Application of GmNramp5b gene in regulation and control of soybean manganese resistance

Abstract

The invention discloses an application of a GmNramp5b gene in regulating and controlling the manganese resistance of soybeans. A member GmNramp5b of a GmNramp family is screened based on soybean transcriptome analysis, through qRT-PCR identification, gene cloning, overexpression vector construction and arabidopsis thaliana genetic transformation, the biological function of the GmNramp5b when soybean seedling root systems and leaves suffer from manganese toxicity stress and the molecular mechanism for regulating and responding to manganese toxicity stress are analyzed, and the application of the GmNramp5b in the soybean seedling root systems and leaves is established. It is found that over-expression of the GmNramp5b gene can improve the manganese resistance of the plant; therefore, the GmNramp5b gene can be used for cultivating manganese-resistant high-quality soybeans.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular breeding, and particularly relates to application of the GmNramp5b gene in regulating manganese tolerance in soybean. Background Art

[0002] Soybean ( Glycine max Soybean (Soybean) is an important grain and oil crop, ensuring daily life and production needs. Manganese toxicity (Mn) inhibits soybean plant growth, becoming a major factor limiting soybean yield and quality. Natural resistance-associated macrophage protein (Nramp) may play an important role in metal ion transport. However, the mechanism of soybean response to Mn toxicity remains unclear, and few studies have examined the function of the soybean Nramp gene family in Mn transport. Summary of the Invention

[0003] In view of the above-mentioned deficiencies in the prior art, the object of the present invention is to provide an application of the GmNramp5b gene in regulating manganese tolerance in soybean.

[0004] The first object of the present invention is to provide a GmNramp5b protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0005] The second object of the present invention is to provide a GmNramp5b gene encoding the GmNramp5b protein.

[0006] Preferably, the nucleotide sequence of the CDS of the GmNramp5b gene is shown in SEQ ID NO.1.

[0007] The third object of the present invention is to provide a recombinant vector containing the GmNramp5b gene.

[0008] Preferably, the recombinant vector is a vector for overexpressing the GmNramp5b gene, and the vector backbone is pTF101s.

[0009] The fourth object of the present invention is to provide a recombinant cell containing the GmNramp5b gene.

[0010] The fifth object of the present invention is to provide the use of the GmNramp5b gene in regulating plant manganese tolerance.

[0011] Preferably, the application is the application of overexpressing the GmNramp5b gene in improving plant manganese tolerance.

[0012] Preferably, the plant is soybean or Arabidopsis thaliana.

[0013] Using soybean (Yuechun 03-3) as the experimental material, this study identified GmNramp5b, a member of the GmNramp family, based on transcriptome analysis. Through qRT-PCR identification, gene cloning, overexpression vector construction, and genetic transformation in Arabidopsis thaliana, the authors analyzed the biological functions of GmNramp5b in soybean seedling roots and leaves exposed to manganese toxicity, thereby exploring the molecular mechanism by which GmNramp5b regulates soybean responses to manganese toxicity. The authors found that overexpressing the GmNramp5b gene can improve plant manganese tolerance; therefore, the GmNramp5b gene could be used to cultivate high-quality, manganese-tolerant soybeans. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the structure of the GmNramp5b gene; yellow represents exons, blue represents untranslated regions, and the black solid line represents introns.

[0015] Figure 2 It is the content of some amino acids in GmNramp5b.

[0016] Figure 3 This is the structural analysis of GmNramp5b protein; where A: secondary structure; B: tertiary structure; C: transmembrane domain; D: hydrophilicity / hydrophobicity.

[0017] Figure 4 This is a phylogenetic tree and conserved motif analysis of some plant Nramp proteins; A: phylogenetic tree; B: conserved motif; Gm: soybean; At: Arabidopsis; Ha: sunflower; Ptr: Populus trichocarpa; SlN: tomato; Os: rice; Na: tobacco.

[0018] Figure 5 This is the analysis of cis-acting elements in the GmNramp5b gene promoter.

[0019] Figure 6 It is the construction of subcellular localization vector; among them, A: PCR amplification result of GmNramp5b transient expression vector fragment, M: Marker2000, 1-3: PCR amplification result; B: vector colony PCR detection result, M: Marker2000, 1-2: colony PCR detection result.

[0020] Figure 7The following are the results of GmNramp5b subcellular localization; A: colocalization result of pBWA(V)HS-GmNramp5b-GLosgfp and plasma membrane-localized Maker (OsMCA1); B: subcellular localization result of empty pBWA(V)HS-Glosgfp; GFP: green fluorescent protein signal; Marker: plasma membrane-labeled OsMCA1 protein signal; Chl: chlorophyll autofluorescence signal; BF: bright field; Merge: merge, bar=20 µm.

[0021] Figure 8 Overexpression vector construction and positive detection; A: GmNramp5b fragment PCR amplification electrophoresis, 1-5: PCR amplification results; B: Overexpression vector colony PCR amplification results, 1-5: colony PCR results; C: GV3101 colony PCR amplification results, 1-3: colony PCR results; D: Resistance gene Bar detection results, 1-4: Bar detection results; E: GmNramp5b detection results; M in the figure is Marker (AD: 2000, E: 5000).

[0022] Figure 9 Effects of different manganese concentrations on root length of wild-type and overexpression Arabidopsis thaliana; A: 1 / 2 MS; B: 1 / 2 MS+1.5 mM Mn; C: root length statistics; Bar=1.4 cm.

[0023] Figure 10 The growth phenotypes of wild-type and overexpression strains of Arabidopsis thaliana under different manganese concentration treatments; A: Growth phenotype under normal conditions; B: Growth phenotype under 3 mM Mn conditions; from left to right: wild type (WT), overexpression strains (OX1, OX2, OX3), Bar=2.5 cm.

[0024] Figure 11 Effects of different manganese concentrations on biomass and rosette leaf morphological parameters of wild-type and overexpression Arabidopsis thaliana; A: aboveground fresh weight; B: rosette leaf radius.

[0025] Figure 12 Effects of different manganese concentrations on the photosynthetic pigment content of wild-type and overexpression Arabidopsis thaliana; A: chlorophyll a; B: chlorophyll b; C: total chlorophyll; D: carotenoids.

[0026] Figure 13 The effects of different manganese concentrations on the contents of physiological indicators of wild-type and overexpression strains; A: POD activity; B: SOD activity; C: APX activity; D: CAT activity; E: MDA; F: soluble protein.

[0027] Figure 14is the relative expression level of stress-responsive genes in transgenic Arabidopsis under manganese stress. DETAILED DESCRIPTION

[0028] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.

[0029] Example 1 1. Methods 1 Bioinformatics analysis of soybean GmNramp5b 1.1 GmNramp5b gene and protein structure analysis The genome, transcript, CDS (nucleotide sequence shown in SEQ ID NO. 1), and protein sequence (amino acid sequence shown in SEQ ID NO. 2) of GmNramp5b were obtained from the Phytozome13 database (https: / / phytozome-next.jgi.doe.gov / ). The gene structure and physicochemical properties of GmNramp5b were analyzed using GSDS2.0 and Protparam, respectively. The secondary and tertiary structures of GmNramp5b were analyzed using SOPMA and SWISS-MODEL, respectively. TMHMM and Protscale were used to analyze the transmembrane structure and hydrophilicity of GmNramp5b, respectively.

[0030] 1.2 Protein phylogenetic tree analysis and conserved motif prediction A phylogenetic tree was constructed using MEGA 7.0 (Molecular Evolutionary Genetics Analysis, version 7) to analyze the relationship between soybean GmNramp5b and reported Nramp homologs from other species, including sunflower (Helianthus annuus), rice (Oryza sativa), poplar (Populus trichocarpa), tobacco (Nicotiana attenuata), tomato (Solanum lycopersicum), and Arabidopsis thaliana. Conserved motifs in GmNramp5b and other Nramp proteins were predicted using MEME (Multiple EM for Motif Elicitation) (http: / / meme-suite.org / ).

[0031] 1.3 Analysis of promoter cis-acting elements The cis-acting element of GmNramp5b (upstream 2000 bp) was obtained and exported using the online tools PlantCARE and Tbtools.

[0032] 2. Vector Construction 2.1 Cloning of soybean GmNramp5b Primers (F: ATGCATACATATTACATAATACTTGC; R: CTAAGATATTTCTCTATCAATATCTGTG) were designed based on the CDS sequence of GmNramp5b obtained from the Phytozome13 resource database (https: / / phytozome-next.jgi.doe.gov / ). GmNramp5b was amplified using soybean cDNA as a template, recovered and ligated into the pMD-18T vector, and stored at −20°C for future use.

[0033] E. coli transformation: Transfer 5 µL of the ligation product and DH5α competent cells to a centrifuge tube and gently shake. After cold, heat, and cold stress treatment, place the tube in a centrifuge tube containing 0.5 mL of LB liquid and incubate on a shaker for 1 hour. Transfer the bacterial solution to solid culture medium and incubate for 16 hours at 37°C. Subsequently, incubate a single colony in LB liquid for 3 hours. After sequencing, store the tube in 10% glycerol at -80°C.

[0034] 2.2 Construction of subcellular localization vector The GmNramp5b transient expression vector is pBWA(V)HS-GLosgfp, and the designed primer sequences are: F: 5'-CAGTGGTCTCACAACATGCATACATATTACATAAT-3', R: 5'-CAGTGGTCTCATACAAGATATTTCTCTATCAATAT-3'.

[0035] The product obtained in 2.1 was then used to amplify the transiently expressed GmNramp5b fragment. PCR settings were as follows: 94°C pre-denaturation for 5 min; 35 cycles of 94°C denaturation for 30 s, 58°C annealing for 45 s, and 72°C extension for 106 s; and incubation at 72°C for 10 min. The product was purified and digested with Bsa I to obtain the linearized plasmid and digestion product. The recombination reaction system was then prepared according to the kit instructions. E. coli transformation was performed as described above.

[0036] 2.3 Overexpression vector construction The GmNramp5b overexpression vector is pTF101s, and the designed primer sequences are: F:TTCGCGAGCTCGGTACCCGGGATGCATACATATTACATAATACTTGC, R: CGACTCTAGAGGATCCCCGGGCTAAGATATTTCTCTATCAATATCTGTG.

[0037] The CDS sequence of GmNramp5b was amplified using the above primers, following the same PCR amplification procedure as above. The purified product was then digested with Sma I to obtain a linearized plasmid and digestion product. The recombination reaction system was then prepared according to the kit instructions. Escherichia coli and Agrobacterium tumefaciens were then transformed.

[0038] Agrobacterium transformation: Transfer 5 µL of the pTF101s-GmNramp5b recombinant plasmid to a 1.5 mL centrifuge tube containing GV3101 Agrobacterium. Vortex the mixture, place on ice for 5 minutes, and then quickly freeze in liquid nitrogen. Heat the mixture in a 37°C water bath and place on ice again for 5 minutes. Then, add 0.7 mL of YEP to the tube and incubate for 2 hours at 28°C. Incubate overnight on solid medium (containing Spec and Rif) at 28°C. Individual colonies will then be cultured in YEP liquid medium with shaking for 48 hours. Finally, test for positive results.

[0039] 2.4 GmNramp5b subcellular localization Following a previously reported method, intact young leaves of Arabidopsis seedlings were enzymatically digested, washed with W5 solution, and suspended in MMG to obtain a protoplast suspension. The recombinant plasmid pBWA(V)HS-GmNramp5b-GLosgfp and a tonoplast-localizing marker (OsMCA1) plasmid were then added to the protoplast suspension for co-transformation. The protoplasts were then incubated in the dark for 2 days. Using an empty pBWA(V)HS-GLosgfp plasmid as a control, the fluorescence signal distribution within the protoplasts was observed using a laser confocal scanning microscope (Zeiss LSM780, Germany) under excitation at 488 nm / 510 nm.

[0040] 2.5 Genetic transformation of GmNramp5b 2.5.1 Genetic transformation of Arabidopsis thaliana to overexpress GmNramp5b Following the reported method, Agrobacterium transformed with the pTF101S-GmNramp5b recombinant plasmid was activated twice using plates (containing Spec and Rif). Single colonies were cultured in YEP (containing Spec and Rif) at 180 rpm and 28°C for 48 h. Subsequently, the culture was expanded using 100 mL of YEP (containing Spec and Rif) and the cells were harvested. A 1 / 2 MS solution containing 5% sucrose and a surfactant (0.03% Silwet L-77) was added to the cells to prepare the infection solution (OD600 range 0.8-1). Arabidopsis infection requires lush flowering. Widthed inflorescences and formed fruit pods were removed, and the inflorescences were submerged in the infection solution for 35 seconds before being removed (the same plant was infected four times every 5 days). Water was removed from the inflorescences, and the cells were incubated in the dark and moist for 14 h. The cells were then placed in an artificial climate chamber for normal incubation and harvested.

[0041] 2.5.2 Homozygous screening of transgenic Arabidopsis Place an appropriate amount of harvested T0 seed ramets into a 1.5 mL centrifuge tube. Place the tube in a desiccator with a beaker at the bottom. Add 100 mL of sodium hypochlorite and 4.2 mL of hydrochloric acid. Once the gas is generated, cover the desiccator and fumigate for 14 hours. After disinfection, move to a clean bench and blow out the chlorine. Sow the seeds on a screening medium containing herbicide and incubate in an artificial climate chamber for 15 days. Select T0 seedlings with green leaves and transfer them to nutrient soil for incubation. After 30 days of incubation, identify positive plants using the Bar test. Once confirmed, harvest the seeds and continue to propagate them for testing until the T2 generation is homozygous, at which time experimental analysis is performed.

[0042] 2.5.3 Arabidopsis treatment analysis T2 and wild-type seeds were germinated in nutrient soil for 7 days. The germinated seedlings were transplanted into small pots filled with nutrient soil, with four plants per pot. After 12 days of growth, the plants were treated with normal (distilled water) and manganese stress (3 mM Mn) treatments. After seven treatments, treatments were repeated every three days. Morphological indicators, fresh and dry weights, photosynthetic pigment content, antioxidant enzyme activity, and expression of stress-related genes were then measured. Three biological replicates were performed for each indicator.

[0043] Root length was determined by sterilizing the seeds as described in 2.5.2. The seeds were then sown on normal growth medium (1 / 2 MS) and manganese-containing medium (1.5 mM Mn + 1 / 2 MS) for 15 days and statistically analyzed. Three biological replicates were performed.

[0044] 2.6 RNA extraction, reverse transcription, and real-time fluorescence quantitative PCR 2.6.1 RNA extraction and reverse transcription Soybean samples were ground into powder using liquid nitrogen, and total RNA was extracted using an RNA extraction kit (Yisheng Biotechnology, Shanghai). The extracted RNA concentration was determined using a Nano Dorp assay, and reverse transcription was performed using the Hifair® II 1st Strand cDNA Synthesis Kit (Yisheng Biotechnology, Shanghai) to generate cDNA, which was stored at -20°C for future use.

[0045] 2.6.2 Real-time fluorescence quantitative PCR Arabidopsis thaliana AtActin (At5g62690) was selected as the internal reference gene. The real-time fluorescence quantitative primers for the target gene were designed as follows: GmNramp5b-RT-F: CCCAGGAAACTTTGAGACAG, GmNramp5b-RT-R: CACTACGGCAATTTCAGCA.

[0046] AtActin-RT-F: GATGTTCAGGCGAGTGAGTGAG, AtActin-RT-R:CGTAGTCACCTTCTTCATCCGC.

[0047] The remaining primer sequences are listed in Appendix 1. Expression analysis was performed using the cDNA obtained in 2.6.1. The first step was denaturation at 95°C for 3 min, followed by denaturation at 95°C for 10 s and annealing / extension at 60°C for 30 s, for 40 cycles. Relative expression was calculated using the 2-∆∆Ct method.

[0048] Table 1 Primer sequences 2. Results 1 GmNramp5b gene structure analysis GmNramp5b is approximately 8844 bp in length and contains 14 exons and 13 introns ( Figure 1 ), with an untranslated region at each end, and the full length of the open reading frame is 1767 bp.

[0049] 2 Analysis of the physicochemical properties of GmNramp5b protein According to the ProtParam prediction results, the molecular formula of GmNramp5b protein is estimated to be C2957H4686N750O805S24, which is composed of 9222 atoms. The isoelectric point, average hydropathic index, instability coefficient and fat coefficient are 9.04, 0.538, 40.62 and 117.26 respectively, which is classified as an unstable protein. It is composed of 588 amino acids, of which leucine, isoleucine, serine and alanine account for 12.9%, 9.7%, 9.2% and 8.3% respectively ( Figure 2 ), accounting for 40.1% of the total.

[0050] 3 GmNramp5b protein structure analysis Through online software analysis, it was found that ( Figure 3 ), the secondary structure of the GmNramp5b protein is dominated by α-helices, accounting for 56.46%, while β-turns account for the lowest proportion, at 1.36%. The tertiary structure of the GmNramp5b protein is predominantly composed of α-helices, with numerous random coils also present. Predicted transmembrane domains of the GmNramp5b protein revealed 12 transmembrane regions, suggesting that GmNramp5b may be an integral membrane protein. Analysis of the GmNramp5b protein revealed that most polypeptide chains exhibit negative values, indicating a high hydrophilicity.

[0051] 4. GmNramp5b protein homology analysis MEGA7.0 was used to construct the evolutionary tree of soybean GmNramp5b and other plants, including Arabidopsis, sunflower, poplar, tomato, tobacco and other Nramp homologous proteins. Figure 4 A shows that GmNramp5b has the highest homology with GmNramp5a, and has the highest homology with other plants including AtNranp1, AtNranp6, PtrNranp6 and HaNranp6. In addition, MEME was used to predict the conserved motifs of Nramp proteins ( Figure 4 B) found that the conserved motifs of Nramp proteins, including GmNramp5b, are highly similar. Therefore, analyzing GmNramp5b may have certain theoretical value in the study of other plant-related homologous proteins.

[0052] 5 Analysis of cis-regulatory elements in the GmNramp5b promoter The cis-acting elements were analyzed by extracting the 2000 bp promoter region upstream of GmNramp5b, and different elements and their positions were distinguished. Figure 5It can be seen that 11 elements are most likely to appear, including defense and stress response, plant hormone response and light response related elements. The presence of these elements will respond to the expression of GmNramp5b and enhance the plant's stress resistance.

[0053] 6 Construction of GmNramp5b subcellular localization vector The GmNramp5b coding region sequence was obtained by PCR amplification, with a length of 1767 bp ( Figure 6 A). The recombinant plasmid pBWA(V)HS-GmNramp5b-Glosgfp was transformed into E. coli DH5α for detection ( Figure 6 B).

[0054] 7 Analysis of GmNramp5b subcellular localization results Arabidopsis leaf protoplasts were used as vectors to transiently express GmNramp5b ( Figure 7 The location of the GmNramp5b-driven GFP fusion expression overlapped with the plasma membrane marker signal, resulting in a superimposed yellow fluorescence. In contrast, the empty control GFP fluorescence signal was widely distributed. This comparison confirmed that the GmNramp5b protein is localized to the plasma membrane.

[0055] 8 Construction of GmNramp5b overexpression vector and positive detection The complete coding region of GmNramp5b was amplified by PCR, with a length of 1767 bp. The recombinant plasmid pTF101s-GmNramp5b overexpression vector was constructed and transformed into Escherichia coli DH5α, followed by sequencing. The pTF101s-GmNramp5b plasmid was transformed into Agrobacterium tumefaciens GV3101. Transgenic Arabidopsis plants were obtained after herbicide screening. The results of GmNramp5b detection in the transformed lines are shown in Figure 2. Figure 8 .

