Development and application of reporting system for detecting VEGI expression

By constructing the VEGI promoter reporter plasmid and transfecting it in HEK 293T cells, luciferase activity detection was used to solve the accuracy of VEGI promoter activity detection, achieving efficient detection effects, revealing the key regulatory areas of the VEGI promoter, and promoting biomedical research.

CN120505367APending Publication Date: 2025-08-19NANTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510581368.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-07
Publication Date
2025-08-19

AI Technical Summary

Technical Problem

The prior art lacks efficient and accurate detection methods for VEGI promoter activity, which affects the study of VEGI gene transcriptional regulation mechanism and pathogenesis of related diseases.

Method used

Reporter gene plasmids were constructed, including the full-length VEGI promoter and the mutant reporter plasmid, and plasmid transfection was performed in HEK 293T cells. The luciferase activity value of the full-length mutant of the transfected VEGI promoter was detected using a single-tube luminescence detector.

Benefits of technology

An efficient and accurate detection method for VEGI promoter activity is provided, which reduces the interference of experimental conditions and improves data reliability. The role of p50/p65 heterodimer on VEGI promoter activity is discovered, and a key regulatory region is determined, providing a basis for in-depth study of the transcriptional regulatory mechanism of VEGI genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120505367A_ABST
    Figure CN120505367A_ABST
Patent Text Reader

Abstract

The invention provides development and application of a reporter system for detecting VEGI expression, and relates to the technical field of molecular biology, the technical key points are as follows: the invention provides a detection method for detecting VEGI promoter activity, and the detection method is characterized by comprising the following steps: S1, constructing a reporter gene plasmid: the reporter gene plasmid is a VEGI promoter reporter plasmid; s2, carrying out plasmid transfection in an HEK293T cell; and S3, detecting the luciferase activity value of the full-length mutant transfected with the VEGI promoter by using a single-tube light-emitting detector. The method provided by the invention can accurately detect the transcriptional activity of the VEGI promoter, can be widely applied to the field of biomedical research, and provides a new means for knowing the transcriptional regulation mechanism of genes and the pathogenesis of related diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biology technology, and in particular to the development and application of a reporter system for detecting VEGI expression. Background Art

[0002] Vascular Endothelial Growth Inhibitor (VEGI) is a cytokine secreted by vascular endothelial cells. It acts on endothelial cells to inhibit endothelial cell function and angiogenesis, making it an important angiogenesis inhibitor. VEGI can inhibit endothelial cell proliferation by interacting with death receptor 3 (DR3) and activating downstream signaling pathways, thereby reducing angiogenesis. Furthermore, VEGI can inhibit induced phosphorylation of ERK and Akt, blocking the VEGF signaling pathway and reducing endothelial cell survival and migration. VEGI expression is regulated by transcription factors. Transcription factors specifically recognize and bind to sequences within the VEGI promoter through their DNA-binding domains, thereby affecting RNA polymerase binding and the formation of the transcription initiation complex. Changes in promoter activity directly influence VEGI gene transcription levels, thereby impacting its biological function. Currently, research on VEGI promoter activity is inadequate, and efficient and accurate detection methods and application protocols are lacking. Summary of the Invention

[0003] The purpose of the present invention is to solve the problem in the prior art of lacking an efficient and accurate detection method for VEGI (Gene ID: 9966).

[0004] In order to achieve the above object, the present invention adopts the following technical solutions:

[0005] A method for detecting VEGI promoter activity comprises the following steps:

[0006] S1: Construction of reporter gene plasmid: The reporter gene plasmid is the VEGI promoter full-length and mutant reporter plasmid;

[0007] S2: Plasmid transfection will be performed in HEK 293T cells;

[0008] S3: Luciferase activity of the transfected VEGI promoter full-length mutant was detected using a single-tube luminescence detector.

[0009] Preferably, the method for constructing the VEGI promoter reporter plasmid in S1 is to clone the VEGI promoter sequence into the firefly luciferase reporter gene plasmid (pBV-Luc).

[0010] Preferably, in S1, an overexpression plasmid is first constructed:

[0011]

[0012] Then construct the luciferase reporter plasmid:

[0013]

[0014] Preferably, an internal reference plasmid carrying the Renilla luciferase gene is constructed in S1 and used as an internal control.

