Vector for gradient reduction of expression of protein in plant based on uAUG-ds combined with sGP183, construction method and application
By constructing a vector of uAUG-ds combined with sGP183, using pCAMBIA1300 as the skeleton, a specific PCR band was inserted, which achieved a gradient reduction in the expression of target proteins in plants, solving the interference of highly expressed proteins on plant growth and development, and providing assistance for precise regulation and functional analysis.
Patent Information
- Application Number
- CN202510722706.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-30
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2045-05-30
AI Technical Summary
The prior art is difficult to accurately regulate the expression of transgenic proteins without affecting plant growth and yield, especially the interference of highly expressed proteins on plant growth and development.
A vector based on uAUG-ds combined with PepMV subgene promoter sGP183 was constructed. By connecting different types of uAUG-ds and sGP183, a gradient was formed to reduce protein expression. pCAMBIA1300 was used as the vector backbone and a specific PCR band was inserted to achieve precise regulation of the target protein.
The gradient reduces the expression of the target protein under the condition of unchanging promoter, solves the interference of highly expressed proteins on plant growth and development, and provides a help in studying functional analysis of different expression quantities.
Smart Images

Figure CN120505358A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering technology, and in particular to a vector, construction method and application for gradient-reducing protein expression in plants by utilizing a translation inhibitory element uAUG-ds in combination with a subgene promoter sGP183 of Pepino mosaic virus (PepMV). Background Art
[0002] Pepino mosaic virus (PepMV) is a positive-sense, single-stranded RNA virus with a genome length of approximately 6.4 kb, belonging to the genus Potyvirus. Its genomic RNA encodes the RNA-dependent RNA polymerase (RdRP), which plays a key role in viral replication and transcription. Subgenomic sgRNA1 and sgRNA2 encode three gene block proteins (TGB1, TGB2, and TGB3) responsible for viral intercellular movement. Subgenomic sgRNA3, produced by RdRP and produced from the subgenomic promoter sGP183, encodes the coat protein (CP), which encapsidates the viral RNA to form protective viral particles. The virus primarily infects Solanaceae crops such as tomatoes, peppers, and eggplants, particularly damaging tomato production. When PepMV infects tomatoes, leaves exhibit mosaic, mottling, shrunken, or deformed appearance, while fruits develop yellow or chlorotic spots, sunken skin, or a "tiger-skin" pattern.
[0003] The "TBF1 regulatory cassette" regulates pathogen-responsive translation through two upstream open reading frames (uORFs), thereby modulating the expression of the immunity gene NPR1, conferring broad-spectrum disease resistance in Arabidopsis thaliana and rice without compromising growth and yield. Subsequent studies have found that a double-stranded RNA structure (uAUG-ds) upstream of the uAUG start codon of TBF1 mRNA inhibits protein translation, while an immune-induced RNA helicase unwinds uAUG-ds, promoting the translation of defense proteins. Summary of the Invention
[0004] The purpose of the present invention is to provide a vector for expressing a protein in plants based on uAUG-ds combined with sGP183 gradient reduction, as well as a construction method and application.
[0005] The 5' UTR regions of both TUB7 and TBF1 contain uAUG-ds, designated A-uAUG-ds (144 nucleotides) and B-uAUG-ds (105 nucleotides), respectively. Class 1 uAUG-ds is designated C-uAUG-ds (54 nucleotides). Their sequences are shown in SEQ ID NOs: 4-6; the sGP183 sequence of PepMV is shown in SEQ ID NO: 7.
[0006] The vector constructed by the present invention can reduce the accumulation of the target protein by connecting a single uAUG-ds and sGP183 in series without changing the promoter. The series connection of C-uAUG-ds on the basis of uAUG-ds-sGP183 can further reduce the accumulation of the target protein, thereby achieving a gradient reduction in the expression of the target protein in plants. This provides support for the functional analysis of different expression levels of the target gene in plants. In response to the transgenic problem caused by high-expression protein interfering with plant growth and development, the present invention can accurately regulate the expression level of the target protein, thereby effectively solving this problem.
[0007] Specifically, the technical solutions adopted by the present invention are as follows:
[0008] The vector for expressing protein in plants based on the gradient reduction of uAUG-ds combined with sGP183 uses pCAMBIA1300 as the vector backbone, and utilizes the translation inhibition element uAUG-ds combined with the subgene promoter sGP183 of PepMV to construct a single uAUG-ds combined with sGP183 vector and / or a double uAUG-ds combined with sGP183 vector.
