab. Combining BVD-523 with these immunotherapies is an attractive treatment option; further investigation is needed to explore dosing schedules and assess whether synergistic responses can be achieved.
[0444] Based on preclinical data, BVD-523 may be promising for the treatment of patients with malignancies that rely on MAPK signaling, including those whose tumors have acquired resistance to other treatments. The clinical development of BVD-523 is described below. See Examples 17-24
[0445] Example 17
[0446] A Phase I dose-escalation study of BVD-523 (ulixertinib), a first-in-class novel oral ERK1 / 2 kinase inhibitor, in patients with advanced solid tumors
[0447] This study describes the first in-human dose-escalation study of an ERK1 / 2 inhibitor for the treatment of patients with advanced solid tumors. BVD-523 has an acceptable safety profile, good pharmacokinetics, and early evidence of clinical activity.
[0448] Mitogen-activated protein kinase (MAPK) signaling via the RAS-RAF-MEK-ERK cascade plays a key role in tumorigenesis and has therefore attracted great interest as a therapeutic target. This ubiquitous pathway consists of the upstream RAS of the cascade of protein kinases RAF, MEK1 / 2, and ERK1 / 2. RAS is activated by GTP binding, which in turn leads to the sequential activation of each protein kinase. Although they appear to be the only physiological substrates of MEK1 / 2, ERK1 / 2 has many targets in the cytoplasm and nucleus, including the transcription factors Elk1, c-Fos, p53, Ets1 / 2, and c-Jun (Shaul et al., 2007). ERK1 / 2 activation and kinase activity affect cell proliferation, differentiation, and survival through multiple mechanisms (Rasola et al., 2010), including activation of members of the ribosomal S6 kinase (RSK) family (Romeo et al., 2012).
[0449] Constitutive abnormal activation of the RAS-RAF-MEK1 / 2-ERK1 / 2 signaling pathway has been identified and is involved in the development or maintenance of many cancers (Schubbert et al., 2007 and Gollob et al., 2006). Mutations in RAS family genes (such as KRAS, NRAS, and HRAS) are the most common, with activating RAS mutations occurring in approximately 30% of human cancers (Schubbert et al., 2007). KRAS mutations are prevalent in pancreatic cancer (>90%) (Kanda et al., 2012), cholangiocarcinoma (3%-50%) (Hezel et al., 2014), colorectal cancer (30%-50%) (Arrington et al., 2012), lung cancer (27%) (Pennycuick et al., 2012), ovarian cancer (15%-39%) (Dobrzycka et al., 2009), and endometrioid endometrial cancer (18%) (O'Hara and Bell, 2012); NRAS mutations are prevalent in melanoma (20%) (Khattak et al., 2013) and myeloid leukemia (8%-13%) (Yohe 2015); and HRAS mutations are prevalent in bladder cancer (12%) (Fernández-Medarde and Santos, 2011). Mutations in RAF family genes (most notably BRAF) occur frequently, particularly in melanoma. BRAF mutations have been found in 66% of malignant melanomas and ~7% of other cancers (Davies et al., 2002), while MEK mutations are rare, occurring in 8% of melanomas overall (Nikolaev et al., 2012). In contrast, ERK mutations that contribute to tumorigenesis have rarely been reported to date (Deschenes-Simard et al., 2014).
[0450] The U.S. Food and Drug Administration (FDA) has approved two selective BRAF inhibitors, velotinib and dalatinib, as V600 -mutant metastatic melanoma (Taflinar [package insert] and Zelboraf [package insert]). Although response rates to these targeted therapies are limited in patients with BRAF V600 In patients with HER2-positive leukemia (MEK) mutations, responses can be as high as 50%, but the duration of response is typically measured in months rather than years (Hauschild et al., 2012 and McArthur et al., 2014). The MEK1 / 2 inhibitor trametinib has also been approved as a monotherapy in this setting (Mekinist [package insert]), but is more commonly used in combination with the BRAF inhibitor dalatinib. First-line use of trametinib in combination with dalatinib provided a greater improvement in overall survival compared to velotinib monotherapy without increasing overall toxicity (Robert et al., 2015), highlighting the potential utility of simultaneously targeting multiple proteins of this MAPK signaling pathway. This treatment combination was also associated with a lower incidence of MEK inhibitor-associated rash and BRAF inhibitor-induced hyperproliferative skin lesions compared to each drug alone (Flaherty et al., 2012). Recently, a phase III trial also showed that BRAF V600E / K In patients with mutation-positive melanoma, the use of dalatinib plus trametinib compared with dalatinib alone resulted in significant improvements in overall survival (25.1 vs. 18.7 months, hazard ratio [HR] 0.71, P = 0.0107), progression-free survival (PFS) (11.0 vs. 8.8 months, HR 0.67, P = 0.0107), and overall response (69% vs. 53%; P = 0.0014) (Long et al., 2015). Similarly, the combination of cobimetinib plus velotinib demonstrated significant improvements in PFS (9.9 vs. 6.2 months, HR 0.51, P < 0.001) and complete response (CR) or partial response (PR) rates (68% vs. 45%; P < 0.001) compared with velotinib alone (Larkin et al., 2014). To this end, the FDA recently approved the combination of velotinib and cobimetinib for BRAF V600E / K Based on these and related findings, the combination of a BRAF inhibitor plus a MEK inhibitor has become a promising approach for melanomas containing BRAF mutations. V600E / K Standard targeted therapy options for patients with metastatic melanoma who harbor HER2 mutations.