[0056] Effects of GmNramp5b overexpression on root length in Arabidopsis By counting the root length. Figure 9 ) showed that, compared with roots grown under normal conditions and under manganese (1.5 mM) toxicity stress, GmNramp5b overexpression inhibited root growth under manganese toxicity. Compared with the wild-type strain, the root length of the GmNramp5b-overexpressing strain grown under normal conditions increased by an average of 6.55%, a nonsignificant difference, while the root length of the GmNramp5b-overexpressing strain under manganese stress decreased by an average of 20.72%, a significant difference. This suggests that GmNramp5b-overexpressing strains can further reduce manganese absorption and improve manganese tolerance by reducing root length.

[0057] Effects of GmNramp5b overexpression on rosette leaf morphology and biomass in Arabidopsis The results showed that GmNramp5b overexpression promoted the growth of rosette leaves and increased the biomass of the strain ( Figure 10 Compared with the wild-type strain, the average fresh weight of the GmNramp5b overexpressing strain increased by 21.50% and 77.36% under normal conditions and manganese toxicity stress, respectively ( Figure 11 A). At the same time, the rosette leaf radius of the GmNramp5b overexpressing lines increased by an average of 16.67% and 25.20%, respectively ( Figure 11 B).

[0058] Effects of GmNramp5b overexpression on photosynthetic pigment content in Arabidopsis By measuring photosynthetic pigment indicators, it was found that under normal conditions, there was no significant difference in photosynthetic pigment content between GmNramp5b overexpression and wild-type strains, while under manganese toxicity stress, the photosynthetic pigment content showed an overall increasing trend ( Figure 12 Under normal conditions, the chlorophyll a, chlorophyll b, total chlorophyll, and carotenoid contents of the GmNramp5b overexpressing line decreased by an average of 6.87%, 10.92%, 7.86%, and 7.35%, respectively, compared with the wild-type line. Under manganese toxicity stress, the chlorophyll a, chlorophyll b, total chlorophyll, and carotenoid contents of the GmNramp5b overexpressing line decreased by an average of 5.91%, 15.92%, 8.42%, and 2.20%, respectively, compared with the wild-type line. This suggests that the GmNramp5b overexpressing line responds to manganese stress by affecting photosynthesis.

[0059] Effects of GmNramp5b overexpression on physiological and biochemical parameters of Arabidopsis By measuring the physiological indicators of rosette leaves, it was found that under normal conditions, there was no significant difference in the indicators between the overexpression and wild-type lines, but under manganese toxicity stress, there were significant differences in POD, SOD, CAT and MDA between the overexpression and wild-type lines ( Figure 13 Under manganese toxicity stress, the activities of POD, APX, SOD, and CAT increased in the GmNramp5b overexpressing strain, while MDA content decreased. Soluble protein showed no change, indicating that GmNramp5b overexpression activated the antioxidant enzyme system.

[0060] 13 Detection of stress-related gene expression in GmNramp5b transgenic Arabidopsis Expression detection results ( Figure 14), genes related to antioxidant (AtPOD, AtSOD, AtCAT, AtAPX), glucose metabolism (AtHXK, AtGAPDH, AtPFK3), flavonoid biosynthesis (AtCHS, AtCHI, AtANS, AtF3H, AtF3'H), phenylalanine ammonia lyase (AtPAL) and proline synthesis (AtP5CS) were significantly induced in the GmNramp5b overexpression line, and genes related to antioxidant and flavonoid biosynthesis were mainly upregulated.

Claims

1. GmNramp5b protein, characterized in that The amino acid sequence is shown in SEQ ID NO.

2.

2. GmNramp5b gene, characterized in that Encodes the GmNramp5b protein according to claim 1.

3. The GmNramp5b gene according to claim 2, wherein The nucleotide sequence of CDS is shown in SEQ ID NO.

1.

4. A recombinant vector containing the GmNramp5b gene according to claim 2.

5. The recombinant vector according to claim 4, characterized in that This is a vector for overexpressing the GmNramp5b gene, and the vector backbone is pTF101s. A recombinant cell comprising the GmNramp5b gene according to claim 2.

7. Use of the GmNramp5b gene according to claim 2 in regulating manganese tolerance in plants.

8. The use according to claim 7, characterized in that The application of overexpression of GmNramp5b gene in improving plant manganese tolerance.

9. The use according to claim 7, characterized in that The plants are soybean and Arabidopsis thaliana.

Images