[0009] (I) Construction of vectors containing single uAUG-ds combined with sGP183
[0010] A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR, and C-uAUG-ds-sGP183-KpnI-3'UTR were artificially synthesized. The 3'UTR is the 3'UTR of PepMV, and the sequences are shown in SEQ ID NOs: 1-3. The sequences of A-uAUG-ds, B-uAUG-ds, and C-uAUG-ds are shown in SEQ ID NOs: 4-6. The sequences of sGP183 and 3'UTR of PepMV are shown in SEQ ID NOs: 7-8.
[0011] Using the synthetic A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR, and C-uAUG-ds-sGP183-KpnI-3'UTR as templates, primers FA / R-BamHI, FB / R-BamHI, and FC / R-BamHI were used to generate a specific PCR band. The PCR target band was then inserted into the pCAMBIA1300 vector linearized with SacI and BamHI to generate pCAMBIA1300-A, B, and C-sGP183 vectors. The sequences of FA / R-BamHI, FB / R-BamHI, and FC / R-BamHI are shown in SEQ ID NOs: 13-16.
[0012] FA: GAGAGAACACGGGGGACGAGCTCATGGTCTCTGCTTCTGACGTC
[0013] FB: GAGAGAACACGGGGGACGAGCTC ATGGAAGAAACCAAACGAAACTC
[0014] FC: GAGAGAACACGGGGGACGAGCTC ATGTGGATGAGGAGTTCGATTG
[0015] R-BamHI:TACGAACGAAAGCTCGGATCC TTTTTTTTTTTTTTTTTAAATTACAAAAG
[0016] The primers for identification were FA / R-pCAM, FB / R-pCAM, and FC / R-pCAM. The correct clone was expanded, the plasmid was extracted, and sequenced using R-pCAM primers. The sequence is shown in SEQ ID NO: 17.
[0017] R-pCAM:CACAGTAAATTACAAGCACAAC.
[0018] GFP was used as a candidate protein to evaluate the effect of the vector:
[0019] (1) Using F-GFP / R-GFP primers, GFP, which emits green fluorescence upon UV irradiation, was constructed into KpnI-linearized pCAMBIA1300-A-uAUG-ds-sGP183, pCAMBIA1300-B-uAUG-ds-sGP183, and pCAMBIA1300-C-uAUG-ds-sGP183, and named pCAMBIA1300-A-sGP183-GFP, pCAMBIA1300-B-sGP183-GFP, and pCAMBIA1300-C-sGP183-GFP. The GFP sequence is shown in SEQ ID NO: 9. The sequences of F-GFP / R-GFP are shown in SEQ ID NOs: 18-19:
[0020] F-GFP: CAGTTTGCTGCTACTTCTGGT ATGGCAAGTAAAGGAGAAGAAC
[0021] R-GFP: CTAATTAAGTTTCGAGTGTTTTATTTGTATAGTTCATCCATGCCA
[0022] The identification primers F-GFP / R-pCAM have sequences shown in SEQ ID NOs: 18 and 17.
[0023] (2) The correct pCAMBIA1300-A-sGP183-GFP, pCAMBIA1300-B-sGP183-GFP, and pCAMBIA1300-C-sGP183-GFP were transformed into Agrobacterium to obtain positive Agrobacterium. Subsequently, the Agrobacterium was inoculated into Nicotiana benthamiana leaves. The day after injection, GFP fluorescence was observed under UV irradiation, and Western blot and qRT-PCR were then performed to detect GFP protein accumulation and GFP mRNA levels. The degree of GFP protein reduction was evaluated based on the fluorescence intensity and accumulation of GFP protein.
[0024] (II) Construction of double uAUG-ds combined with sGP183 vector
[0025] AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR and 2C-uAUG-ds-sGP183-KpnI-3'UTR were artificially synthesized, and their sequences are shown in SEQ ID NOs: 10-12.
[0026] Using the synthetic AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR, and 2C-uAUG-ds-sGP183-KpnI-3'UTR as templates, primers FA / R-BamHI, FB / R-BamHI, and FC / R-BamHI were used to generate a specific PCR band. The PCR target band was then inserted into the pCAMBIA1300 vector linearized with SacI and BamHI to generate the pCAMBIA1300-AC-sGP183, pCAMBIA1300-BC-sGP183, and pCAMBIA1300-2C-sGP183 vectors. The sequences of FA / R-BamHI, FB / R-BamHI, and FC / R-BamHI are shown in SEQ ID NOs: 13-16.
[0027] The primers for identification were FA / R-pCAM, FB / R-pCAM, and FC / R-pCAM. The correct clone was expanded, the plasmid was extracted, and sequenced using R-pCAM primers. The sequence is shown in SEQ ID NO: 17.
[0028] GFP was used as a candidate protein to evaluate the effect of the vector:
[0029] (1) Using F-GFP / R-GFP primers, GFP, which emits green fluorescence upon UV irradiation, was constructed into KpnI-linearized pCAMBIA1300-AC-uAUG-ds-sGP183, pCAMBIA1300-BC-uAUG-ds-sGP183, and pCAMBIA1300-2C-uAUG-ds-sGP183, and named pCAMBIA1300-AC-sGP183-GFP, pCAMBIA1300-BC-sGP183-GFP, and pCAMBIA1300-2C-sGP183-GFP. The GFP sequence is shown in SEQ ID NO: 9. The sequences of F-GFP / R-GFP are shown in SEQ ID NOs: 18-19:
[0030] The identification primers F-GFP / R-pCAM have sequences shown in SEQ ID NOs: 18 and 17.
[0031] (2) The correct pCAMBIA1300-AC, BC, and 2C-sGP183-GFP were transformed into Agrobacterium to obtain positive Agrobacterium. Subsequently, the Agrobacterium was inoculated into Nicotiana benthamiana leaves. The day after injection, GFP fluorescence was observed under UV irradiation, and Western blot and qRT-PCR were performed to detect GFP protein accumulation and GFP mRNA levels. The degree of GFP protein reduction was evaluated based on GFP protein fluorescence intensity and GFP protein accumulation.
[0032] Compared with the prior art, the outstanding effects of the present invention are:
[0033] (1) After a large number of experimental explorations, the present invention found that connecting different types of uAUG-ds and sGP183 in series can gradually reduce the expression level of the target protein in plants, thereby controlling it at an appropriate expression level according to the characteristics of the target protein and promoting the functional research of the target protein.
[0034] (2) The present invention facilitates functional analysis of target proteins at varying expression levels in plants. This invention addresses the transgenic challenge of high-expression proteins interfering with plant growth and development by precisely regulating the expression level of target proteins, effectively resolving this issue.
[0035] The vector, construction method and application of the present invention for expressing the protein in plants based on the gradient reduction of uAUG-ds combined with sGP183 are further described below in conjunction with the accompanying drawings and specific examples. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1-Figure 3 This is the vector map of single uAUG-ds combined with sGP183. Figure 1 This is the vector map of A-uAUG-ds-sGP183. KpnI is used to insert the target gene. Figure 2 This is the vector map of B-uAUG-ds-sGP183. Figure 3 This is the vector map of C-uAUG-ds-sGP183.
[0037] Figure 4 Single uAUG-ds combined with sGP183 reduced the accumulation of GFP protein.
[0038] (A) Schematic diagram of the tandem structure of a single uAUG-ds, sGP183, and GFP. GFP expression is controlled by the 35S promoter. The 5'UTR regions of TUB7 and TBF1 contain uAUG-ds, designated A-uAUG-ds (144 nt) and B-uAUG-ds (105 nt), respectively. The Class 1 uAUG-ds, containing 54 nt, was designated C-uAUG-ds. The blue line represents the 3'UTR sequence of sGP183 and PepMV, where sGP183 is the subgenomic promoter of the PepMV CP. The pink box indicates the first 36 nucleotides (nt) at the N-terminus of the CP protein.
[0039] (B) The effect of single uAUG-ds combined with sGP183 on GFP accumulation was shown by GFP fluorescence intensity. Agrobacterium carrying GFP, sGP183-GFP or uAUG-ds-sGP183-GFP vectors (OD 600 =0.5) were infiltrated into Nicotiana benthamiana leaves. Two days after inoculation, the infiltrated leaves were photographed under UV light with a yellow filter. The pCAMBIA1300 empty vector (EV) served as a negative control.