[0451] Although BRAF / MEK-targeted combination therapies have been shown to provide significant additional benefits over single-agent options, most patients ultimately develop resistance and disease progression after approximately 12 months (Robert et al., 2015, Flaherty et al., 2012, and Long et al., 2015). Several mechanisms of acquired resistance have been identified following single-agent or combination therapy, including the generation of BRAF splice variants, BRAF amplification, the development of NRAS or MEK mutations, and upregulation of alternative pathways (Poulikakos et al., 2011, Corcoran et al., 2010, Nazarian et al., 2010, Shi et al., 2014, Johannessen et al., 2010, Wagle et al., 2011, Wagle et al., 2014, and Ahronian et al., 2015). At the heart of many of these resistance mechanisms is the reactivation of ERK signaling, which can rapidly restore MAPK pathway signaling and tumor cell escape from single agent BRAF or combined BRAF / MEK inhibitor therapy (Paraiso et al., 2010). ERK inhibition may offer an opportunity to avoid or overcome resistance from upstream mechanisms because it is the most distal master kinase of the MAPK signaling pathway. This is supported by preclinical evidence that inhibition of ERK by small molecule inhibitors both suppresses the emergence of resistance and overcomes acquired resistance to BRAF and MEK inhibitors (Morris et al., 2013 and Hatzivassiliou et al., 2012).
[0452] BVD-523 is a highly effective, selective, reversible ATP-competitive ERK1 / 2 inhibitor that has been shown to reduce tumor growth and induce tumor regression in BRAF and RAS mutant xenograft models. In addition, single-agent BVD-523 inhibits human xenograft models that are cross-resistant to both BRAF and MEK inhibitors. See Examples 9-16. Therefore, an open-label, first-in-human study of oral BVD-523 was conducted (Clinicaltrials.gov identifier, NCT01781429) to determine the maximum tolerated dose and recommended dose for further study. This study also aims to evaluate the pharmacokinetic and pharmacodynamic properties and preliminary efficacy of patients with advanced cancer.
[0453] Example 18
[0454] Patient characteristics
[0455] From April 4, 2013, to December 1, 2015, a total of 27 patients were enrolled and received at least one dose of study drug. Baseline demographic and disease characteristics are shown in Table 25. The median patient age was 61 years (range, 33-86 years). Fifty-two percent (14 / 27) of the patients were male, and 63% (17 / 27) had an Eastern Cooperative Oncology Group (ECOG) status of 1. Melanoma was the most common cancer (30%; BRAF mutation was present in 7 / 8 of these patients). The remaining patients had colorectal cancer (19%; 5 / 27), papillary thyroid cancer (15%; 4 / 27), or non-small cell lung cancer (NSCLC) (7%; 2 / 27), and 8 patients (30%) were classified as having other cancers (2 pancreatic, 1 appendiceal, 1 nonspermatogonial germ cell, 1 ovarian, and 3 unknown primaries). Most patients had received 2 or more lines of prior systemic therapy, with 41% (11 / 27) receiving 2 to 3 lines and 48% (13 / 27) receiving >3 lines of prior systemic therapy.
[0456] Table 25 - Baseline demographic and clinical characteristics of patients
[0457]
[0458]
[0459] a Seven were BRAF mutant and one was unknown.
[0460] b Two pancreatic, 1 appendix, 1 non-spermatogonial germ cell, 1 ovary, 3 unknown primaries.
[0461] cPatients may have more than one molecular abnormality.
[0462] dOther molecular abnormalities include ERCC1, RRM1, thymidylate synthase, GNAS, MEK1, TP53, CREBBP, ROS1, PTEN, AKT3, and PIK3CA.
[0463] eSome patients received treatment with more than one BRAF inhibitor.
[0464] Abbreviation: ECOG, Eastern Cooperative Oncology Group.
[0465] Example 19
[0466] Effects of BVD-523 on RSK1 / 2 phosphorylation in vitro
[0467] An in vitro biomarker assay that can be used to support clinical studies was developed to demonstrate the inhibitory effect of BVD-523 on ERK activity. This assay expands preclinical cell data, in which inhibitors of MAPK signaling, such as BVD-523, dabrafenib, trametinib, and velotinib, have been shown to inhibit RSK phosphorylation in BRAF mutant cancer cell lines as a function of inhibitor concentration. See Examples 9-16. Specifically, ERK inhibitor-dependent inhibition of phorbol 12-myristate 13-acetate (PMA)-stimulated phosphorylation of the ERK substrate RSK1 in whole blood was used as a target marker. When BVD-523 was added directly to whole blood from healthy volunteers, PMA-stimulated RSK phosphorylation decreased with increasing BVD-523 concentration ( Figure 38 The average IC of the cumulative data for BVD-523 50 The results were as follows: 1) 461 ± 20 nM, and 75.8 ± 2.7% maximum inhibition at 10 μM BVD-523. Maximum inhibition was defined as RSK phosphorylation measured in the presence of 10 μM BVD-523. Patient-derived whole blood samples collected immediately before or at defined time points after administration with BVD-523 were similarly processed and quantified for RSK phosphorylation levels.
[0468] Example 20
[0469] Dose escalation, dose-limiting toxicity (DLT), maximum tolerated dose (MTD), and recommended phase II dose (RP2D)
[0470] According to the protocol, 5 single patient groups (twice a day [BID] 10 to 150 mg) progressed without the sign of DLT. The 300 mg BID group was expanded to more fully characterize BVD-523 exposure. One of the 6 patients given 600 mg BID experienced the DLT of grade 3 rash. The 900 mg BID dose exceeded the MTD, with one patient experiencing grade 3 pruritus and aspartate aminotransferase (AST) elevations, and another patient experiencing grade 3 diarrhea, vomiting, dehydration, and creatinine elevation (table 26). The subsequent 750 mg BID intermediate dose also exceeded the MTD, with one patient's DLT being grade 3 rash and grade 2 diarrhea, and another patient being grade 2 hypotension, creatinine elevation, and anemia. Therefore, MTD and RP2D are determined to be 600 mg BID.
