Construction method of stable genetic transformation system of water hyacinth

By forming wounds at the base of the stem of the water hyacinth or injecting recombinant bacterial fluid and combining with high osmotic pressure treatment, the seasonal limitation and low conversion rate of the water hyacinth stable genetic transformation system were solved, and efficient and rapid gene editing operations were achieved, which was suitable for bioreactor research of water hyacinths.

CN120505347APending Publication Date: 2025-08-19XIAN UNVERSITY OF ARTS & SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510560834.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-08-19

AI Technical Summary

Technical Problem

In the prior art, the stable genetic transformation system of water hyacinth has low conversion rate, long time and seasonal limitations, making it difficult to apply to bioreactors on a large scale.

Method used

Recombinant bacterial bacteria such as Agrobacterium EHA105 are used to introduce exogenous genes into stem-based meristem cells by forming wounds or injections at the base of the stem of the water hyacinth, and combined with high osmotic pressure treatment to achieve the transformation and differentiation and development of exogenous genes.

Benefits of technology

It has achieved efficient transformation without seasonal restrictions, with a conversion efficiency of more than 10%, and a time of less than 12 weeks, reducing the risk of experimental failure and is suitable for the research and application of water hyacinth as a bioreactor.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120505347A_ABST
    Figure CN120505347A_ABST
Patent Text Reader

Abstract

The invention discloses a construction method of a water hyacinth stable genetic transformation system, which comprises the following steps: enabling recombinant bacteria containing exogenous genes to enter water hyacinth stem meristem cells to realize transformation of the exogenous genes in the water hyacinth stem meristem cells; and differentiating and developing the water hyacinth stem meristem cells into which the exogenous genes are introduced to obtain clone strains, namely transgenic seedlings. The construction method of the water hyacinth stable genetic transformation system provided by the invention is not limited by seasons, and can be carried out at any time all the year round under a greenhouse culture condition. The time for realizing the technology is very short, and the fastest time from transformation operation to obtaining of the first-generation transgenic plantlets is 2-3 weeks. And the conversion efficiency is high and is higher than 10%. The method is simple to operate, the related operations comprise bacterial liquid preparation, bacterial liquid and plant co-culture or direct injection, conventional culture of plants, appearance identification and PCR verification, steps which are easy to pollute and cause experiment failure are avoided, the risk of experiment failure is greatly reduced, and the cost is relatively low.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a method for constructing a stable genetic transformation system of water hyacinth. Background Art

[0002] Water hyacinth, also known as water hyacinth and water hyacinth, is an invasive aquatic plant native to the Amazon basin in South America. It has caused serious ecological and economic problems in many countries and regions, including China. However, its rapid growth and reproduction, rich antioxidant content, and high purification efficiency against a wide range of pollutants give it great potential for resource utilization. Especially in the current era of rapid development of synthetic biology, water hyacinth's unique biological properties make it an excellent bioreactor for the biopharmaceutical and biomanufacturing industries. Unfortunately, a stable and scalable genetic transformation system for water hyacinth has not yet been established, making its transformation into a bioreactor impossible.

[0003] At present, there is only one patent report on the stable genetic transformation system of water hyacinth, namely the genetic transformation method of Eichhornia crassipes (CN 102399812A). This patent reports a pollen-mediated stable genetic transformation method when water hyacinth blooms, with a transformation efficiency of 1.44%. However, this method has a long time cycle, requiring 12 weeks at the earliest from the transformation operation to growing transgenic seedlings. In addition, this method is subject to seasonal restrictions because it can only be carried out when water hyacinth blooms, but water hyacinth generally only blooms during the period from the end of May to the beginning of September each year, which means that this transformation method can only be carried out during this period each year. In addition, this method involves multiple steps such as artificial pollination, seed collection, seed disinfection and germination, antibiotic screening, and tissue culture of sterile seedlings. The steps are cumbersome and complicated, and the operating technology is relatively high. It is also easy to contaminate the stage from seed to seedling growth, causing experimental failure. Finally, the transformation efficiency of this method of 1.44% is not high. Therefore, this method is difficult to promote and apply. Summary of the Invention

[0004] The present invention provides a method for constructing a stable genetic transformation system for water hyacinth, which is simple to operate, has high transformation efficiency, short transformation time and no seasonal restrictions, thereby realizing gene editing operations on water hyacinth, which is beneficial to analytical biology research on water hyacinth, as well as synthetic biology or related research and applications using it as a bioreactor.

[0005] To achieve the above-mentioned purpose, the technical solutions adopted by the present invention include:

[0006] A method for constructing a stable genetic transformation system of water hyacinth, comprising:

[0007] The recombinant bacteria containing the exogenous gene enter the stem base meristem cells of the water hyacinth, thereby realizing the transformation of the exogenous gene in the stem base meristem cells of the water hyacinth;

[0008] The clones obtained after differentiation and development of the meristem cells at the base of the stem of water hyacinth into which foreign genes have been introduced are transgenic seedlings.