[0015] Preferably, in S2, the p50 (Gene ID: 4790) + p65 (Gene ID: 5970) heterodimer and the full-length VEGI promoter are co-transfected into HEK 293T cells.

[0016] Preferably, the specific steps of S2 are:

[0017] 1) One day before transfection, HEK 293T cells were seeded into six-well plates according to grouping, with one replicate well per group and a seeding density of approximately 70% per well.

[0018] 2) On the day of transfection, discard the old culture medium in the six-well plate and replace it with 2 mL of fresh complete culture medium.

[0019] 3) Take a corresponding number of 1.5 mL centrifuge tubes and add 125 μL of Opti-MEM without antibiotics and serum to each tube. Then add the pLV3-V, pLV3-p50, pLV3-p65, pVEGI-promoter DNA plasmids and the Renilla plasmid.

[0020] Preferably, the mass ratios of the DNA plasmids and Renilla plasmids in step 3) are as follows:

[0021]

[0022] Compared with the prior art, this application has the following beneficial effects:

[0023] 1. The present invention provides an efficient and accurate method for detecting VEGI promoter activity. By using a dual-luciferase reporter system, the method can effectively reduce the interference of experimental conditions on the results and improve the reliability of the data.

[0024] 2. This method revealed the promoting effect of p50 / p65 heterodimers on VEGI promoter activity and identified the key regulatory region of the VEGI promoter, providing important evidence for in-depth research on the transcriptional regulation mechanism of the VEGI gene;

[0025] In summary, the method of the present invention provides a method for accurately detecting the transcriptional activity of the VEGI promoter, which can be widely used in the field of biomedical research and provide a new means for understanding the transcriptional regulation mechanism of genes and the pathogenesis of related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a fluorescence intensity analysis diagram of the VEGI promoter in each group of cells in the present invention.

[0027] Figure 2 It is a schematic diagram of the full-length and mutant forms of the VEGI promoter of the present invention.

[0028] Figure 3 This is a fluorescence intensity analysis diagram of the VEGI promoter mutants in each group of cells in the present invention. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below with reference to specific embodiments.

[0030] A method for detecting VEGI promoter activity comprises the following steps:

[0031] S1: Construction of reporter gene plasmid:

[0032] The VEGI promoter sequence was cloned into the firefly luciferase reporter gene plasmid (pBV-Luc) to construct the VEGI promoter reporter plasmid;

[0033] Specifically, the overexpression plasmid is constructed as follows:

[0034] Overexpression plasmid vector:

[0035]

[0036] Search the target gene sequence on websites such as NCBI Blast, design synthetic cloning primers, and amplify. Be careful to verify that the target fragment contains double enzyme digestion sites. Primers should be short, with a GC content of approximately 60%. Be careful to avoid ligation at the 3' end.

[0037] Amplify target gene:

[0038] PCR amplification system 20 μL:

[0039]

[0040] Set the amplification temperature and number of cycles:

[0041]

[0042] Gel excision and recovery of PCR products: Prepare an agarose gel of appropriate concentration in advance, run the PCR products through electrophoresis, and then excise and recover the products to detect the concentration.

[0043] Restriction digestion of PCR products and vector pLV3(-):

[0044] Double enzyme digestion reaction system (50 μl)

[0045]

[0046] After 1 hour in a 37°C water bath, the product was excised and recovered by gel cleavage. The above enzyme digestion products were mixed with DNA loading buffer and added to agarose gel. After electrophoresis recovery, gel cleavage was performed according to the instructions of the recovery kit. After elution with 20 μL of sterile ddH2O, the concentration was detected.

[0047] The recovered product was ligated at 16°C overnight. The ligation product was introduced into the recipient bacteria (competent DH5a) and plated overnight. The next day, the colony growth was observed and a single colony was selected and placed in liquid LB medium for amplification. The amplified bacterial solution was used to extract the plasmid using the plasmid extraction kit from Nanjing Novezan Biotechnology Co., Ltd. The plasmid concentration was measured and used for later use.

[0048] Use agarose gel electrophoresis to determine correctness based on the molecular weight of the bands. Use the pLV3(-) vector as a negative control. If constructing a plasmid lacking the target gene fragment, use the full-length target gene plasmid as a reference. Finally, send the plasmid to a sequencing company for accurate sequencing.