[0471] Table 26 - Dose-limiting toxicities in round 1 (21 days)
[0472]
[0473] aIntermediate dose.
[0474] Abbreviations: AST, aspartate aminotransferase; BID, twice daily; DLT, dose-limiting toxicity; N / A, not applicable.
[0475] Example 21
[0476] Adverse events (AEs)
[0477] Investigator-assessed treatment-related AEs of any grade were noted in 26 of 27 patients (96%). The most common treatment-related AEs (>30%) were rash (primarily acne) (70%), fatigue (59%), diarrhea (52%), and nausea (52%) (Table 27). No patient experienced a Grade 4 or 5 treatment-related AE or discontinued treatment due to a treatment-related AE. Most events were Grade 1 to 2, with Grade 3 treatment-related events noted in 13 of 27 patients (48%). The only Grade 3 treatment-related events present in ≥10% of patients were diarrhea (15%) and increased liver function tests (11%), all of which occurred above the 600-mg BID dose.
[0478] Table 27 - Adverse Events Possibly / Definitely Related to BVD-523 in ≥10% of Patients
[0479]
[0480] a No patients experienced grade 4 or 5 AEs possibly or definitely related to BVD-523 treatment.
[0481] b Axillary and maculopapular rashes.
[0482] c There was one grade 1 event of related central serous retinopathy.
[0483] Analysis deadline: December 1, 2015.
[0484] Abbreviations: AE, adverse event; ALT, alanine aminotransferase; AST, aspartate aminotransferase; LFT, liver function test.
[0485] Fourteen patients experienced a total of 28 serious adverse events (SAEs). Nine of these events were considered by the investigator to be related or possibly related to BVD-523, including dehydration, diarrhea or increased creatinine (two patients each), vomiting, nausea, and fever (one patient each). All other SAEs were considered unrelated to treatment with BVD-523. Dose reductions due to AEs occurred in three patients during the study: one patient was reduced from 600 mg BID to 300 mg BID, and two patients were reduced from 900 mg BID to 600 mg BID.
[0486] Example 22
[0487] Pharmacokinetics
[0488] The single-dose and steady-state pharmacokinetics of BVD-523 are summarized in Figure 39A and Table 28. In general, orally administered BVD-523 is slowly absorbed in patients with advanced malignancies. max After administration of up to 600 mg BID, plasma BVD-523 levels remain constant for approximately 2 to 4 hours. Subsequently, plasma drug concentrations slowly decline. Since plasma drug concentrations were only measured up to 12 hours after the morning dose, it was not possible to calculate effective or terminal elimination rates. When administered up to 600 mg BID, BVD-523 pharmacokinetics were linear and max The exposure was proportional to the dose in terms of the area under the curve (AUC). No further increase in exposure was observed when the dose was increased from 600 mg to 900 mg BID. For all doses above 20 mg BID, the exposure was proportional to the dose in terms of the area under the curve (AUC). max Reach EC 50 Furthermore, steady-state exposure remained at the target EC for dose levels ≥150 mg BID throughout the dosing period. 50 or above target EC 50 On Day 15, minimal plasma accumulation of BVD-523 and its metabolites was observed at lower (<75 mg BID) dose levels, while accumulation at higher dose levels ranged from approximately 1.3-fold to 4.0-fold. Pre-dose concentrations on Day 22 were generally similar to those on Day 15, suggesting that steady-state had been achieved by Day 15 (data not shown). The degree of inter-patient variability in plasma exposure to BVD-523 and its metabolites was considered moderate and not problematic.
[0489] Table 28 - Steady-state BVD-523 pharmacokinetics (Round 1, Day 15)
[0490]
[0491]
[0492] a BID dose level; b n = 3 on Day 15; c n = 2 subjects at the 600 mg dose level on Day 15 included two subjects who started at 900 mg on Day 1 and were subsequently reduced to 600 mg; d n = 4 on Day 15; f n = 1 subject who started at 750 mg on Day 1 and was ultimately reduced to 450 mg; Day 15 parameters for this study reflect at least 10 consecutive doses at 450 mg / dose. The individual Day 15 parameters were C at 1300 ng / mL. maxand an AUC of 10700 0-12 ; g n = 3; h n=5.
[0493] Urinary excretion of BVD-523 after the first dose and at steady state was negligible (<0.2% of the dose) at all dose levels within 12 hours post-dose and was not dose-related in this very low percentage range. Renal clearance appeared to be independent of dose. Individual renal clearance values ranged from 0.128 to 0.0895 L / hr (where n=1 / dose level), with mean values ranging from 0.0149 to 0.0300 L / hr (where n≥3).
[0494] Example 23
[0495] Pharmacodynamic confirmation of targeted inhibition of BVD-523
[0496] To confirm the targeting and pathway inhibition of BVD-523, RSK-1 phosphorylation was examined as a target biomarker in human whole blood samples from solid tumor patients receiving BVD-523. Steady-state whole blood samples collected from BVD-523-treated patients before dosing on day 15 showed concentration-dependent inhibition of PMA-stimulated ERK activity ( Figure 39B ), ranging from 0% ERK inhibition at 10 mg BVD-523 BID to 93 ± 8% ERK inhibition at 900 mg BID. The plasma concentration of BVD-523 required to produce 50% inhibition of ERK phosphorylation was similar whether BVD-523 was spiked directly into the plasma of healthy volunteers or administered orally to patients.