[0009] Optionally, the recombinant bacterial cell containing the exogenous gene is Agrobacterium EHA105, and the plasmid is 35S-RUBY.

[0010] Optionally, the method of allowing the recombinant bacteria containing the exogenous gene to enter the meristem cells at the base of the water hyacinth stem includes: forming an open wound at the base of the stem of the water hyacinth plant, then co-culturing it with a recombinant bacterial solution containing the exogenous gene, and simultaneously applying high osmotic pressure treatment, so that the recombinant bacteria enter the meristem cells at the base of the water hyacinth stem through the open wound.

[0011] Optionally, the recombinant bacterial solution containing the exogenous gene is an infiltration solution of Agrobacterium containing the exogenous gene; the infiltration solution is 10mM MgCl2, 10uM MES, 100uM AS; in the infiltration solution, the OD600 of the Agrobacterium containing the exogenous gene is 1.0.

[0012] Optionally, the water hyacinth plant is a small plant with 4-6 leaves; forming an open wound at the base of the stem includes: cutting off the oldest 1-2 leaves near the base of the leaves with a sterilized scalpel, and gently scratching the area between all two leaves.

[0013] Optional, including:

[0014] Immerse the plant material in the bacterial solution and complete pressure infiltration at 0.08 MPa for 5 seconds in the dark.

[0015] The treated plant materials were cultured in Hoagland's nutrient solution at 28°C in the dark for 2 days and then cultured in the light until clones grew.

[0016] Alternatively, the method of allowing the recombinant bacteria containing the exogenous gene to enter the stem base meristem cells of the water hyacinth includes: injecting the cultured recombinant bacteria containing the exogenous gene into the stem base meristem of the water hyacinth plant, where the clones grown after differentiation and development of the cells are the transgenic seedlings.

[0017] Optionally, the recombinant bacterial solution containing the exogenous gene is an infiltration solution of Agrobacterium containing the exogenous gene; the infiltration solution is 10mM MgCl2, 10uM MES, 100uM AS; in the infiltration solution, the OD600 of the Agrobacterium containing the exogenous gene is 1.0.

[0018] Optionally, the water hyacinth plant is a small plant with 4-6 leaves; axillary buds between all leaves are removed with a sterilized scalpel; the recombinant bacterial solution containing exogenous genes is Agrobacterium infiltration solution containing exogenous genes, and the Agrobacterium infiltration solution containing exogenous genes is drawn up with a syringe and injected into the center of the angle between the two leaves of the plant and the axillary bud incision.

[0019] Optionally, after the cultured recombinant bacterial solution containing the exogenous gene is injected into the stem base meristem of the water hyacinth plant, a high osmotic pressure treatment is also performed, and the osmotic fluid is 10mM MgCl2, 10uM MES, 100uM AS; in the osmotic fluid, the OD600 of the Agrobacterium containing the exogenous gene is 1.0; the plant material is immersed in the osmotic fluid, and pressure osmosis is completed under the conditions of 0.08MPa, 5s, and maintained in the dark; the treated plant material is cultured in Hoagland's nutrient solution at 28°C in the dark for 2 days; and then cultured under light until clones grow.

[0020] The advantages of the present invention are:

[0021] The method for constructing a stable genetic transformation system for water hyacinth provided by the present invention is not restricted by season and can be carried out at any time of the year under greenhouse culture conditions. The technology is implemented in a very short time, with the fastest time from the transformation operation to obtaining first-generation transgenic seedlings being 2-3 weeks. The transformation efficiency is high, exceeding 10%. The operation is simple, involving steps including bacterial liquid preparation, co-cultivation of the bacterial liquid with plants or direct injection, conventional plant cultivation, morphological identification, and PCR verification. There are no steps that are prone to contamination and may lead to experimental failure, which greatly reduces the risk of experimental failure and is relatively low in cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the following detailed description, they are used to explain the present invention but do not constitute a limitation of the present invention. In the accompanying drawings:

[0023] Figure 1 This is the morphology of water hyacinth plants transformed using method 1 of the method for constructing a stable genetic transformation system for water hyacinth in Example 1. A is an untransformed water hyacinth plant. The red arrow indicates the newly formed roots of the untransformed small clone, which are off-white in color. B is a water hyacinth plant transformed using method 1 and containing the Ruby gene. The red arrow indicates the primary clone, i.e., the T1 generation transgenic plant. Its newly formed roots are red, indicating the accumulation of betalains expressed by the Ruby gene.

[0024] Figure 2The method for constructing a stable genetic transformation system for water hyacinth in Example 1 is shown in Figure 1. A gel run of the PCR product of the Ruby gene of the primary clone of water hyacinth transformed by method 1; A and B are respectively gel runs of the PCR product detection of the T1 generation water hyacinth roots and leaves transformed by method 1; in Figure A, M: DL2000, the bands from top to bottom are: 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp; 1: positive control, PCR product with Ruby plasmid as DNA template; 2-16: T1 generation water hyacinth plants transformed with Ruby gene (sequentially 1-GM1-1-1, 1-GM1-1 -2, 1-GM1-1-3, 1-GM1-1-4, 1-GM1-2-1, 1-GM1-2-2, 1-GM1-2-3, 1-GM1-2-4, 1-GM1-3-1, 1-GM1-4-1, 1-GM1-4-2, 1-GM1-5-1, 1-GM1-5-2) as a template; 17: negative control, PCR product using ddH2O as a template; 18: negative control, PCR product using DNA from leaves of untransformed common water hyacinth as a template; 19: negative control, PCR product using DNA from untransformed common water hyacinth as a template. In Figure B, M: DL2000; 1: positive control, PCR product using Ruby plasmid as DNA template; 2-16: PCR products using leaf DNA of T1 generation water hyacinth plants transformed with Ruby gene (1-GM1-1-1, 1-GM1-1-2, 1-GM1-1-3, 1-GM1-1-4, 1-GM1-2-1, 1-GM1-2-2, 1-GM1-2-3, 1-GM1-2-4, 1-GM1-3-1, 1-GM1-4-1, 1-GM1-4-2, 1-GM1-5-1, 1-GM1-5-2) as template; 17: negative control, PCR product using ddH2O as template; 18: negative control, PCR product using leaf DNA of untransformed common water hyacinth as template; 19: negative control, PCR product using root DNA of untransformed common water hyacinth as template;

[0025] Figure 3 The morphology of water hyacinth plants transformed by method 2 of the method for constructing a stable genetic transformation system for water hyacinth in Example 2 is shown; A is an untransformed water hyacinth plant, and the red arrow indicates the newly formed roots of the untransformed small clone, which are off-white in color; B is a water hyacinth plant transformed by method 2, and the red arrow indicates the roots of the primary clone, which do not show obvious red color;

[0026] Figure 4This is a method for constructing a stable genetic transformation system for water hyacinth in Example 2. Method 2 shows a gel run of the PCR product of the Ruby gene of the primary clone of water hyacinth transformed; in the figure, M: DL2000, and the bands from top to bottom are: 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp; 1: negative control, PCR product with ddH2O replacing the template DNA; 2: positive control, PCR product with the Ruby plasmid as the template; 3 and 4: negative controls, PCR products with DNA from untransformed common water hyacinth leaves and roots as templates, respectively; 5-20: positive controls with R The PCR products were prepared using DNA from T1 generation water hyacinth plant tissue samples (1-GM3-1-1 root, 1-GM3-1-1 leaf, 1-GM3-1-2 root, 1-GM3-1-3 root, 1-GM3-2-1 root, 1-GM3-2-2 root, 1-GM3-2-3 root, 1-GM3-1-2 leaf, 1-GM3-1-3 leaf, 1-GM3-2-1 leaf, 1-GM3-2-2 leaf, 1-GM3-2-3 leaf, 1-GM3-3-1 root, 1-GM3-3-2 root, 1-GM3-3-1 leaf, and 1-GM3-3-2 leaf) expressing the uby gene as templates.

[0027] Figure 5 The morphology of water hyacinth plants transformed by method 3 of the method for constructing a stable genetic transformation system for water hyacinth in Example 3 is shown; A is an untransformed water hyacinth plant, and the red arrow indicates the newly formed roots of the untransformed small clone, which are off-white in color; B is a water hyacinth plant containing the Ruby gene after transformation by method 1, and the red arrow indicates the primary clone, i.e., the T1 generation transgenic plant, whose newly formed roots are red, indicating the accumulation of betalain expressed by the Ruby gene;

[0028] Figure 6The method for constructing a stable genetic transformation system for water hyacinth in Example 3 is shown in the following figure: a gel run of the PCR product of the Ruby gene of the first-level clone of water hyacinth transformed by method 3; specifically, a gel run of the PCR product detection of the T1 generation water hyacinth roots and leaves transformed by method 2; in the figure, M: DL2000; the bands from top to bottom are: 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp; 1: negative control, PCR product with DNA of untransformed common water hyacinth leaves as template; 2: negative control, PCR product with DNA of untransformed common water hyacinth roots as template; 3: positive control, PCR product with Ruby plasmid as template; 4-13: T1 generation water hyacinth plants transformed with Ruby gene (sequentially 2-GM3-1-1, 14-23: PCR products using root DNA of T1 generation transgenic water hyacinth plants of Ruby gene (in order: 2-GM3-1-1, 2-GM3-1-2, 2-GM3-1-3, 2-GM3-2-1, 2-GM3-2-2, 2-GM3-3-1, 2-GM3-4-1, 2-GM3-4-2, 2-GM3-4-3, 2-GM3-5-1) as template; 24: negative control, PCR product using ddH2O as template;

[0029] Figure 7 qRT-PCR detection of the expression level of the Ruby gene in the transformed clones. This is a gel run of the Ruby gene PCR product of the first-level clone of water hyacinth transformed by method 2 in the method for constructing a stable genetic transformation system for water hyacinth in Example 3; the Ctrl is a water hyacinth clone whose roots are turning red after transformation; 1-GM1-1-1 and 2-GM3-4-2 are clones grown after transformation by methods 1 and 3, respectively. Their roots turned red in the early growth stage, and PCR detection of roots and leaves were positive; 1-GM1-1-2 and 2-GM3-1-2 are clones grown after transformation by methods 1 and 3, respectively. Their roots never turned red during the growth period, but PCR detection of roots and leaves were positive; the Ruby gene expression levels of all samples were calculated based on the Ruby gene expression level in the roots of the Ctrl, among which the expression level of the Ruby gene was not detected in the leaf sample of 1-GM1-1-2 under the existing experimental conditions. DETAILED DESCRIPTION

[0030] In conjunction with the above drawings, the technical solution of the present invention is described:

[0031] The methods of the present invention include: 1) Method 1: Artificially create a wound at the stem base of a water hyacinth plantlet, then co-cultivate it with a plasmid-containing Agrobacterium solution and simultaneously apply hyperosmotic pressure treatment. The Agrobacterium enters the meristematic cells of the stem base of the water hyacinth through the artificial wound, thereby completing the transformation of the exogenous gene in the meristematic cells. The stem base meristem develops and differentiates to grow into a new clone, which is the transgenic seedling. 2) Method 2: Directly inject the cultured Agrobacterium solution into the stem base meristem of the water hyacinth plantlet. The clone that grows after the cells differentiate and develop here is the transgenic seedling. Method three is based on method two, and also adds a high osmotic pressure treatment process. The main function of the high osmotic pressure treatment in the present invention is to help the recombinant bacterial bodies that enter the intercellular spaces of the water hyacinth stem meristem or attach to the surface of the water hyacinth stem meristem cells to quickly enter the meristem cells. Therefore, in theory, as long as a wound is artificially created at the stem base in method one, and then it is co-cultured with Agrobacterium liquid containing a plasmid or the cultured Agrobacterium liquid is directly injected into the stem base meristem of the water hyacinth plant in method two, stable transgenic plants can be cultivated. Adding the high osmotic pressure treatment process increases the speed and probability of the recombinant bacterial bodies entering the water hyacinth stem meristem cells.

[0032] The method for constructing a stable genetic transformation system of water hyacinth comprises the following steps: allowing a recombinant bacterial body containing an exogenous gene to enter the stem base meristem cells of the water hyacinth to achieve transformation of the exogenous gene in the stem base meristem cells of the water hyacinth; and obtaining transgenic seedlings after the stem base meristem cells of the water hyacinth into which the exogenous gene has been introduced undergo differentiation and development.

[0033] In the present invention, the recombinant bacterial cell containing the exogenous gene is Agrobacterium EHA105, and the plasmid is 35S-RUBY.

[0034] In the present invention, allowing the recombinant bacteria containing exogenous genes to enter the meristem cells at the base of the water hyacinth stem includes: forming an open wound at the base of the stem of the water hyacinth plant, then co-culturing it with the recombinant bacteria solution containing the exogenous gene, and applying high osmotic pressure treatment at the same time, so that the recombinant bacteria enter the meristem cells at the base of the water hyacinth stem through the open wound.

[0035] In the present invention, the recombinant bacterial solution containing the exogenous gene is the infiltration solution of Agrobacterium containing the exogenous gene; the infiltration solution is 10mM MgCl2, 10uM MES, 100uM AS; in the infiltration solution, the OD600 of the Agrobacterium containing the exogenous gene is 1.0.

[0036] In the present invention, the water hyacinth plant is a small plant with 4-6 leaves; forming an open wound at the base of the stem includes: cutting off the oldest 1-2 leaves near the base of the leaves with a sterilized scalpel, and gently scratching the area between all two leaves.

[0037] The present invention specifically includes: immersing the plant material in the bacterial solution, completing pressure infiltration at 0.08 MPa for 5 seconds, and maintaining dark conditions; culturing the treated plant material in Hoagland nutrient solution at 28°C for 2 days; and then culturing under light until clones grow.

[0038] In the present invention, the method of allowing the recombinant bacteria containing exogenous genes to enter the stem base meristem cells of water hyacinth includes: injecting the cultured recombinant bacteria containing exogenous genes into the stem base meristem of the water hyacinth plant until droplets seep out. The clones that grow after the cells here differentiate and develop are the transgenic seedlings.

[0039] In the present invention, the water hyacinth plant is a small plant with 4-6 leaves; axillary buds between all leaves are removed with a sterilized scalpel; the recombinant bacterial solution containing the exogenous gene is an Agrobacterium infiltration solution containing the exogenous gene, and the Agrobacterium infiltration solution containing the exogenous gene is drawn up with a syringe and injected into the center position of the angle between the two leaves of the plant and the axillary bud incision.

[0040] In the present invention, after the cultured recombinant bacterial liquid containing the exogenous gene is injected into the stem base meristem of the water hyacinth plant, a high osmotic pressure treatment is performed, and the osmotic fluid contains 10mM MgCl2, 10uM MES, and 100uM AS; in the osmotic fluid, the OD600 of the Agrobacterium containing the exogenous gene is equal to 1.0; the plant material is immersed in the osmotic fluid, and pressure osmosis is completed under the conditions of 0.08MPa and 5s, and the dark condition is maintained; the treated plant material is cultured in Hoagland nutrient solution at 28°C in the dark for 2 days; and then light culture is performed until clones grow.

[0041] Method 1 (co-culture infection method):

[0042] 1) D0: Agrobacterium containing the exogenous gene was streaked onto a fresh YEB plate (100 mg / L Spectinomycin (Spec), 50 mg / L Rifampicin (Rif)) and cultured in an inverted manner at 28°C for 2 days.

[0043] 2) D2: In a laminar flow hood, use an inoculating loop to take a small amount of Agrobacterium from the plate inoculated on D0, disperse it in 5-10 ml of YEB liquid medium (100 mg / L Spec and 50 mg / L Rif), and incubate at 28°C, 180 rpm, and shake for 16-24 h.

[0044] 3) D3: Use a pipette to pipette 300 μL of the bacterial solution from D2 onto a new YEB plate (100 mg / mL Spec, 100 μM AS, 50 mg / L Rif), incubate upside down at 28°C for 24 h, and simultaneously pipette 400-1000 μL of the bacterial solution from D2 into 400 mL of YEB liquid medium (Spec 100 mg / L, 100 μM acetosyringone (AS), 50 mg / L Rif) and incubate on a shaker at 28°C at 180 rpm for 24 h.

[0045] 4) D4: Prepare plant materials and bacterial solution for transformation. The specific steps are as follows:

[0046] A. Select a well-grown plantlet with 4-6 leaves. Bring it to the laboratory, rinse the plant surface with tap water, and set aside.

[0047] B. Prepare infiltration buffer (10 mM MgCl2.6H2O, 10 μM MES, 100 μM AS) and set aside. Then, determine the concentration of the overnight Agrobacterium culture from step 3). When the OD600 is between 0.8 and 1.2, centrifuge at 4000 g for 10 minutes at 4°C. Discard the supernatant (a small amount of residual supernatant can be removed with a pipette). Gently resuspend the cells in 400 mL of infiltration buffer to an OD600 of 1.0.

[0048] C. Place the plantlet from step 1) in a laminar flow hood. Spray the surface evenly with 75% alcohol and gently wipe it clean with a sterile paper towel. Use a sterile scalpel to cut off the oldest 1-2 leaves near the base of the leaves, and gently incise the area between each leaf.

[0049] D. Co-cultivate the plant treated in step 3) with the bacterial suspension prepared in step 2) as follows:

[0050] Place the plant material in a box filled with bacterial solution (ensure all wounds are submerged). Then, place the box in a vacuum chamber, secure the lid, and perform pressure infiltration at 0.08 MPa for 5 seconds. Maintain darkness during the vacuuming process. Once the pressure automatically drops to 0, remove the box and wipe dry any liquid from the plant surface with sterile paper in a laminar flow hood. After vacuum infiltration, use a scalpel to apply an appropriate amount of bacterial moss from the plate in step 3) to each wound.

[0051] 5) Within 1-2 weeks after D4: Place the plants treated in step 4 in a box filled with Hoagland's nutrient solution, then place the box in a wet cardboard box and culture in the dark at 28°C for 2 days. Then remove the cardboard box and culture under normal light conditions (pay attention to the condition of the plants during these days, change the nutrient solution frequently, and pinch off clones that grew in the previous week) until clones grow.

[0052] Note: The culture medium, reagents, paper towels, scalpels, etc. involved in the method should be prepared and sterilized in advance.

[0053] Note: This method requires aseptic operation in the early steps.

[0054] Method 2 (injection infection method):

[0055] 1) D0: Streak inoculate Agrobacterium on a new YEB plate (100 mg / L Spec, 50 mg / L Rif) and culture inverted at 28°C for 2 days.

[0056] 2) D2: In a clean bench, use an inoculating loop to take a small amount of Agrobacterium from the plate inoculated on D0, disperse it in 5-10 mL of YEB liquid medium (100 mg / L Spec, 50 mg / L Rif), and incubate at 28°C with a shaker at 180 rpm for 16-24 h.

[0057] 3) D3: Pipette 300 μL of the bacterial solution from D2 onto a fresh YEB plate (100 mg / ml Spec, 100 μM / L AS, 50 mg / L Rif) and incubate upside down at 28°C for 24 h. Simultaneously, pipette 50 μL of the bacterial solution from D2 into 100 mL of YEB liquid medium (100 mg / L Spec, 100 μM / L AS, 50 mg / L Rif) and incubate at 28°C at 180 rpm for 24 h.

[0058] 4) D4 Prepare the plant material and bacterial solution. The specific steps are as follows:

[0059] 1) Select a well-grown plantlet with 4-6 leaves, bring it to the laboratory, rinse it with tap water to remove any green algae, and set it aside for later use.

[0060] 2) Prepare injection medium (10 mM MgCl2.6H2O, 11 mM MES, 200 μM AS); then, determine the bacterial concentration of D3. When the OD600 reaches 0.2-0.4, centrifuge at 4000 g for 10 min at 4°C. Discard the supernatant (a small amount of residual supernatant can be removed with a pipette). Gently resuspend the cells in 10 mL of Injection Medium to an OD600 of 0.2. Set aside.

[0061] 3) Place the plantlet from step 1) in a laminar flow hood, spray the surface evenly with 75% alcohol, and gently wipe it clean with a sterile paper towel. Use a sterile scalpel to remove all axillary buds between leaves.

[0062] 4) Using a syringe, draw the suspension prepared in step 2) and inject the suspension into the center of the angle between two leaves and the axillary bud incision of all prepared plants;

[0063] 5) Within 1-2 weeks after D4: Place the plants treated in step 5) in a box containing Hoagland's nutrient solution. Place the box in a damp cardboard box and incubate in the dark at 28°C for 2 days. Then remove the cardboard box and incubate in normal light conditions (observe the condition of the plants carefully during these days, change the nutrient solution frequently, and pinch off any clones that have grown in the previous week) until clones emerge.

[0064] Note: The culture medium, reagents, paper towels, scalpels, etc. involved in the method should be prepared and sterilized in advance.

[0065] Note: This method requires attention to aseptic operation.

[0066] Method 3 (injection penetration infection method):

[0067] 1) D0: Streak inoculate Agrobacterium on a new YEB plate (100 mg / L Spec, 50 mg / L Rif) and culture inverted at 28°C for 2 days.

[0068] 2) D2: In a clean bench, use an inoculating loop to take a small amount of Agrobacterium from the plate inoculated on D0, disperse it in 5-10 mL of YEB liquid medium (100 mg / L Spec, 50 mg / L Rif), and incubate at 28°C with a shaker at 180 rpm for 16-24 h.

[0069] 3) D3: Pipette 300 μL of the bacterial solution from D2 onto a fresh YEB plate (100 mg / ml Spec, 100 μM / L AS, 50 mg / L Rif) and incubate upside down at 28°C for 24 h. Simultaneously, pipette 50 μL of the bacterial solution from D2 into 100 mL of YEB liquid medium (100 mg / L Spec, 100 μM / L AS, 50 mg / L Rif) and incubate at 28°C at 180 rpm for 24 h.

[0070] 4) D4 Prepare the plant material and bacterial solution. The specific steps are as follows:

[0071] 1) Select a well-grown plantlet with 4-6 leaves, bring it to the laboratory, rinse it with tap water to remove any green algae, and set it aside for later use.

[0072] 2) Prepare injection medium (10 mM MgCl2.6H2O, 11 mM MES, 200 μM AS); then, determine the bacterial concentration of D3. When the OD600 reaches 0.2-0.4, centrifuge at 4000 g for 10 min at 4°C. Discard the supernatant (a small amount of residual supernatant can be removed with a pipette). Gently resuspend the cells in 10 mL of Injection Medium to an OD600 of 0.2. Set aside.

[0073] 3) Place the plantlet from step 1) in a clean bench, spray the surface evenly with 75% alcohol, and gently wipe it clean with a sterile paper towel. Use a sterile scalpel to remove all axillary buds between leaves.

[0074] 4) Using a syringe, draw the suspension prepared in step 2) and inject the suspension into the center of the angle between two leaves and the axillary bud incision of all prepared plants;

[0075] 5) Infiltration: Place the plant material treated in step 4) in a box filled with Hoagland's nutrient solution (ensure all wounds are submerged). Then, place the box in a vacuum chamber, secure the lid, and perform pressure infiltration at 0.08 MPa for 5 seconds (maintain darkness during the vacuuming process). Wait until the pressure automatically drops to 0 before removing the plant. Remove the plant and wipe dry with sterilized paper. After vacuuming, use a scalpel to apply an appropriate amount of bacterial moss from the plate in step 3 to each wound.

[0076] 6) Within 1-2 weeks after D4: Place the plants treated in step 5) in a box containing Hoagland's nutrient solution. Place the box in a damp cardboard box and incubate in the dark at 28°C for 2 days. Then remove the cardboard box and incubate in normal light conditions (observe the condition of the plants carefully during these days, change the nutrient solution frequently, and pinch off any clones that have grown in the previous week) until clones emerge.

[0077] Note: The culture medium, reagents, paper towels, scalpels, etc. involved in the method should be prepared and sterilized in advance.

[0078] Note: This method requires attention to aseptic operation.

[0079] By implementing the two methods proposed in the present invention, transgenic water hyacinth seedlings can be obtained within 2 to 3 weeks. PCR verification shows that the transformation efficiency of method one reaches 60%, and the transformation efficiency of method three reaches 30%.

[0080] Example 1: Introduction of Ruby gene into water hyacinth by the above method

[0081] The product of Ruby gene expression is betaine, which appears red in the active expression site of the plant and is easily observed with the naked eye. In this embodiment, the gene was transferred into water hyacinth according to the above method.

[0082] EHA105 and 5 water hyacinth plants were operated according to the above method 1, and after transformation, they were cultured under greenhouse conditions. After 2 weeks, clones gradually grew out of each water hyacinth plant. Before PCR detection, a total of 15 primary clones grew out, numbered as follows: 1-GM1-1-1, 1-GM1-1-2, 1-GM1-1-3, 1-GM1-1-4, 1-GM1-2-1, 1-GM1-2-2, 1-GM1-2-3, 1-GM1-2-4, 1-GM1-3-1, 1-GM1-4-1, 1-GM1-4-2, 1-GM1-5-1 and 1-GM1-5-2. Eleven of these primary clones gradually developed red color (such as red) on the root system and / or swollen stem within 6-10 days of growth. Figure 1 However, these red deposits typically faded after a week, and four strains had not developed red color before PCR testing. To verify whether these 15 primary clones were transgenic plants harboring the Ruby gene, roots and leaves were sampled from each strain. Total DNA from each sample was extracted using the CTAB method. Untransformed leaf and root samples from common water hyacinth served as negative controls, and plasmid DNA was used as a positive control. PCR was then used to test the presence of the Ruby gene in each sample.

[0083] The Ruby primer sequence is: Forward: CACGCCATCATTCTTGAGCG;

[0084] Reverse: GACAGCCGAGACAGAACCAAA, the expected PCR product size is 540 bp.

[0085] The results of gel electrophoresis of PCR products were as follows Figure 2 As shown, the positive control showed a distinct bright band at 750-500 bp, while the negative control showed no bands. Some root and leaf samples of the transformed clones showed bright bands, while others showed no bands. Nine samples showed bright bands in both roots and leaves, indicating a transformation efficiency of 60%.

[0086] Example 2: Introduction of Ruby gene into water hyacinth by the above method

[0087] EHA105 and three water hyacinth plants were transformed according to the above method 2 and cultured in the greenhouse. After 2 weeks, clones grew out of each water hyacinth plant, and a total of 8 primary clones grew out before PCR testing. The roots of these primary clones did not show red color before PCR testing (such as Figure 3To verify whether these primary clones were transgenic plants, roots and leaves of each plant were sampled and total DNA was extracted using the CTAB method. Untransformed leaf and root samples of common water hyacinth served as negative controls, and plasmid DNA was used as a positive control. PCR was then used to detect the presence of the Ruby gene in each sample.

[0088] The results of gel electrophoresis of PCR products were as follows Figure 4 As shown, the positive control had an obvious bright band at 750-500bp, the negative control had no bands, some of the root and leaf samples of the transformed clones had bright bands, and some had no bands, but there were no samples with bright bands in both roots and leaves, indicating that the clones that tested positive in roots or leaves were all chimeras, that is, no stable genetically transformed clones were obtained.

[0089] Example 3: Three-way transfer of Ruby gene into water hyacinth using the above method

[0090] EHA105 and five water hyacinth plants were treated according to the above three methods and cultured in greenhouse conditions after transformation. After 2 weeks, clones grew out of each water hyacinth plant, and a total of 10 primary clones grew out before PCR testing. Two of these primary clones gradually developed red spots on the roots and / or swollen stems within 6-10 days of growth (such as Figure 5 ), 8 strains did not show red color before PCR testing. To verify whether these primary clones were transgenic plants, roots and leaves of each strain were sampled and total DNA was extracted from each sample using the CTAB method. Untransformed leaves and roots of common water hyacinth were used as negative controls, and plasmid DNA was used as a positive control. PCR was then performed to detect the presence of the Ruby gene in each sample. The results of gel electrophoresis of the PCR products are shown in Figure 2. Figure 6 As shown, the positive control showed a clear bright band at 750-500 bp, while the negative control showed no bands. Some of the root and leaf samples of the transformed clones showed bright bands, while others did not. There were 3 samples with bright bands in both roots and leaves, indicating a transformation rate of 30%.

[0091] Because some of the primary clones of water hyacinth transformed with the Ruby gene in Examples 1 and 3 above did not show red in their roots in the early growth stage, but were found to be positive in PCR detection of their roots and leaves, we selected four transformed clones, namely 1-GM1-1-1 and 2-GM3-4-2, whose roots showed red in the early growth stage and were positive in PCR detection of roots and leaves, and 1-GM1-1-2 and 2-GM3-1-2, whose roots never showed red but were positive in PCR detection of roots and leaves. We took their roots and leaves respectively, and used a transformed clone with red roots as a control. After RNA was extracted, it was reverse transcribed into cDNA, and then the expression level of the Ruby gene in each sample was detected by real-time fluorescence quantitative PCR to test whether the expression level of the Ruby gene in water hyacinth was positively correlated with the red betaine produced by the roots.

[0092] The results are as follows Figure 7 As shown, except for the 1-GM1-1-2 leaf sample, where no expression of the Ruby gene was detected, the Ruby gene was expressed at varying levels in all other samples, and the expression level was not positively correlated with the presence of red deposits. This suggests that the accumulation of betaine, the final product of the Ruby gene, in water hyacinth is regulated by other factors, and its mRNA level is not directly proportional to the final betaine content. Under the current system, using the expression of this gene as a preliminary screening criterion for successful transformation in water hyacinth may result in false negatives, meaning that transformed clones that were actually successfully transformed but did not develop red color may be missed in the statistics. Future improvements may be made to address this issue and improve screening accuracy.

[0093] The above are only specific embodiments of the present invention, but the present invention is not limited to the above embodiments. Without departing from the design concept and principle of the present invention, various modifications, improvements and changes of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for constructing a stable genetic transformation system of water hyacinth, characterized in that: include: The recombinant bacteria containing the exogenous gene enter the stem base meristem cells of the water hyacinth, thereby realizing the transformation of the exogenous gene in the stem base meristem cells of the water hyacinth; Transgenic seedlings are obtained after differentiation and development of the meristem cells at the base of the water hyacinth stem into which foreign genes are introduced.

2. The method for constructing a stable genetic transformation system of water hyacinth according to claim 1, wherein The recombinant bacterial cell containing the exogenous gene is Agrobacterium EHA105, and the plasmid is 35S-RUBY.

3. The method for constructing a stable genetic transformation system of water hyacinth according to claim 1 or 2, characterized in that: The method of allowing the recombinant bacterial body containing the exogenous gene to enter the meristem cells at the base of the water hyacinth stem comprises: An open wound is formed at the base of the stem of the water hyacinth plant, which is then co-cultured with a recombinant bacterial solution containing exogenous genes and subjected to high osmotic pressure treatment. The recombinant bacteria enter the meristem cells at the base of the water hyacinth stem through the open wound.

4. The method for constructing a stable genetic transformation system of water hyacinth according to claim 3, characterized in that: The recombinant bacterial solution containing the exogenous gene is an Agrobacterium infiltration solution containing the exogenous gene; The permeabilization solution was 10 mM MgCl2, 10 uM MES, and 100 uM AS; In the infiltration solution, the OD600 of Agrobacterium containing the exogenous gene is 1.

0.

5. The method for constructing a stable genetic transformation system of water hyacinth according to claim 3, characterized in that: The water hyacinth plant is a small plant with 4-6 leaves; Creating an open wound at the stem base involves cutting off the oldest 1-2 leaves near the base of the leaves with a sterile scalpel and gently scoring the wound between all two leaves.

6. The method for constructing a stable genetic transformation system of water hyacinth according to claim 3, characterized in that: Specifically include: Immerse the plant material in the bacterial solution and complete pressure infiltration at 0.08 MPa for 5 seconds in the dark. The treated plant materials were cultured in Hoagland's nutrient solution at 28°C in the dark for 2 days and then cultured in the light until clones grew.

7. The method for constructing a stable genetic transformation system of water hyacinth according to claim 1 or 2, characterized in that: The method of allowing the recombinant bacterial body containing the exogenous gene to enter the meristem cells at the base of the water hyacinth stem comprises: The cultured recombinant bacterial liquid containing exogenous genes is injected into the meristem at the base of the stem of the water hyacinth plant. The clones that grow after the cells here differentiate and develop are the transgenic seedlings.

8. The method for constructing a stable genetic transformation system of water hyacinth according to claim 7, characterized in that: The recombinant bacterial solution containing the exogenous gene is an Agrobacterium infiltration solution containing the exogenous gene; The permeabilization solution was 10 mM MgCl2, 10 uM MES, and 100 uM AS; In the infiltration solution, the OD600 of Agrobacterium containing the exogenous gene is 1.

0.

9. The method for constructing a stable genetic transformation system of water hyacinth according to claim 7, characterized in that: The water hyacinth plant is a small plant with 4-6 leaves; axillary buds between all leaves are removed with a sterilized scalpel; The recombinant bacterial solution containing the exogenous gene is Agrobacterium tumefaciens osmotic fluid containing the exogenous gene. The syringe draws the Agrobacterium tumefaciens osmotic fluid containing the exogenous gene and injects it into the center of the angle between the two leaves of the plant and the axillary bud incision.

10. The method for constructing a stable genetic transformation system of water hyacinth according to claim 7, characterized in that: After the cultured recombinant bacteria containing the exogenous gene were injected into the stem base meristem of the water hyacinth plant, a high osmotic pressure treatment was performed. The osmotic fluid contained 10mM MgCl2, 10uM MES, and 100uM AS. In the osmotic fluid, the OD600 of the Agrobacterium containing the exogenous gene was 1.

0. The plant material was immersed in the infiltration solution and pressure infiltration was completed at 0.08 MPa for 5 s in a dark environment. The treated plant materials were cultured in Hoagland's nutrient solution at 28°C in the dark for 2 days and then cultured in the light until clones grew.

Citation Information

Patent Citations

  • Genetic transformation method of Eichhornia crassipes

    CN102399812A