Nonapeptide aptamer PA2 and application thereof in prevention and treatment of botrytis cinerea

Abstract

The invention relates to a nonapeptide aptamer PA2 and application thereof in prevention and treatment of tomato gray mold, and belongs to the technical field of tomato disease prevention and treatment. In order to solve the problem that a polypeptide aptamer capable of targeting botrytis cinerea lacks in the prior art, the invention provides a nonapeptide aptamer PA2 targeting botrytis cinerea BcBMP3 protein, and the amino acid sequence of the nonapeptide aptamer PA2 is as shown in SEQ ID NO: 1. The nonapeptide aptamer PA2 provided by the invention can be specifically combined with BcBMP3 protein of botrytis cinerea, can inhibit the hypha growth capability of botrytis cinerea and prevent botrytis cinerea from infecting tomato leaves, and can be used for preparing polypeptide biopesticide to prevent and treat botrytis cinerea. Meanwhile, the nucleic acid molecule for coding the nonapeptide aptamer PA2 is introduced into a plant cell as an exogenous gene, a tomato variety capable of resisting gray mold can be cultivated, and the method has important significance on genetic improvement of tomato gray mold resistance and breeding of disease-resistant varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of tomato disease prevention and control, and in particular relates to a nonapeptide aptamer PA2 and application thereof in preventing and controlling tomato gray mold. Background Art

[0002] Tomato (Solanum lycopersicum L.) is one of the most important vegetable crops in the world and has great economic value. However, gray mold caused by Botrytis cinerea has seriously restricted the development of the global tomato industry, causing direct economic losses of up to tens of billions of yuan. The current strategy for the prevention and control of tomato gray mold mainly relies on the application of broad-spectrum chemical pesticides, but this strategy has the following limitations: (1) It destroys the ecological balance and causes environmental pollution. (2) It enhances the resistance of Botrytis cinerea to pesticides and reduces the field control effect of pesticides. Compared with broad-spectrum chemical pesticide control, the use of disease-resistant crop varieties to control field diseases has attracted widespread attention due to its green and sustainable characteristics. However, Botrytis cinerea lacks conserved effect factors that can be recognized by R proteins, so it is impossible to use R proteins to cultivate crop varieties with complete resistance to gray mold.

[0003] In response to the above challenges, new technical means are urgently needed to be developed for the breeding of gray mold-resistant varieties. In recent years, the use of peptide aptamers (PAs) technology that specifically targets plant viruses has become one of the research hotspots. Peptide aptamer technology has become a potential alternative to break through the limitations of broad-spectrum chemical pesticides and traditional breeding due to its high specificity, greenness and sustainability. For example, Rudolph et al. screened peptide aptamers targeting the nucleocapsid (N) protein of tomato spotted wilt virus and constructed transgenic Nicotiana benthamiana strains that have broad-spectrum resistance to five tomato spotted wilt virus genus viruses. Patent application documents with application numbers 202411289190.3 and 202310626012.4 disclose peptide ligands SR-22 and RR-8 that target pathogenic oomycetes. Experiments have shown that SR-22 and RR-8 can prevent and control litchi downy mildew and potato late blight.

[0004] However, research on the use of peptide aptamers targeting Botrytis cinerea to control tomato gray mold and even to cultivate disease-resistant crop varieties is still blank. Summary of the Invention

[0005] To solve the problem that the existing technology lacks polypeptide aptamers that can target Botrytis cinerea, the present invention provides a nonapeptide aptamer PA2 targeting the BcBMP3 protein of Botrytis cinerea and its application in preventing and controlling tomato gray mold.

[0006] The technical solution of the present invention:

[0007] A nonapeptide aptamer PA2, whose amino acid sequence is shown in SEQ ID NO: 1, specifically HisArgArgAlaThrArgPheTrpThr.

[0008] Furthermore, the nucleotide sequence encoding the nonapeptide aptamer PA2 is shown in SEQ ID NO: 2.