[0049] Then, the same method was used to construct the full-length and mutant luciferase reporter plasmids of VEGI promoter on the pBV-Luc vector:

[0050] In one embodiment, an internal reference plasmid carrying the Renilla luciferase gene is constructed and used as an internal control.

[0051] S2: Plasmid transfection in HEK293T cells:

[0052] The p50+p65 heterodimer was co-transfected with the full-length VEGI promoter into HEK293T cells;

[0053] S3: Dual luciferase reporter assay:

[0054] The luciferase activity of the transfected VEGI promoter full-length mutant was detected using a single-tube luminescence detector.

[0055] The above contents are described below with reference to specific embodiments:

[0056] Example 1: Experimental materials and sources:

[0057] 1. Single-tube luminescence detector was purchased from Promega;

[0058] 2. OPTI-MEM was purchased from Gibco;

[0059] 3. DMEM high glucose medium was purchased from Hyclone Company;

[0060] 4. FBS was purchased from eallBio;

[0061] 5. Lipo8000 TM Transfection reagents were purchased from Beyotime Biotechnology Co., Ltd.

[0062] 6. Firefly luciferase reporter gene cell lysate was purchased from Beyotime Biotechnology Co., Ltd.

[0063] 7. ReporterAssay System was purchased from Promega (Beijing) Biotech;

[0064] Example 2: Verification experiment and result display:

[0065] 1. Plasmid construction

[0066] (1) Overexpression plasmid construction

[0067] Table 1 Overexpression plasmid vector

[0068]

[0069] (2) Luciferase reporter plasmid construction: Construction of VEGI promoter and its mutant plasmid in the dual luciferase system

[0070] Table 2 Luciferase reporter plasmid vector

[0071]

[0072] 2. Dual luciferase reporter assay

[0073] (1) Detection of VEGI promoter activity in cells co-transfected with full-length VEGI and p50 / p65 heterodimer

[0074] 1) One day before transfection, HEK 293T cells were seeded into six-well plates according to grouping, with one replicate well per group and a seeding density of approximately 70% per well.

[0075] 2) On the day of transfection, discard the old culture medium in the six-well plate and replace it with 2 mL of fresh complete culture medium.

[0076] 3) Take a corresponding number of 1.5 mL centrifuge tubes and add 125 μL of Opti-MEM without antibiotics and serum to each tube. Add the corresponding volume of DNA plasmid according to the DNA plasmid content in each group in the table below and mix thoroughly by gently pipetting.

[0077] Table 3 Cell transfection groups for detecting pVEGI-promoter activity

[0078]

[0079] Note: Groups ②-③ were added with 0.1 μg of Renilla plasmid as an internal reference

[0080] 4) According to the amount of plasmid (μg): Lipo8000 TM (μL)=1:1.6Add Lipo8000 to each centrifuge tube TM , gently blow to mix, then add dropwise to the corresponding six-well plate, and place in the incubator to continue culturing;

[0081] 5) Observe the cell status and replace with fresh complete medium after 6 hours;

[0082] 6) Dual luciferase assay was performed after 48 h.

[0083] The results are as follows Figure 1 As shown, the VEGI promoter was activated as detected by dual luciferase reporter gene assay, and co-transfection of p50 / p65 heterodimer further promoted the VEGI promoter activity (***P<0.001, ****P<0.0001).

[0084] (2) Cell lysis and dual luciferase assay

[0085] 1) When using the dual-luciferase assay reagent for the first time, add all of the Luciferase Assay Buffer II to the Luciferase Assay Substrate to completely dissolve the substrate in the buffer to make the Luciferase Assay Reagent. Aliquot and store at -80°C until ready for use.

[0086] 2) Remove Stop& Buffer was dissolved at room temperature and 50×Stop& Substrate diluted to 1×Stop& Substrate, mix thoroughly and place on ice for later use, Stop& Reagent must be prepared before use;

[0087] 3) Dissolve the dual-luciferase reporter gene cell lysate at room temperature, aspirate the culture medium in the six-well plate, wash the cells once with pre-chilled PBS, add 150-200 μL of melted cell lysate to each well, scrape the cells with a cell scraper, transfer them to a 1.5 mL centrifuge tube, and place on ice until assayed.