[0040] (C) Western blot analysis of the effect of single uAUG-ds combined with sGP183 on GFP accumulation. GFP protein was detected using an anti-GFP antibody, with actin as an internal control. This experiment was repeated three times, and representative results are shown. GFP protein accumulation, shown in the left image, was quantified using IMAGEJ software and expressed as the mean ± standard error of the mean (SEM, n = 3). Significant differences were determined by Duncan's multiple range test (P < 0.05, using IBM SPSS STATISTICS software).
[0041] (D) qRT-PCR analysis of the effect of single uAUG-ds combined with sGP183 on GFP mRNA levels. Error bars represent mean ± standard deviation (SD) (n = 3 biological replicates).
[0042] Figure 5-Figure 7 This is the vector map of double uAUG-ds combined with sGP183. Figure 5 This is the vector map of AC-uAUG-ds-sGP183. KpnI is used to insert the target gene. Figure 6 This is the vector map of BC-uAUG-ds-sGP183. Figure 7 This is the vector map of 2C-uAUG-ds-sGP183.
[0043] Figure 8 Double uAUG-ds combined with sGP183 reduced the accumulation of GFP protein.
[0044] (A) Schematic diagram of the tandem structure of double uAUG-ds, sGP183, and GFP. A-, B-, and C-uAUG-ds were tandemly linked to C-uAUG-ds and named AC-, BC-, and 2C-uAUG-ds, respectively.
[0045] (B) Effect of double uAUG-ds combined with sGP183 on GFP accumulation as shown by GFP fluorescence intensity.
[0046] (C) Western blot analysis of the effect of double uAUG-ds combined with SGP183 on GFP accumulation.
[0047] (D) qRT-PCR analysis of the effect of double uAUG-ds combined with sGP183 on GFP mRNA levels. DETAILED DESCRIPTION
[0048] A vector for gradient-reduced protein expression based on the translation repression element uAUG-ds combined with the PepMV subgene promoter sGP183, the construction method of which comprises the following steps:
[0049] (I) Artificially synthesized A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR, and C-uAUG-ds-sGP183-KpnI-3'UTR, with the 3'UTR being the 3'UTR of PepMV. The sequences of A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR, and C-uAUG-ds-sGP183-KpnI-3'UTR are shown in SEQ ID NOs: 1-3. The sequences of A-uAUG-ds, B-uAUG-ds, and C-uAUG-ds are shown in SEQ ID NOs: 4-6. The sequences of sGP183 and 3'UTR of PepMV are shown in SEQ ID NOs: 7-8.
[0050] Using the synthetic A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR, and C-uAUG-ds-sGP183-KpnI-3'UTR as templates, primers FA / R-BamHI, FB / R-BamHI, and FC / R-BamHI were used to generate a specific PCR band. The specific PCR band was purified by agarose gel electrophoresis and gel extraction. The sequences of FA / R-BamHI, FB / R-BamHI, and FC / R-BamHI are shown in SEQ ID NOs: 13-16.
[0051] FA: GAGAGAACACGGGGGACGAGCTCATGGTCTCTGCTTCTGACGTC
[0052] FB: GAGAGAACACGGGGGACGAGCTC ATGGAAGAAACCAAACGAAACTC
[0053] FC: GAGAGAACACGGGGGACGAGCTC ATGTGGATGAGGAGTTCGATTG
[0054] R-BamHI:TACGAACGAAAGCTCGGATCC TTTTTTTTTTTTTTTTTAAATTACAAAAG
[0055] The PCR target band was constructed into the pCAMBIA1300 vector linearized with SacI and BamHI and transformed into DH5α competent E. coli. The primers were identified as FA / R-pCAM, FB / R-pCAM, and FC / R-pCAM. The correct clone was expanded, the plasmid was extracted, and sequenced using the R-pCAM primer. The sequence is shown in SEQ ID NO: 17.
[0056] R-pCAM:CACAGTAAATTACAAGCACAAC
[0057] Thus, the vectors containing pCAMBIA1300-A-sGP183, pCAMBIA1300-B-sGP183 and pCAMBIA1300-C-sGP183 were obtained. Figure 1-3 shown.
[0058] (II) To clarify the effects of A-sGP183, B-sGP183, and C-sGP183 on the accumulation of target proteins, GFP, which emits green fluorescent protein upon UV irradiation, was used as a candidate protein to evaluate the effectiveness of the vector.
[0059] 1. Using TMV-GFP as a template, primers F-GFP / R-GFP were used to amplify the GFP nucleotide sequence to obtain a specific PCR band. The specific PCR target band was purified by agarose gel electrophoresis and gel cutting. The GFP sequence is shown in SEQ ID NO: 9. The sequence of F-GFP / R-GFP is shown in SEQ ID NO: 18-19:
[0060] F-GFP: CAGTTTGCTGCTACTTCTGGT ATGGCAAGTAAAGGAGAAGAAC
[0061] R-GFP: CTAATTAAGTTTCGAGTGTTTTATTTGTATAGTTCATCCATGCCA
[0062] 2. 600 ng of pCAMBIA1300-A, B, and C-sGP183 plasmids, 1 μL of KpnI, and 2 μL of 10× Fast Digest Green Buffer; make up the remaining volume to 20 μL with ddH2O; digest at 37°C for 4 h, then at 80°C for 10 min, and store frozen at -20°C.
[0063] 3. Add 1 μL of the backbone of pCAMBIA1300-A-sGP183, pCAMBIA1300-B-sGP183, and pCAMBIA1300-C-sGP183 plasmids digested with KpnI, 2 μL of the amplified F-GFP / R-GFP fragment, 5 μL of 2× Master Assembly Mix from Sino-US Taihe Co., Ltd., and add ddH2O to 10 μL. Incubate at 50°C for 15 min.
[0064] 4. Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;
[0065] The primers F-GFP / R-pCAM were identified, and their sequences were shown in SEQ ID NOs: 18 and 17. The correct clones were expanded, the plasmids were extracted, and sequenced using R-pCAM primers.
[0066] Thus, the vectors containing pCAMBIA1300-A-sGP183-GFP, pCAMBIA1300-B-sGP183-GFP and pCAMBIA1300-C-sGP183-GFP were obtained. Figure 4 As shown in A.
[0067] (III) The pCAMBIA1300-A-sGP183-GFP, B-sGP183-GFP, and C-sGP183-GFP vectors were transformed into EHA105 competent Agrobacterium, and positive Agrobacterium colonies were identified using primers F-GFP / R-pCAM. The sequences are shown in SEQ ID NOs: 18 and 17. Agrobacterium containing pCAMBIA1300-A, B, and C-sGP183-GFP were inoculated into Nicotiana benthamiana leaves. Two days after the injection, Figure 4 As shown in B, compared with the leaf area expressing GFP, the GFP fluorescence in the sGP183-GFP area was weaker, and both Western blot and qRT-PCR detected weaker GFP protein bands and lower GFP mRNA levels ( Figure 4 BD). This suggests that sGP183 may reduce the accumulation of GFP protein by reducing the level of GFP mRNA. Compared with the sGP183-GFP expression area, the B-sGP183-GFP expression area had almost no fluorescent protein, and only extremely weak GFP protein bands were detected by Western blot. B-uAUG-ds did not affect the GFP mRNA level of sGP183-GFP ( Figure 4 BD). C-uAUG-ds only slightly reduced the accumulation of GFP protein. Although A-uAUG increased the GFP mRNA level, it significantly reduced the GFP fluorescence intensity and protein accumulation ( Figure 4 These results indicate that both uAUG-ds and sGP183 can effectively reduce GFP protein accumulation. The order of influence of different uAUG-ds-sGP183 on GFP protein accumulation is: B-sGP183 > A-sGP183 > C-sGP183.
[0068] (IV) Artificial synthesis of AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR and 2C-uAUG-ds-sGP183-KpnI-3'UTR. The sequences of AC, BC and 2C-uAUG-ds-sGP183-KpnI-3'UTR are shown in SEQ ID NOs: 10-12.
[0069] Using the synthetic AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR, and 2C-uAUG-ds-sGP183-KpnI-3'UTR as templates, primers FA / R-BamHI, FB / R-BamHI, and FC / R-BamHI were used to generate a specific PCR band. The specific PCR band was purified by agarose gel electrophoresis and gel extraction. The sequences of FA / R-BamHI, FB / R-BamHI, and FC / R-BamHI are shown in SEQ ID NOs: 13-16.
[0070] The PCR target band was constructed into the pCAMBIA1300 vector linearized with SacI and BamHI and transformed into DH5α competent E. coli. The primers were identified as FA / R-pCAM, FB / R-pCAM, and FC / R-pCAM. The correct clone was expanded, the plasmid was extracted, and sequenced using the R-pCAM primer. The sequence is shown in SEQ ID NO: 17.
[0071] Thus, vectors containing pCAMBIA1300-AC-sGP183, pCAMBIA1300-BC-sGP183 and pCAMBIA1300-2C-sGP183 were obtained. Figure 5-Figure 7 shown.
[0072] (V) To clarify the effects of AC-sGP183, BC-sGP183, and 2C-sGP183 on the accumulation of target proteins, GFP, which emits green fluorescent protein upon UV irradiation, was used as a candidate protein to evaluate the effectiveness of the vector.
[0073] 1. Using TMV-GFP as a template, primers F-GFP / R-GFP were used to amplify the GFP nucleotide sequence to obtain a specific PCR band. The specific PCR target band was purified by agarose gel electrophoresis and gel cutting. The GFP sequence is shown in SEQ ID NO: 9. The sequence of F-GFP / R-GFP is shown in SEQ ID NO: 18-19:
[0074] 2. 600 ng of pCAMBIA1300-AC, pCAMBIA1300-BC, and pCAMBIA1300-2C-sGP183 plasmids, 1 μL KpnI, and 2 μL 10× Fast Digest Green Buffer; make up the remaining volume to 20 μL with ddH2O; digest at 37°C for 4 h, then at 80°C for 10 min, and store frozen at -20°C.
[0075] 3. Add 1 μL of the backbone of pCAMBIA1300-AC-sGP183, pCAMBIA1300-BC-sGP183, and pCAMBIA1300-2C-sGP183 plasmids digested with KpnI, 2 μL of the amplified F-GFP / R-GFP fragment, 5 μL of 2× Master Assembly Mix (China-US Taihe Co., Ltd.), and ddH2O to 10 μL. Incubate at 50°C for 15 min.
[0076] 4. Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;
[0077] The primers F-GFP / R-pCAM were identified, and their sequences were shown in SEQ ID NOs: 18 and 17. The correct clones were expanded, the plasmids were extracted, and sequenced using R-pCAM primers.
[0078] Thus, the vectors containing pCAMBIA1300-ACsGP183-GFP, pCAMBIA1300-BC-sGP183-GFP and pCAMBIA1300-2C-sGP183-GFP were obtained. Figure 8 As shown in A.
[0079] (VI) The pCAMBIA1300-AC, BC, and 2C-sGP183-GFP vectors were transformed into EHA105 competent Agrobacterium, and positive Agrobacterium colonies were identified using primers F-GFP / R-pCAM. The sequences are shown in SEQ ID NOs: 18 and 17. Agrobacterium containing pCAMBIA1300-AC, BC, and 2C-sGP183-GFP was inoculated into Nicotiana benthamiana leaves. Two days after the injection, Figure 8 As shown in B, compared with single uAUG-ds, double uAUG-ds further reduced GFP fluorescence intensity and GFP protein accumulation ( Figure 8 BC), BC-sGP183-GFP showed the weakest protein band. qRT-PCR analysis showed that compared with sGP183-GFP and B-sGP183-GFP, BC-uAUG-ds did not affect the mRNA level of GFP, while 2C and AC could reduce the mRNA level of GFP ( Figure 8 D).
[0080] RNA was extracted using the Trizol method and reverse transcribed to obtain cDNA. qRT-PCR was performed using the cDNA as a template to detect GFP mRNA using primers qPCR-GFP-F / R. The primers qPCR-GFP-F / R are shown in SEQ ID NOs: 20-21.
[0081] qPCR-GFP-F: CAATGTATACATCACGGCAGAC
[0082] qPCR-GFP-R:TTTCGAAAGGGCAGATTGTG
[0083] The total plant protein was extracted using the urea method, and GFP protein was detected by Western blot.
[0084] The above experimental results show that the present invention can gradually reduce the accumulation of GFP protein by combining single and double uAUG-ds with sGP183.
[0085] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.
Claims
1. A vector for expressing a protein in plants based on uAUG-ds combined with sGP183 gradient reduction, characterized in that: Using pCAMBIA1300 as the vector backbone, the translation inhibitory element uAUG-ds was combined with the PepMV subgene promoter sGP183 to construct a single uAUG-ds combined with sGP183 vector and / or a double uAUG-ds combined with sGP183 vector.
2. The vector for expressing a protein in plants based on uAUG-ds combined with sGP183 gradient reduction according to claim 1, characterized in that: The uAUG-ds of TUB7, TBF1 and ClassI types were named A-uAUG-ds, B-uAUG-ds and C-uAUG-ds, respectively, and their sequences are shown in SEQ ID NOs: 4-6; the sGP183 sequence of PepMV is shown in SEQ ID NO:
7.