[0009] Furthermore, the first amino acid residue at the N-terminus of the nonapeptide aptamer PA2 is acetylated, and the first amino acid residue at the C-terminus is amidated.

[0010] Furthermore, the first amino acid His at the N-terminus of the nonapeptide aptamer PA2 is replaced with a basic amino acid Arg or Lys.

[0011] and / or the second amino acid Arg at the N-terminus is replaced with a basic amino acid His or Lys,

[0012] and / or the third amino acid Arg at the N-terminus is replaced with a basic amino acid His or Lys,

[0013] and / or the N-terminal 4th amino acid Ala is replaced with a hydrophobic amino acid Phe, Leu, Met, Trp, Pro, Val or Ile,

[0014] and / or the fifth amino acid Thr at the N-terminus is replaced by a polar uncharged amino acid Gys, Gly, Gln, Asn, Ser or Tyr,

[0015] and / or the sixth amino acid Arg at the N-terminus is replaced with a basic amino acid His or Lys,

[0016] and / or the N-terminal 7th amino acid Phe is replaced by a hydrophobic amino acid Ala, Leu, Met, Trp, Pro, Val or Ile,

[0017] and / or the N-terminal 8th amino acid Trp is replaced by a hydrophobic amino acid Phe, Ala, Leu, Met, Pro, Val or Ile,

[0018] and / or the N-terminal 9th amino acid Thr is replaced by a polar uncharged amino acid Gys, Gly, Gln, Asn, Ser or Tyr.

[0019] The present invention provides an application of the nonapeptide aptamer PA2 in preventing and controlling tomato gray mold.

[0020] Furthermore, the nonapeptide aptamer PA2 was used to prepare polypeptide biopesticides.

[0021] Furthermore, the polypeptide biopesticide can specifically bind to the BcBMP3 protein of Botrytis cinerea, inhibit the growth of Botrytis cinerea hyphae and prevent Botrytis cinerea from infecting tomato plants.

[0022] Furthermore, a nucleic acid molecule encoding the nonapeptide aptamer PA2 containing the nucleotide sequence shown in SEQ ID NO: 2 was introduced into plant cells as an exogenous gene for breeding gray mold-resistant tomato varieties.

[0023] Furthermore, the methods for introducing the exogenous gene into plant cells include conventional biotechnology means such as Agrobacterium-mediated vector transformation, plant virus vector, direct DNA transformation, microinjection, and electroporation.

[0024] Furthermore, the nucleic acid molecule encoding the nonapeptide aptamer PA2 containing the nucleotide sequence shown in SEQ ID NO: 2 also includes a nucleic acid fragment encoding a plant-derived signal peptide or a precursor thereof.

[0025] Furthermore, the plant-derived signal peptide is SCOOP12 signal peptide.

[0026] Beneficial effects of the present invention:

[0027] The nonapeptide aptamer PA2 provided by the present invention can specifically bind to the BcBMP3 protein of Botrytis cinerea, inhibiting the growth of Botrytis cinerea hyphae and preventing the infection of tomato leaves. Amino acid sequence-derived mutants obtained by replacing amino acids of the same type at amino acid sites in the nonapeptide aptamer PA2 provided by the present invention also have the ability to specifically bind to the BcBMP3 protein of Botrytis cinerea and inhibit the growth of Botrytis cinerea hyphae. The nonapeptide aptamer PA2 and its amino acid sequence-derived mutants can be used to prepare polypeptide biopesticides to control tomato gray mold. Furthermore, the introduction of nucleic acid molecules encoding the nonapeptide aptamer PA2 as exogenous genes into plant cells can also cultivate tomato varieties resistant to gray mold, which is of great significance for the genetic improvement of tomato varieties resistant to gray mold and the selection of disease-resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 These are photos of colony growth on the SD / -Leu / -Trp medium and the SD / -Leu / -Trp / -His / -Ade four-deficient culture plate in the yeast two-hybrid experiment in Example 1;

[0029] Figure 2 This is a photo of the Botrytis cinerea colony in the plate antibacterial test in Example 2;

[0030] Figure 3 This is a photo of tomato leaves used in the tomato gray mold control effect verification test in Example 3. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described below in conjunction with the examples, but is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention (replacing the amino acids in the nonapeptide aptamer with other amino acids of the same type) without departing from the spirit and scope of the technical solution of the present invention shall be included in the scope of protection of the present invention. The process equipment or devices not specifically noted in the following examples are all conventional equipment or devices in the art. Unless otherwise specified, the raw materials used in the examples of the present invention can be obtained commercially; unless otherwise specified, the technical means used in the examples of the present invention are all conventional means well known to those skilled in the art.

[0032] Example 1

[0033] The Botrytis cinerea protein BcBMP3, a downstream kinase in the MAPK pathway, is part of the cell wall integrity (CWI) signaling pathway. Within this pathway, BcBMP3 forms a complex with the upstream kinase BcMKK1 and the scaffold protein BcPro40 to regulate hyphal growth, conidia formation, and activate the expression of pathogenicity-related genes. Therefore, BcBMP3 plays a dual regulatory role in both the development and pathogenicity of Botrytis cinerea.

[0034] Based on this, the present invention uses BcBMP3 protein as a key target for the development of polypeptide aptamers. The yeast two-hybrid technology is used to screen a nonapeptide aptamer that specifically binds to the BcBMP3 protein and name it PA2. Its amino acid sequence is shown in SEQ ID NO: 1, with a total length of 9aa. The nucleotide sequence encoding the nonapeptide aptamer PA2 is shown in SEQ ID NO: 2, with a sequence length of 27bp.

[0035] The nonapeptide aptamer PA2 provided in this embodiment has the first amino acid residue at the N-terminus modified by acetylation and the first amino acid residue at the C-terminus modified by amidation, specifically AC-HisArgArgAlaThrArgPheTrpThr-NH2, where AC is acetylated (-COCH3) and NH2 is amidated (-CONH2).

[0036] This example provides a yeast two-hybrid experiment to verify the interaction between the nonapeptide aptamer PA2 and the BcBMP3 protein of Botrytis cinerea. The specific implementation steps are as follows:

[0037] Step 1: Using the cDNA of Botrytis cinerea strain B05.10 as a template, conventional PCR amplification was performed using primers BcBMP3-BD-F and BcBMP3-BD-R to obtain the BcBMP3 gene.

[0038] The nucleotide sequence of primer BcBMP3-BD-F is shown in SEQ ID NO: 3, specifically:

[0039] BcBMP3-BD-F:ATTCTCAGAGGAGGACCTGATGGCAGACCTGCAAGGA;

[0040] The nucleotide sequence of primer BcBMP3-BD-R is shown in SEQ ID NO: 4, specifically:

[0041] BcBMP3-BD-R:AAACCCCTCAAGACCCGTCGATCGCATAGCATCCAA.

[0042] Step 2: The PCR product obtained in step 1 was recovered by agarose gel electrophoresis, and then ligated into the pGBKT7 (BD) vector by homologous recombination to obtain pGBKT7-BcBMP3; the nonapeptide aptamer PA2 was synthesized by chemical synthesis, and the nucleic acid fragment encoding the nonapeptide aptamer PA2 was cloned into the pGADT7 (AD) vector to obtain pGADT7-PA2.

[0043] Step 3. Prepare competent yeast: ① Streak the ultra-low temperature frozen yeast strain AH109 on YPDA solid culture medium and culture at 30℃ for 3 days. ② Pick a single colony and culture it in 20mL YPDA liquid culture and culture it at 30℃ and 180rpm overnight. Inoculate an appropriate amount of bacterial liquid into 200mL YPDA liquid culture medium and continue to expand the culture until OD600 = 0.6. ③ Centrifuge the bacterial liquid at 2200rpm for 10min, discard the supernatant and wash the bacteria with 50mL ultrapure water. Add 1.5mL of 1×TE / LiAc pre-cooled on ice to the bacteria to resuspend the bacteria;

[0044] Step 4: Use the recombinant plasmid from step 2 to transform competent yeast:

[0045] ① Add at least 1 μg of pGBKT7-BcBMP3 and pGADT7-PA2 recombinant plasmids (BD:BcBMP3 / AD:PA2) and 10 μL of salmon sperm carrier DNA to 100 μL of yeast competent cells.

[0046] At the same time, yeast competent cells were co-transformed with empty vector AD and pGBKT7-BcBMP3 recombinant plasmid (BD:BcBMP3 / AD:Empty), and yeast competent cells were co-transformed with empty vector BD and pGADT7-PA2 recombinant plasmid (BD:Empty / AD:PA2) as negative controls.

[0047] ②Add 600 μL of PEG / LiAC, mix well, and place at 30°C for 30 min.

[0048] ③Add 70 μL of DMSO and incubate in a 42°C water bath for 20 minutes.

[0049] ④ Place on ice for 5 minutes, then centrifuge at 12000 rpm for 1 minute.

[0050] ⑤ Add 100 μL of 0.9% NaCl solution to each of the three transformed yeast competent cells, and spread them onto SD-Leu-Trp solid screening medium and SD / -Leu / -Trp / -His / -Ade four-deficient culture plates, respectively. Culture at 30°C for 2-3 days to verify the interaction between BcBMP3 protein and the nonapeptide aptamer PA2.

[0051] Figure 1 The following are photos of colony growth on SD / -Leu / -Trp medium and SD / -Leu / -Trp / -His / -Ade four-deficient culture plates in the yeast two-hybrid experiment of this example; Figure 1 It can be seen that all three yeasts grew colonies on the SD / -Leu / -Trp medium, indicating that the recombinant plasmid transformation was successful. Only the yeast containing both the recombinant plasmids pGBKT7-BcBMP3 and pGADT7-PA2 grew blue colonies on the SD / -Leu / -Trp / -His / -Ade culture plate, indicating that the two proteins interacted, further proving that the nonapeptide aptamer PA2 can specifically bind to the BcBMP3 protein of Botrytis cinerea.

[0052] Example 2

[0053] In this example, the inhibitory effect of the nonapeptide aptamer PA2 on Botrytis cinerea was verified by a plate antibacterial test.

[0054] The nonapeptide aptamer PA2 provided in Example 1 was added to PDA solid culture medium at the following concentrations: 0 μM, 25 μM, 50 μM, and 100 μM. After the culture medium solidified, a 6 mm borer was used to inoculate the Botrytis cinerea strain B05.10. The culture was incubated at 25°C for 3 days. This experiment was repeated three times: Replicate 1, Replicate 2, and Replicate 3. The 0 μM concentration represents no PA2 addition to the plate, serving as a negative control. The effect of the nonapeptide aptamer PA2 on the mycelial growth of Botrytis cinerea was verified by measuring the radial diameter of the colonies on the culture medium.

[0055] Figure 2 This is a photo of the Botrytis cinerea colony in the plate antibacterial test of this embodiment; Figure 2 It can be seen that adding a low concentration of nonapeptide aptamer PA2 (25 μM) to the PDA plate has an inhibitory effect on the hyphae growth of Botrytis cinerea, and adding a 100 μM concentration of nonapeptide aptamer PA2 has a significant inhibitory effect on the hyphae growth of Botrytis cinerea.

[0056] Example 3

[0057] This example investigates the control effect of the nonapeptide aptamer PA2 on tomato gray mold.

[0058] The Botrytis cinerea strain B05.10 cultured at 25°C for one week was rinsed with 2-3 mL of sterile water, shaken vigorously, and filtered. The conidia suspension was counted and diluted to a concentration of 1 × 10 5 The conidia suspension was mixed with the following concentration gradients of 50 μM, 100 μM and 200 μM nonapeptide aptamer PA2 and PBS buffer solution (0 μM), and 10 μL of the mixture was inoculated on 3-6 week old detached tomato leaves. The disease condition of the inoculated leaves was observed 3-5 days after inoculation, and the lesion area was recorded to verify the control effect of PA2 on tomato gray mold.

[0059] Figure 3 The following is a photo of tomato leaves used in the tomato gray mold control efficacy test in this example. In the photo, B05.10 is a conidia suspension of a standard strain of Botrytis cinerea, and B05.10+PBS is a conidia suspension of a standard strain of Botrytis cinerea mixed with PBS buffer to treat tomato leaves to eliminate the effect of PBS buffer on the onset of tomato gray mold. Figure 3 Analysis of the efficacy of the nonapeptide aptamer PA2 in controlling tomato gray mold showed that the combination of B05.10 + 100 μM PA2, i.e., mixing 100 μM of the nonapeptide aptamer PA2 with conidia of the B05.10 strain and inoculating tomato leaves, significantly inhibited the infection of Botrytis cinerea on tomato leaves. The combination of B05.10 + 200 μM PA2, i.e., 200 μM of the nonapeptide aptamer PA2, completely inhibited the infection of Botrytis cinerea on tomato leaves.

[0060] Example 4

[0061] This example provides an amino acid sequence-derived mutant 1 of the nonapeptide aptamer PA2 of Example 1, wherein the first amino acid His at the N-terminus of the nonapeptide aptamer PA2 of Example 1 is replaced with a basic amino acid Lys, the second amino acid Arg at the N-terminus is replaced with a basic amino acid His, the third amino acid Arg at the N-terminus is replaced with a basic amino acid His, the fourth amino acid Ala at the N-terminus is replaced with a hydrophobic amino acid Val, the fifth amino acid Thr at the N-terminus is replaced with a polar uncharged amino acid Gln, the sixth amino acid Arg at the N-terminus is replaced with a basic amino acid His, the seventh amino acid Phe at the N-terminus is replaced with a hydrophobic amino acid Trp, the eighth amino acid Trp at the N-terminus is replaced with a hydrophobic amino acid Phe, and the ninth amino acid Thr at the N-terminus is replaced with a polar uncharged amino acid Ser.

[0062] The amino acid sequence of the amino acid sequence-derived mutant 1 obtained in this example is shown in SEQ ID NO: 5, wherein the first amino acid residue at the N-terminus is acetylated and the first amino acid residue at the C-terminus is amidated, specifically AC-LysHisHisValGlnHisTrpPheSer-NH2, where AC is acetylated (-COCH3) and NH2 is amidated (-CONH2).

[0063] Example 5

[0064] This example provides an amino acid sequence-derived mutant 2 of the nonapeptide aptamer PA2 of Example 1, wherein the first amino acid His at the N-terminus of the nonapeptide aptamer PA2 of Example 1 is replaced with a basic amino acid Arg, the second amino acid Arg at the N-terminus is replaced with a basic amino acid His, the third amino acid Arg at the N-terminus is replaced with a basic amino acid Lys, the fourth amino acid Ala at the N-terminus is replaced with a hydrophobic amino acid Ile, the fifth amino acid Thr at the N-terminus is replaced with a polar uncharged amino acid Tyr, the sixth amino acid Arg at the N-terminus is replaced with a basic amino acid Lys, the seventh amino acid Phe at the N-terminus is replaced with a hydrophobic amino acid Leu, the eighth amino acid Trp at the N-terminus is replaced with a hydrophobic amino acid Val, and the ninth amino acid Thr at the N-terminus is replaced with a polar uncharged amino acid Gln.

[0065] The amino acid sequence of the amino acid sequence-derived mutant 2 obtained in this example is shown in SEQ ID NO: 6, wherein the first amino acid residue at the N-terminus is acetylated and the first amino acid residue at the C-terminus is amidated, specifically AC-ArgHisLysIleTyrLysLeuValGln-NH2, where AC is acetylated (-COCH3) and NH2 is amidated (-CONH2).

Claims

1. A nonapeptide aptamer PA2, characterized in that: Its amino acid sequence is shown in SEQ ID NO: 1, specifically HisArgArgAlaThrArgPheTrpThr.

2. The nonapeptide aptamer PA2 according to claim 1, characterized in that: The nucleotide sequence encoding the nonapeptide aptamer PA2 is shown in SEQ ID NO:

2.

3. The nonapeptide aptamer PA2 according to claim 1, characterized in that: The first amino acid residue at the N-terminus of the nonapeptide aptamer PA2 is acetylated, and the first amino acid residue at the C-terminus is amidated.

4. The nonapeptide aptamer PA2 according to claim 1 or 3, characterized in that: The first amino acid His at the N-terminus of the nonapeptide aptamer PA2 is replaced with a basic amino acid Arg or Lys. and / or the second amino acid Arg at the N-terminus is replaced with a basic amino acid His or Lys, and / or the third amino acid Arg at the N-terminus is replaced with a basic amino acid His or Lys, and / or the N-terminal 4th amino acid Ala is replaced with a hydrophobic amino acid Phe, Leu, Met, Trp, Pro, Val or Ile, and / or the fifth amino acid Thr at the N-terminus is replaced by a polar uncharged amino acid Gys, Gly, Gln, Asn, Ser or Tyr, and / or the sixth amino acid Arg at the N-terminus is replaced with a basic amino acid His or Lys, and / or the N-terminal 7th amino acid Phe is replaced by a hydrophobic amino acid Ala, Leu, Met, Trp, Pro, Val or Ile, and / or the N-terminal 8th amino acid Trp is replaced by a hydrophobic amino acid Phe, Ala, Leu, Met, Pro, Val or Ile, and / or the N-terminal 9th amino acid Thr is replaced by a polar uncharged amino acid Gys, Gly, Gln, Asn, Ser or Tyr.

5. Use of the nonapeptide aptamer PA2 according to any one of claims 1 to 4 in preventing and controlling tomato gray mold.

6. The use of the nonapeptide aptamer PA2 in preventing and controlling tomato gray mold according to claim 5, characterized in that: The nonapeptide aptamer PA2 was used to prepare polypeptide biopesticides.

7. The use of the nonapeptide aptamer PA2 in preventing and controlling tomato gray mold according to claim 6, characterized in that: The polypeptide biological pesticide can specifically bind to the BcBMP3 protein of Botrytis cinerea, inhibit the growth of Botrytis cinerea hyphae and prevent Botrytis cinerea from infecting tomato plants.

8. The use of the nonapeptide aptamer PA2 in preventing and controlling tomato gray mold according to claim 5, characterized in that: A nucleic acid molecule encoding the nonapeptide aptamer PA2 containing the nucleotide sequence shown in SEQ ID NO: 2 is introduced into plant cells as an exogenous gene to cultivate a tomato variety resistant to gray mold.

9. The use of the nonapeptide aptamer PA2 in preventing and controlling tomato gray mold according to claim 8, characterized in that: The nucleic acid molecule encoding the nonapeptide aptamer PA2 containing the nucleotide sequence shown in SEQ ID NO: 2 also includes a nucleic acid fragment encoding a plant-derived signal peptide or a precursor thereof.

10. Use of the nonapeptide aptamer PA2 in preventing and controlling tomato gray mold according to claim 9, characterized in that: The plant-derived signal peptide is SCOOP12 signal peptide.

Images