[0088] 4) Take out a new 1.5 mL centrifuge tube, add 10 μL of cell lysis buffer, cap tightly, and place in a detector to measure the fluorescence value of firefly luciferase and Renilla luciferase as blank controls;

[0089] 5) Pipette 10 μL of cell lysate, add 20 μL of Luciferase Assay Reagent, mix well, and then measure the firefly luciferase fluorescence value on the instrument;

[0090] 6) Take out the centrifuge tube from the detector and add 20μL Stop& Reagent, mix well and then test the fluorescence value of Renilla luciferase as an internal reference;

[0091] 7) The same sample was tested twice, and the ratio of firefly to Renilla luciferase fluorescence values was statistically analyzed using GraphPad Prism 10.

[0092] (3) Detection of VEGI promoter activity in cells co-transfected with VEGI mutants and p50 / p65 heterodimers

[0093] In one embodiment, see Figure 2 , Figure 2 The full-length and truncated versions of the VEGI promoter are shown, including

[0094]

[0095] Truncated form lacking -1113bp / -713bp: (pVEGI-mut1 (SEQ ID NO:02): TAACTTTA GACTAATCAGGGAGTAGTGGTTAATGTTCTACCCTCACAGACAGTCACCTCGATCTGTGGCCTCATACTCTGATTAAACAATGGTCAATGCAGACTGGAAATACTTTCCTTTCATGGGCAGTCATGTGCTAGAGGTTACAACTCCAAGCCGTGATTTAGAACTAGGTCATCTTCCTAGCTCCTCTGTCTTCATCCTTGGATGACCTAGGACAAGTGCCTTCACCTTTTAGAACTTTGCTATTCCCATCTGTACACTGAGAATGAATTTCTATGAGGTTCAAAATGACAGAGGGCTAGGCAGCACTTTGCAAAGAGCTGATGCAAATGTGATTTCCGTTTCCCAATCTGCAAACCACACACCTCTCATCCCTCACTTTCACTTCCAGAAGCACACTCCCCAGACTGGCACAGCTGGTAAGCCTCCAGTGCAGGGAACAGGTATATTTTAATTTGCCCCACCCACTGACTTGATGAATTCTTTCTCTCCTCCTTCAGGGACTTTCCTAACTTCCTTCTGTAAACGAAGGAAGGAGCACATGAGCATACTGTATATAAATATGCTTGGGAAAGCTTTCTTCTTCTCCTTCTTCTTCTTTTTTTTTTTTTTTTTTTTTTCCTCAAACCAAACTTGGTTTCTGTTGTAGGCGGTGCATTCTCTAGCAGGGTAGGGCCACAGTGTGCTCTTGAAGAGGGGAGGGGAGAGGAAAAGGGAAGGAGGAGACTGAGTGATTAAGTCACCCACTGTGAGAGCTGGTCTTCTATTTAATGGGGGCTCTCTCTGCCCAGGAGTC) and

[0096] -1113bp / -314bp truncation: (pVEGI-mut2(SEQ ID NO:03):CACTCCCCAGACTGGCACAGCTGGTAAGCCTCCAGTGCAGGGAACAGGTATATTTTAATTTGCCCCACCCACTGACTTGATGAATTCTTTCTCTCCTCCTTCAGGGACTTTCCTAACTTCCTTCTGTAAACGAAGGAAGGAGCACATGAGCATACTGTATATAAATATGCTTGGGAAAGCTTTCTTCTTCTCCTTCT TCTTCTTTTTTTTTTTTTTTTTTCCTCAAACCAAACTTGGTTTCTGTTGTAGGCGGTGCATTCTCTAGCAGGGTAGGGCCACAGTGTGCTCTTGAAGAGGGGAGGGGAGAGGAAAAGGGAAGGAGGAGACTGAGTGATTAAGTCACCCACTGTGAGAGCTGGTCTTCTATTTAATGGGGGCTCTCTCTGCCCAGGAGTC).

[0097] The specific steps are as follows:

[0098] 1) One day before transfection, HEK 293T cells were seeded into six-well plates according to grouping, with one replicate well per group and a seeding density of approximately 70% per well.

[0099] 2) On the day of transfection, discard the old culture medium in the six-well plate and replace it with 2 mL of fresh complete culture medium.