3. The vector for expressing a protein in plants based on the combination of uAUG-ds and sGP183 gradient reduction according to claim 2, characterized in that: A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR, and C-uAUG-ds-sGP183-KpnI-3'UTR were artificially synthesized and constructed into pCAMBIA1300 to obtain pCAMBIA1300-A-sGP183, pCAMBIA1300-B-sGP183, and pCAMBIA1300-C-sGP183 vectors; wherein, the sequences of A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR, and C-uAUG-ds-sGP183-KpnI-3'UTR are shown in SEQ ID NOs: 1-3.
4. The vector for expressing a protein in plants based on uAUG-ds combined with sGP183 gradient reduction according to claim 2, characterized in that: AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR, and 2C-uAUG-ds-sGP183-KpnI-3'UTR were artificially synthesized and constructed into pCAMBIA1300 to obtain pCAMBIA1300-AC-sGP183, pCAMBIA1300-BC-sGP183, and pCAMBIA1300-2C-sGP183 vectors; wherein, the sequences of AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR, and 2C-uAUG-ds-sGP183-KpnI-3'UTR are shown in SEQ ID NOs: 10-12.
5. The method for constructing a vector for expressing a protein in plants based on uAUG-ds combined with sGP183 gradient reduction according to claim 3, characterized in that: Using the artificially synthesized A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR, and C-uAUG-ds-sGP183-KpnI-3'UTR as templates, primers FA / R-BamHI, FB / R-BamHI, and FC / R-BamHI were used to obtain a specific PCR band. The PCR target band was then constructed into the pCAMBIA1300 vector linearized with SacI and BamHI to obtain pCAMBIA1300-A-sGP183, pCAMBIA1300-B-sGP183, and pCAMBIA1300-C-sGP183 vectors; Wherein, the sequences of FA / R-BamHI, FB / R-BamHI and FC / R-BamHI are shown in SEQ ID NOs: 13-16; FA: GAGAGAACACGGGGGACGAGCTCATGGTCTCTGCTTCTGACGTC FB: GAGAGAACACGGGGGACGAGCTC ATGGAAGAAACCAAACGAAACTC FC: GAGAGAACACGGGGGACGAGCTC ATGTGGATGAGGAGTTCGATTG R-BamHI:TACGAACGAAAGCTCGGATCCTTTTTTTTTTTTTTTTTAAATTACAAAAG; The identification primers were FA / R-pCAM, FB / R-pCAM, and FC / R-pCAM; the correct clone was expanded, the plasmid was extracted, and sequenced using R-pCAM primers, the sequence of which is shown in SEQ ID NO: 17; R-pCAM:CACAGTAAATTACAAGCACAAC.
6. The method for constructing a vector for expressing a protein in plants based on uAUG-ds combined with sGP183 gradient reduction according to claim 4, characterized in that: Using the artificially synthesized AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR, and 2C-uAUG-ds-sGP183-KpnI-3'UTR as templates, primers FA / R-BamHI, FB / R-BamHI, and FC / R-BamHI were used to obtain a specific PCR band. The PCR target band was then constructed into the pCAMBIA1300 vector linearized with SacI and BamHI to obtain pCAMBIA1300-AC-sGP183, pCAMBIA1300-BC-sGP183, and pCAMBIA1300-2C-sGP183 vectors; Wherein, the sequences of FA / R-BamHI, FB / R-BamHI and FC / R-BamHI are shown in SEQ ID NOs: 13-16; The identification primers were FA / R-pCAM, FB / R-pCAM and FC / R-pCAM; the correct clone was expanded and cultured, the plasmid was extracted, and sequenced using R-pCAM primers, the sequence of which is shown in SEQ ID NO:
17.
7. Use of the vector for gradient-reducing protein expression in plants based on uAUG-ds combined with sGP183 according to any one of claims 1 to 4 in regulating the expression level of a target protein.
Citation Information
Patent Citations
Method for quickly identifying influence of uORF (Upstream Open Reading Frame) on translational level
CN103642931A
Wisteria mosaic virus WiMV as well as infectious cloning vector and application thereof
CN116622648A
PCAMBIA1300-miniRNA3-BC-NLPPya vector, construction method and application of vector in high cucumber mosaic virus resistance
CN120505357A