[0497] Example 24
[0498] Anti-tumor effects
[0499] Tumor responses to BVD-523 were assessed in 25 evaluable patients using the response evaluation criteria in Solid Tumors version 1.1 (RECIST v1.1); 2 patients did not receive two scans of target lesions and were therefore not assessed using RECIST v1.1. No patient achieved a complete response, but 3 patients (all with BRAF-containing V600 BRAF / MEK-mutant melanoma) achieved partial responses (129 days [BRAF / MEK-inhibitor-naive], 294 days ongoing [refractory to existing BRAF / MEK inhibitors], and 313 days ongoing as of data cutoff [intolerant to other BRAF / MEK inhibitors] ( Figure 40AInterestingly, all three partial responders had BRAF-mutant melanoma. One partial responder who received BVD-523 at a dose of 450 mg twice daily saw an approximately 70% reduction in the total number of target lesions from baseline, while other partial responders showed reductions of 47.0% and 33.6%. Stable disease was confirmed in 18 patients, including six with stable disease for more than six months and another six with stable disease for more than three months. In this study, four patients had progressive disease at the time of their first assessment.
[0500] Figure 40B Computed tomography (CT) scan of 1 of 3 partial responders (RECIST v1.1) who progressed on prior velotinib and subsequent dabrafenib / trametinib therapy is shown; a durable partial response was observed after dosing with BVD-523 600 mg BID for >300 days. In 5 of 16 evaluable patients, BVD-523 was associated with a positive fluorodeoxyglucose emission tomography scan ( 18 F-FDG-PET) is associated with metabolic responses.
[0501] Figure 41 The timing and duration of response in the study population are depicted. Two patients who responded to BVD-523 remain on study and continued BVD-523 treatment until the study cutoff date (>500 days); in addition, one bronchoalveolar NSCLC patient (insufficient tissue for molecular profiling) has been treated for >700 days with stable disease. Twenty-four of 27 patients (90%) discontinued treatment due to progressive disease (22 / 27, 82%) or other reasons (2 / 27, 7%). The median duration of BVD-523 treatment before discontinuation was 4.7 months.
[0502] discuss
[0503] The present invention provides results from a first-in-human study evaluating the safety, pharmacokinetics, pharmacodynamics, and preliminary efficacy of BVD-523 in 27 patients with advanced solid tumors. In this dose-escalation study, oral treatment with BVD-523 resulted in radiographic responses (3 partial responses) and prolonged disease stability by RECIST v1.1 in some patients, most of whom had received ≥2 prior systemic therapies. 18By imaging tumor uptake of F-glucose, evidence of BVD-523-dependent inhibition of metabolic responses in tumors was established in a subset of patients. Drug exposure increased linearly with dose up to 600 mg BID, where exposure to 600 mg BID provided near-complete 24 / 7 inhibition of ERK-dependent substrate (RSK-1) phosphorylation in an ex vivo whole blood assay. Furthermore, tolerability to BVD-523 was manageable when administered up to its MTD and RP2D (determined to be 600 mg BID).
[0504] BVD-523 is generally well tolerated, with manageable and reversible toxicities. The most common AEs are rash (usually acne), fatigue, and gastrointestinal side effects, including nausea, vomiting, and diarrhea. The safety of BVD-523 is consistent with its selective inhibition of the MAPK pathway; the AE profile shows considerable overlap with that experienced by MEK inhibitors. However, toxicities associated with any targeted therapy may include dependence on both the specific mechanism and the degree of target inhibition, as well as any off-target effects (Zelboraf [package insert] and Hauschild et al., 2012). Ongoing and future studies will expand on the efficacy and safety demonstrated in this dose escalation study and will guide how the unique characteristics of the ERK inhibitor BVD-523 can be used as a single agent or in combination with other agents.
[0505] The durable response of RAF and MEK inhibitors is often limited by intrinsic and eventual acquired resistance, a common feature of which is often related to reactivation of the ERK pathway (Poulikakos et al., 2011, Corcoran et al., 2010, Nazarian et al., 2010, Shi et al., 2014, Johannessen et al., 2010, Wagle et al., 2011, Wagle et al., 2014, Ahronian et al., 2015 and Paraiso et al., 2010). Therefore, ERK inhibition by BVD-523 alone or in combination with other MAPK signaling pathway inhibitors has the potential to delay the development of resistance to existing therapies and benefit a wider range of patient populations. ERK inhibitors, including BVD-523, retain their efficacy in BRAF- and MEK-resistant cell lines, providing preclinical evidence for the use of ERK inhibitors in patients with acquired resistance to standard treatment (BRAF / MEK combination therapy). See, for example, Examples 9-16. Importantly, in this study, a patient whose cancer progressed after initially receiving a BRAF inhibitor (vemurafenib) and subsequently stabilizing on a combination of BRAF and MEK inhibitors (dabrafenib / trametinib) had a partial response when receiving single-agent BVD-523. As of the study cutoff date reported herein, this patient had been on study for a total of 708 days. Based in part on the anti-tumor effect observed in this patient, the FDA has designated BVD-523 for the treatment of patients with unresectable or metastatic BRAF tumors. V600 Fast Track development program for patients with mutation-positive melanoma whose melanoma is refractory to or has progressed after treatment with a BRAF and / or MEK inhibitor. Precisely defining how BVD-523 can best support patient care (e.g., as a single agent or in various combinations) requires additional clinical studies.
[0506] In summary, this example provides data from the initial data from the dose escalation portion of a Phase I study evaluating BVD-523, a novel, first-in-class ERK inhibitor, as a treatment for patients with advanced cancer. Continuous, twice-daily oral treatment with BVD-523 produced anti-tumor effects in several patients, including those who had not received or had progressed on existing MAPK pathway-targeted therapies. In this population of patients with advanced cancer, BVD-523 was generally well tolerated with manageable toxicity; the MTD and RP2D were 600 mg BID. BVD-523 exposure increased linearly to the RP2D, and robust pharmacodynamic effects were evident at this dose level. An expansion of this Phase I clinical study is currently underway to confirm and expand on the observations made in the dose escalation phase. Specifically, patients are participating in expanded cohorts across molecular classifications of various tumor histologies (e.g., NRAS, BRAF, MEK, or ERK alterations). Additionally, expansion cohorts are evaluating BVD-523 in patients with cancer who have not received prior treatment with available MAPK pathway therapies or whose disease has progressed on these therapies.
[0507] literature
[0508] ABSALAN,Farnaz,Mostafa Ronaghi(2008).Molecular Inversion ProbeAssay.Methods in Molecular Biology 396.Humana Press.pp.315-330.
[0509] AHRONIAN LG, Sennott EM, Van Allen EM, Wagle N, Kwak EL, Faris JE, et al. Clinical acquired resistance to RAF inhibitor combinations in BRAF-mutantcolorectal cancer through MAPK pathway alterations. Cancer Discov 2015;5:358-67.
[0510] ARCILA ME,Drilon A,Sylvester BE,Lovly CM,Borsu L,Reva B,et al.MAP2K1(MEK1)mutations define a distinct subset of lung adenocarcinoma associatedwith smoking.Clin Cancer Res 2015;21:1935-43.
[0511] ARONOV AM,Baker C,Bemis GW,Cao J,Chen G,Ford PJ,et al.Flipped out:structure-guided design of selective pyrazolylpyrrole ERK inhibitors.J MedChem 2007;50:1280-7.
[0512] ARONOV AM,Tang Q,Martinez-Botella G,Bemis GW,Cao J,Chen G,etal.Structure-guided design of potent and selective pyrimidylpyrroleinhibitors of extracellular signal-regulated kinase(ERK)using conformationalcontrol.J Med Chem 2009;52:6362-8.
[0513] ARRINGTON AK,Heinrich EL,Lee W,Duldulao M,Patel S,Sanchez J,etal.Prognostic and predictive roles of KRAS mutation in colorectal cancer.IntJ Mol Sci 2012;13:12153-68.
[0514] CARGNELLO M,Roux PP.Activation and function of the MAPKs and theirsubstrates,the MAPK-activated protein kinases.Microbiol Mol Biol Rev 2011;75:50-83.
[0515] CARLINO MS,Fung C,Shahheydari H,Todd JR,Boyd SC,Irvine M,etal.Preexisting MEK1P124 mutations diminish response to BRAF inhibitors inmetastatic melanoma patients.Clin Cancer Res 2015;21:98-105.
[0516] CHAPMAN PB,Hauschild A,Robert C,Haanen JB,Ascierto P,Larkin J,etal.Improved survival with vemurafenib in melanoma with BRAF V600E mutation.NEngl J Med 2011;364:2507-16.
[0517] CORCORAN,R.B.,et al.BRAF gene amplification can promote acquiredresistance to MEK inhibitors in cancer cells harboring the BRAF V600Emutation.Sci Signal(2010);3(149):ra84.
[0518] DAI,B.,et al.STAT3 mediates resistance to MEK inhibitor throughmicroRNA miR-17.Cancer Res(2011);71:3658-3668.
[0519] DAVIES H,Bignell GR,Cox C,Stephens P,Edkins S,Clegg S,et al.Mutationsof the BRAF gene in human cancer.Nature 2002;417:949-54.
[0520] DESCHENES-SIMARD X,Kottakis F,Meloche S,Ferbeyre G.ERKs in cancer:friends or foes?Cancer Res 2014;74:412-9.
[0521] DOBRZYCKA B,Terlikowski SJ,Kowalczuk O,Niklinska W,Chyczewski L,Kulikowski M.Mutations in the KRAS gene in ovarian tumors.Folia HistochemCytobiol 2009;47:221-4.
[0522] EMERY,C.M.,et al.MEK1 mutations confer resistance to MEK and B-RAFinhibition.PNAS(2009);106(48):20411-6.
[0523] FEDOROV O,Niesen FH,Knapp S.Kinase inhibitor selectivity profilingusing differential scanning fluorimetry.Methods Mol Biol 2012;795:109-18.
[0524] A,Santos E.Ras in cancer anddevelopmental diseases.Genes Cancer 2011;2:344-58.
[0525] FLAHERTY KT,Infante JR,Daud A,Gonzalez R,Kefford RF,Sosman J,etal.Combined BRAF and MEK inhibition in melanoma with BRAF V600 mutations.NEngl J Med2012;367:1694-703.
[0526] GOETZ EM,Ghandi M,Treacy DJ,Wagle N,Garraway LA.ERK mutations conferresistance to mitogen-activated protein kinase pathway inhibitors.Cancer Res2014;74:7079-89.
[0527] GOLLOB JA,Wilhelm S,Carter C,Kelley SL.Role of Raf kinase in cancer:therapeutic potential of targeting the Raf / MEK / ERK signal transductionpathway.Semin Oncol 2006;33:392-406.
[0528] GREGER,James G.,et al."Combinations of BRAF,MEK,and PI3K / mTORinhibitors overcome acquired resistance to the BRAF inhibitor GSK2118436dabrafenib,mediated by NRAS or MEK mutations."Molecular cancer therapeutics11.4(2012):909-920.
[0529] GROENENDIJK FH,Bernards R.Drug resistance to targeted therapies:dejavu all over again.Mol Oncol 2014;8:1067-83.
[0530] HALL RD,Kudchadkar RR.BRAF mutations:signaling,epidemiology,andclinical experience in multiple malignancies.Cancer Control 2014;21:221-30.
[0531] HARDENBOL,P.,et al.Multiplexed genotyping with sequence-taggedmolecular inversion probes.Nat.Biotechnol.2003,no.21,p.673-678.
[0532] HATZIVASSILIOU,Georgia,et al."RAF inhibitors prime wild-type RAF toactivate the MAPK pathway and enhance growth."Nature 464.7287(2010):431-435.
[0533] HATZIVASSILIOU G,Liu B,O'Brien C,Spoerke JM,Hoeflich KP,Haverty PM,etal.ERK inhibition overcomes acquired resistance to MEK inhibitors.Mol CancerTher 2012;11:1143-54.
[0534] HAUSCHILD A,Grob J-J,Demidov LV,Jouary T,Gutzmer R,Millward M,etal.Dabrafenib in BRAF-mutated metastatic melanoma:a multicentre,open-label,phase 3 randomised controlled trial.Lancet 2012;380:358-65.
[0535] HAYES TK,Neel NF,Hu C,Gautam P,Chenard M,Long B,et al.Long-Term ERKInhibition in KRAS-Mutant Pancreatic Cancer Is Associated with MYCDegradation and Senescence-like Growth Suppression.Cancer Cell 2016;29:75-89.
[0536] HEZEL AF,Noel MS,Allen JN,Abrams TA,Yurgelun M,Faris JE,et al.PhaseII study of gemcitabine,oxaliplatin in combination with panitumumab in KRASwild-type unresectable or metastatic biliary tract and gallbladder cancer.BrJ Cancer 2014;111:430-6.
[0537] JHA S,Morris EJ,Hruza A,Mansueto MS,Schroeder G,Arbanas J,etal.Dissecting therapeutic resistance to ERK inhibition.Mol Cancer Ther 2016;15:548-59.
[0538] JOHANNESSEN,C.M.,et al.COT / MAP3K8 drives resistance to RAF inhibitionthrough MAP kinase pathway reactivation.Nature(2010);468(7326):968-972.
[0539] JOHNSON DB,Menzies AM,Zimmer L,Eroglu Z,Ye F,Zhao S,et al.AcquiredBRAF inhibitor resistance:A multicenter meta-analysis of the spectrum andfrequencies,clinical behaviour,and phenotypic associations of resistancemechanisms.Eur J Cancer2015;51:2792-9.
[0540] KANDA M,Matthaei H,Wu J,Hong SM,Yu J,Borges M,et al.Presence ofsomatic Mutations in most early-stage pancreatic intraepithelialneoplasia.Gastroenterology 2012;142:730-733.
[0541] KHATTAK M,Fisher R,Turajlic S,Larkin J.Targeted therapy andimmunotherapy in advanced melanoma:an evolving paradigm.Ther Adv Med Oncol2013;5:105-18.
[0542] KING,Alastair J.,et al."Dabrafenib;preclinical characterization,increased efficacy when combined with trametinib,while BRAF / MEK toolcombination reduced skin lesions."PloS one 8.7
[0543] (2013):e67583.
[0544] LARKIN J,Ascierto PA,Dréno B,Atkinson V,Liszkay G,Maio M,etal.Combined vemurafenib and cobimetinib in BRAF-mutated melanoma.N Engl J Med2014;371:1867-76.
[0545] LITTLE,A.S.,et al.,Amplification of the Driving Oncogene,KRAS orBRAF,Underpins Acquired Resistance to MEK1 / 2 Inhibitors in Colorectal CancerCells.Sci.Signal.4,ra17(2011).
[0546] LIU,Dingxie,et al."BRAF V600E maintains proliferation,transformation,and tumorigenicity of BRAF-mutant papillary thyroid cancer cells."Journal ofClinical Endocrinology&
[0547] Metabolism 92.6(2007):2264-2271.
[0548] LIU B,Fu L,Zhang C,Zhang L,Zhang Y,Ouyang L,et al.
[0549] Computational design,chemical synthesis,and biological evaluation ofa novel ERK inhibitor(BL-EI001)with apoptosis-inducing mechanisms in breastcancer.Oncotarget2015;6:6762-75.
[0550] LONG GV,Fung C,Menzies AM,Pupo GM,Carlino MS,Hyman J,et al.IncreasedMAPK reactivation in early resistance to dabrafenib / trametinib combinationtherapy of BRAF-mutant metastatic melanoma.Nat Commun 2014;5:5694.
[0551] LONG GV,Stroyakovskiy D,Gogas H,Levchenko E,de Braud F,Larkin J,etal.Dabrafenib and trametinib versus dabrafenib and placebo for Val600 BRAF-mutant melanoma:a multicentre,double-blind,phase 3 randomised controlledtrial.Lancet2015;386:444-51.
[0552] MANANDHAR SP,Hildebrandt ER,Schmidt WK.Small-molecule inhibitors ofthe Rce1p CaaX protease.J Biomol Screen.2007;12(7):983-993.
[0553] MASSEY PR,Prasad V,Figg WD,Fojo T.Multiplying therapies and reducingtoxicity in metastatic melanoma.Cancer Biol Ther2015;16:1014-8.
[0554] MAURER,T,Garrenton,LS,Oh,A,Pitts,K,Anderson,DJ,Skelton,
[0555] NJ,Fauber,BP,Pan,B,Malek,S,Stokoe,D,Ludlam,MJC,Bowman,KK,Wu,J,Giannetti,AM,Starovasnik,MA,Mellman,I,Jackson,PK,Rudolph,J,Wang,W,Fang,G.Small-molecule ligands bind to a distinct pocket in Ras and inhibit SOS-mediated nucleotide exchange activity.PNAS.2012;109(14):5299-304.MCARTHUR GA,Chapman PB,Robert C,Larkin J,Haanen JB,Dummer R,et al.Safety and efficacy ofvemurafenib in BRAF v600E and BRAF v600K mutation-positive melanoma(BRIM-3):extended follow-up of a phase 3,randomised,open-label study.Lancet Oncol2014;15:323-32.
[0556] MEKINIST[package insert].Research Triangle Park,NC:
[0557] GlaxoSmithKline;2014.
[0558] METZKER,Emerging technologies in DNA sequencing Genome Res.2005.15:1767-1776.
[0559] MITTAL,Rohit et al."The acetyltransferase activity of the bacterialtoxin YopJ of Yersinia is activated by eukaryotic host cell inositolhexakisphosphate."Journal of Biological Chemistry 285.26(2010):19927-19934.
[0560] MORRIS EJ,Jha S,Restaino CR,Dayananth P,Zhu H,Cooper A,etal.Discovery of a novel ERK inhibitor with activity in models of acquiredresistance to BRAF and MEK inhibitors.Cancer Discov2013;3:742-50.
[0561] NAZARIAN,R.,et al.Melanomas acquire resistance to B-RAF
[0562] (V600E)inhibition by RTK or N-RAS upregulation.Nature.2010;
[0563] 468(7326):973-977.
[0564] NIKOLAEV SI,Rimoldi D,Iseli C,Valsesia A,Robyr D,Gehrig C,et al.Exomesequencing identifies recurrent somatic MAP2K1 and MAP2K2 mutations inmelanoma.Nat Genet 2012;44:133-9.NILSSON,M.,et al.Padlock probes:circularizing oligonucleotides for localized DNA detection.Science.1994,no.265,p.2085-2088.O'HARA AJ,Bell DW.The genomics and genetics of endometrialcancer.Adv Genomics Genet 2012;2012:33-47.
[0565] OJESINA AI,Lichtenstein L,Freeman SS,Pedamallu CS,Imaz-Rosshandler I,Pugh TJ,et al.Landscape of genomic alterations in cervical carcinomas.Nature2014;506:371-5.OTA et al.,Single nucleotide polymorphism detection bypolymerase chain reaction-restriction fragment length polymorphism.NatProtoc.2007;2(11):2857-64.
[0566] PARAISO KHT,Fedorenko IV,Cantini LP,Munko AC,Hall M,Sondak VK,etal.Recovery of phospho-ERK activity allows melanoma cells to escape from BRAFinhibitor therapy.Br J Cancer 2010;102:1724-30.
[0567] PATGIRI A,Yadav,KK,Arora,PS,Bar-Sagi,D.An orthosteric inhibitor ofthe Ras-Sos interaction.Nat Chem Biol.2011;7:585-587.
[0568] PENNYCUICK A,Simpson T,Crawley D,Lal R,Santis G,Cane P,et al.RoutineEGFR and KRAS mutation analysis using COLD-PCR in non-small cell lungcancer.Int J Clin Pract2012;66:748-52.
[0569] PORTER SB,Hildebrandt ER,Breevoort SR,Mokry DZ,Dore TM,SchmidtWK.Inhibition of the CaaX proteases Rce1p and Ste24p by peptidyl(acyloxy)methyl ketones.Biochim Biophys Acta.2007;1773(6):853-862.
[0570] POULIKAKOS PI,Persaud Y,Janakiraman M,Kong X,Ng C,Moriceau G,etal.RAF inhibitor resistance is mediated by dimerization of aberrantly splicedBRAF(V600E).Nature2011;480:387-90.
[0571] QUEIROLO P,Picasso V,Spagnolo F.Combined BRAF and MEK inhibition forthe treatment of BRAF-mutated metastatic melanoma.Cancer Treat Rev 2015;41:519-26.
[0572] RASOLA A,Sciacovelli M,Chiara F,Pantic B,Brusilow WS,BernardiP.Activation of mitochondrial ERK protects cancer cells from death throughinhibition of the permeability transition.Proc NatlAcad Sci U S A 2010;107:726-31.
[0573] RIZOS H,Menzies AM,Pupo GM,Carlino MS,Fung C,Hyman J,et al.BRAFinhibitor resistance mechanisms in metastatic melanoma:spectrum and clinicalimpact.Clin Cancer Res2014:20:1965-77.
[0574] ROBERT C,Karaszewska B,Schachter J,Rutkowski P,Mackiewicz A,Stroiakovski D,et al.Improved overall survival in melanoma with combined abrafenib and trametinib.N Engl J Med2015:372:30-9.
[0575] [ PMC free article ] [ PubMed ] Romeo Y, Zhang X, Roux PP.Regulation and function of the RSK family of protein kinases.Biochem J 2012:441:553-69.
[0576] RUDOLPH J,Xiao Y,Pardi A,Ahn NG.Slow inhibition and conformationselective properties of extracellular signal-regulated kinase 1 and 2 inhibitors.Biochemistry 2015:54:22-31.
[0577] SHAUL YD,Seger R.The MEK / ERK cascade:from signaling specificity todiverse functions.Biochim Biophys Acta2007:1773:1213-26.
[0578] SHI H,Hugo W,Kong X,Hong A,Koya RC,Moriceau G,et al.
[0579] Acquired resistance and clonal evolution in melanoma during BRAFinhibitor therapy.Cancer Discov 2014;4:80-93.
[0580] SHIMA,F,Yoshikawa,Y,Ye,M,Araki,M,Matsumoto,S,Liao,J,Hu,
[0581] L,Sugimoto,T,Ijiri,Y,Takeda,A,Nishiyama,Y,Sato,C,Muraoka,S,Tamura,A,Osoda,T,Tsuda,K-I,Miyakawa,T,Fukunishi,H,Shimada,J,Kumasaka,Yamamoto,M,Kataoka,T.
[0582] In silico discovery of small-molecule Ras inhibitors that displayantitumor activity by blocking the Ras-effector interaction.PNAS.
[0583] 2013;110(20):8182-7.
[0584] SCHUBBERT S,Shannon K,Bollag G.Hyperactive Ras in developmentaldisorders and cancer.Nat Rev Cancer2007;7:295-308.
[0585] Sun C,Hobor S,Bertotti A,Zecchin D,Huang S,Galimi F,et al.Intrinsicresistance to MEK inhibition in KRAS mutant lung and colon cancer throughtranscriptional induction of ERBB3.Cell Rep 2014;7:86-93.
[0586] TAFLINAR[package insert].Research Triangle Park,NC:
[0587] GlaxoSmithKline;2015.
[0588] TRUNZER K,Pavlick AC,Schuchter L,Gonzalez R,McArthur GA,Hutson TE,etal.Pharmacodynamic effects and mechanisms of resistance to vemurafenib inpatients with metastatic melanoma.J Clin Oncol 2013;31:1767-74.
[0589] VILLANUEVA,J.,et al.Acquired resistance to BRAF inhibitors mediatedby a RAF kinase switch in melanoma can be overcome by cotargeting MEK andIGF-1R / PI3K.Cancer Cell.2010;18:683-695.
[0590] WAGLE,N.,et al.Dissecting therapeutic resistance to RAF inhibition inmelanoma by tumor genomic profiling.Journal of Clinical Oncology 2011;29(22):3085-3096.
[0591] WAGLE N,Van Allen EM,Treacy DJ,Frederick DT,Cooper ZA,Taylor-WeinerA,et al.MAP kinase pathway alterations in BRAF-mutant melanoma patients withacquired resistance to combined RAF / MEK inhibition.Cancer Discov 2014;4:61-8.Wainstein E,Seger R.The dynamic subcellular localization of ERK:
[0592] mechanisms of translocation and role in various organelles.Curr OpinCell Biol 2016;39:15-20.
[0593] WANG,H.,et al.Identification of the MEK1(F129L)activating mutation asa potential mechanism of acquired resistance to MEK inhibition in humancancers carrying the B-RAF V600E mutation.
[0594] Cancer Res(2011);71(16):5535-45.
[0595] Yang W,Soares J,Greninger P,Edelman EJ,Lightfoot H,Forbes S,etal.Genomics of Drug Sensitivity in Cancer(GDSC):a resource for therapeuticbiomarker discovery in cancer cells.Nucleic Acids Res 2013;41:D955-D961.
[0596] Yao Z,Torres NM,Tao A,Gao Y,Luo L,Li Q,et al.BRAF Mutants Evade ERK-Dependent Feedback by Different Mechanisms that Determine Their Sensitivity to Pharmacologic Inhibition.Cancer Cell 2015;28:370-83.
[0597] Yohe S.Molecular genetic markers in acute myeloid leukemia.J Clin Med2015;4:460-78.
[0598] Zelboraf [package insert]. South San Francisco, CA: Genentech USA, Inc.; 2015.
[0599] All documents cited in this application are hereby incorporated by reference as if fully incorporated herein.
[0600] Although illustrative embodiments of the present invention have been described herein, it should be understood that the invention is not limited to those described and that various other changes or modifications may be made by those skilled in the art without departing from the scope or spirit of the invention.
Claims
1. A method for treating a subject with unresectable or metastatic BRAF600 mutation-positive melanoma, comprising administering to the subject 600 mg BID of BVD-523 or a pharmaceutically acceptable salt thereof.
2. The method of claim 1, wherein the mutation is BRAF V600E mutation.
3. The method of claim 1, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.
4. The method of claim 1, wherein the mammal is a human.
5. The method of claim 1, wherein the melanoma has MAPK activity.
6. A composition for treating a subject with unresectable or metastatic BRAF600 mutation-positive melanoma, the composition comprising 600 mg of BVD-523 or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable carrier, adjuvant or vehicle.
7. The composition of claim 6, wherein the subject is a mammal.
8. The composition according to claim 6, wherein the mammal is selected from the group consisting of humans, primates, farm animals and domestic animals.
9. The composition according to claim 6, wherein the mammal is a human.
10. The composition of claim 6, wherein the melanoma has MAPK activity.
11. The composition of claim 6, wherein the mutation is BRAF V600E mutation.
Citation Information
Patent Citations
Photoactive Metal Nitrosyls For Blood Pressure Regulation And Cancer Therapy
US20110152230A1
Methods for Determining Sequence Variants Using Ultra-Deep Sequencing
US20120264632A1
Detection of nucleic acids by target-specific hybrid capture method
US20130203632A1
DNA sequencing by mass spectrometry via exonuclease degradation
US5622824A
DNA sequencing by mass spectrometry via exonuclease degradation
US6140053A