[0100] 3) Take a corresponding number of 1.5 mL centrifuge tubes and add 125 μL of Opti-MEM without antibiotics and serum to each tube. Add the corresponding volume of DNA plasmid according to the DNA plasmid content in each group in the table below and mix thoroughly by gently pipetting.

[0101] Table 4 Cell transfection groups for detecting pVEGI-mut1 activity

[0102]

[0103] Note: Groups ②-③ were added with 0.1 μg of Renilla plasmid as an internal reference

[0104] Table 5 Cell transfection groups for detecting pVEGI-mut2 activity

[0105]

[0106] Note: Groups ②-③ were added with 0.1 μg of Renilla plasmid as an internal reference

[0107] 4) According to the amount of plasmid (μg): Lipo8000 TM (μL)=1:1.6Add Lipo8000 to each centrifuge tube TM , gently blow to mix, then add dropwise to the corresponding six-well plate, and place in the incubator to continue culturing;

[0108] 5) Observe the cell status and replace with fresh complete medium after 6 hours;

[0109] 6) After 48 hours, perform dual luciferase assay using the same steps as above.

[0110] The results are as follows Figure 3 As shown in Figure 2, the fluorescence intensity of the VEGI-mut1 promoter in cells was significantly enhanced after co-transfection of the pVEGI-mut1 plasmid with the p50 and p65 plasmids; Figure 3 B, There was no significant change in the fluorescence intensity of the VEGI-mut2 promoter after co-transfection of pVEGI-mut2 plasmid with p50 and p65 plasmids.

[0111] The above experiments show that the -712bp / -314bp region of the VEGI promoter is the key region for p50 / p65 heterodimers to activate its transcriptional activity.

[0112] In summary, the present application provides an efficient and accurate method for detecting VEGI promoter activity. By utilizing the dual luciferase reporter system, the interference of changes in experimental conditions on the results can be effectively reduced, thereby improving the reliability of the data. Furthermore, this method discovered the promoting effect of p50 / p65 heterodimers on VEGI promoter activity, and determined the key regulatory regions of the VEGI promoter, providing an important basis for in-depth study of the transcriptional regulation mechanism of the VEGI gene. The present application provides a method for accurately detecting the transcriptional activity of the VEGI promoter, which can be widely used in the field of biomedical research, and provides a new means for understanding the transcriptional regulation mechanism of genes and the pathogenesis of related diseases.

Claims

1. A method for detecting VEGI promoter activity, characterized in that: The following steps are involved: S1: Construction of reporter gene plasmid: The reporter gene plasmid is a VEGI promoter reporter plasmid; S2: Plasmid transfection will be performed in HEK 293T cells; S3: Luciferase activity of the transfected VEGI promoter full-length mutant was detected using a single-tube luminescence detector.

2. The method for detecting VEGI promoter activity according to claim 1, wherein: The method for constructing the VEGI promoter reporter plasmid in S1 is to clone the VEGI promoter sequence into the firefly luciferase reporter gene plasmid (pBV-Luc).

3. The method for detecting VEGI promoter activity according to claim 2, wherein: In the S1, an overexpression plasmid is first constructed: Then construct the luciferase reporter plasmid:

4. The method for detecting VEGI promoter activity according to claim 3, wherein: An internal reference plasmid carrying the Renilla luciferase gene was constructed in S1 and used as an internal control.

5. The method for detecting VEGI promoter activity according to claim 4, wherein: In the S2, p50+p65 heterodimers were co-transfected with the full-length VEGI promoter into HEK 293T cells.

6. The method for detecting VEGI promoter activity according to claim 5, wherein: The specific steps of S2 are: 1) One day before transfection, HEK 293T cells were seeded into six-well plates according to grouping, with one replicate well per group and a seeding density of approximately 70% per well. 2) On the day of transfection, discard the old culture medium in the six-well plate and replace it with 2 mL of fresh complete culture medium. 3) Take a corresponding number of 1.5 mL centrifuge tubes and add 125 μL of Opti-MEM without antibiotics and serum to each tube. Then add the pLV3-V, pLV3-p50, pLV3-p65, pVEGI-promoter DNA plasmids and the Renilla plasmid.

7. The method for detecting VEGI promoter activity according to claim 6, wherein: The mass ratios of the DNA plasmids and Renilla plasmids in step 3) are as follows: