Method for detecting content of glutamic acid based on glutamine synthetase isoenzyme and application of method
By using TaGS1;3 enzyme catalyzing the reaction of glutamic acid with hydroxylamine and chromatogenesis, the specificity and cost problems of the detection methods in the prior art were solved, and efficient, accurate and low-cost quantitative detection of glutamic acid was achieved.
Patent Information
- Application Number
- CN202510581992.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-07
- Publication Date
- 2025-08-19
AI Technical Summary
In the prior art, the glutamate content determination method has problems such as low specificity, susceptibility to interference from other amino acids, requiring expensive equipment and complex operations, especially the accuracy and cost limitations of the GDH method and the traditional GS method.
A new glutamine synthetase isozyme TaGS1;3 is used to catalyze the reaction of glutamic acid with hydroxylamine to produce γ-glutamyl hydroxamic acid, and the glutamic acid content is determined by using FeCl3 chromatogenesis method, which avoids interference from other amino acids, simplifies the operation process, and reduces equipment demand.
It realizes high specificity and high sensitivity glutamic acid detection, which is lower than that of HPLC method, and is suitable for large-scale sample detection, and the detection results are highly consistent with the HPLC method.
Smart Images

Figure CN120505397A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of glutamate content detection technology, specifically relating to a method for detecting glutamate content based on glutamine synthase isoenzyme and its application. Background Art
[0002] Glutamic acid is one of the essential amino acids in living organisms, playing a crucial role in metabolic regulation, signal transduction, and protein synthesis. Accurate determination of glutamate content is of great significance for biochemical research, the food industry, and pharmaceutical development. Currently, methods for determining glutamate content mainly include enzymatic methods based on glutamate dehydrogenase (GDH) and high-performance liquid chromatography (HPLC). The GDH method catalyzes the reaction of glutamate with NAD+ or NADP+ to generate α-ketoglutarate and NADH / NADPH, and the glutamate content is indirectly determined by detecting the absorbance of NADH / NADPH. However, the GDH method has limitations such as low specificity, susceptibility to interference from other amino acids (such as alanine and aspartic acid), the need for expensive coenzymes, and strict reaction conditions. Furthermore, while the HPLC method offers high sensitivity and accuracy, its equipment is expensive, operation is complex, and analysis time is long, making it unsuitable for large-scale sample analysis.
[0003] Theoretically, methods based on glutamine synthase (GS) can catalyze the reaction of glutamate with hydroxylamine to generate γ-glutamylhydroxyxamic acid (GMH). The glutamate content is then determined colorimetrically after GMH reacts with ferric chloride. However, the activity of traditional GS is easily interfered with by exogenous amino acids such as glutamine, leading to inaccurate results and limiting its application in glutamate content determination.
[0004] To address this issue, this invention has screened a novel glutamine synthase isoenzyme (TaGS1;3). This isoenzyme exhibits catalytic activity unaffected by other amino acids, and possesses advantages such as high specificity, high sensitivity, and ease of operation. The TaGS1;3-based assay method requires no expensive equipment or coenzymes, providing a new technical solution for the rapid, accurate, and low-cost detection of glutamate. Summary of the Invention
[0005] The purpose of this invention is to provide a method for detecting glutamate content based on glutamine synthase isoenzyme and its application.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] The application of a glutamine synthase isoenzyme TaGS1;3 in the detection of glutamate content, wherein the amino acid sequence of the glutamine synthase TaGS1;3 is shown in Table SEQ ID No.1.
[0008] This invention also provides a method for detecting glutamate content based on the glutamine synthase isoenzyme TaGS1;3, comprising the following steps:
[0009] S1. Draw the standard curve
[0010] Add 0.3 mL of imidazole-hydrochloric acid solution, 0.1 mL of MgSO4 solution, 0.2 mL of ATP-Na2 solution, and 0.2 mL of TaGS1;3 crude enzyme solution to several centrifuge tubes, respectively; then add different amounts of glutamic acid to several centrifuge tubes to make their final concentrations 0 mM, 0.25 mM, 0.5 mM, 0.75 mM, 1.0 mM, 1.5 mM, and 2.0 mM, respectively, and make up the reaction system to 1.2 mL with deionized water.
[0011] Incubate at 37℃ for 5 min, add 0.1 mL of hydroxylamine reagent and react at 37℃ for 30 min, add 0.5 mL of FeCl3 stop solution, mix well, and centrifuge at 8000 g for 5 min; measure the A value of the supernatant using an enzyme-linked immunosorbent assay (ELISA) reader. 540nm Absorbance; plotted on the x-axis, A 540nm Plot a standard curve with absorbance values as the ordinate;
[0012] S2. Determine the glutamic acid content of the sample to be tested.
[0013] Add 0.3 mL of imidazole-hydrochloric acid solution, 0.1 mL of MgSO4 solution, 0.2 mL of ATP-Na2 solution, and 0.2 mL of TaGS1;3 crude enzyme solution to multiple centrifuge tubes respectively; dilute the test samples 5 times and 10 times respectively, and add 0.2 mL of the diluted test sample to different centrifuge tubes respectively, with the treatment of adding 0.2 mL of deionized water to the centrifuge tube as a blank control;
[0014] Incubate at 37℃ for 5 min, add 0.1 mL of hydroxylamine reagent and react at 37℃ for 30 min, add 0.5 mL of FeCl3 stop solution, mix well, and centrifuge at 8000 g for 5 min; measure the A value of the supernatant using an enzyme-linked immunosorbent assay (ELISA) reader. 540nm Absorbance; A 540nm The absorbance value was substituted into the standard curve to calculate the glutamic acid content.
[0015] Furthermore, in steps S1 and S2, the concentrations of the imidazole-hydrochloric acid solution, MgSO4 solution, ATP-Na2 solution, and hydroxylamine reagent are 0.5 mol / L, 0.5 mol / L, 30 mmol / L, and 1 mol / L, respectively.
[0016] Furthermore, in steps S1 and S2, the final FeCl3 solution is prepared by mixing equal volumes of 0.37 mol / L FeCl3 solution, 1.47 mol / L trichloroacetic acid solution, and 50% HCl solution.
[0017] Furthermore, in steps S1 and S2, the preparation method of the TaGS1;3 crude enzyme solution includes the following steps:
[0018] a.TaGS1;3 clone
[0019] Grain samples of Yumai 49-198 were ground with liquid nitrogen, and total RNA was extracted and reverse transcribed to obtain the corresponding cDNA. Specific primers were designed based on the TaGS1;3 sequence, and PCR amplification was performed using cDNA as a template. The amplified product was purified. The purified DNA fragment was linked to a T vector, heat-transformed into DH5α Escherichia coli competent cells, and after resistance screening and sequencing verification, the correctly sequenced strains were preserved.
[0020] b. Construction of prokaryotic expression vectors
[0021] Seamless cloning primers were designed based on the CDS sequence of TaGS1;3. PCR amplification was performed using the TaGS1;3 T vector as a template. The amplification product was purified, and the pET-21a-TaGS1;3 recombinant vector was constructed. The correctly sequenced recombinant vector was transformed into Rosetta(DE3)pLysS Escherichia coli competent cells. After resistance selection and sequencing verification, the correctly sequenced bacterial strain was preserved.
[0022] c.TaGS1;3 prokaryotic expression
[0023] Rosetta(DE3)pLysS bacterial culture containing the pET-21a-TaGS1;3 recombinant vector was inoculated into LB liquid medium and activated overnight at 37°C and 220 rpm. The activated bacterial culture was then inoculated into LB liquid medium and cultured at 37°C and 220 rpm until OD was reached. 600 The value was 0.6. IPTG was added to a final concentration of 1 mmol / L. Expression was induced at 37℃ for 5 h. The cells were then collected by centrifugation at 4℃ and 8000g for 5 min.
[0024] d. TaGS1;3 Crude enzyme solution collection
[0025] The bacterial cells were resuspended in a lysing buffer, and PMSF was added to a final concentration of 1 mmol / L. The cells were then autoclaved on ice until the bacterial solution was clear. The solution was centrifuged at 12,000 rpm for 25 min at 4 °C, and the supernatant was collected as the crude TaGS1;3 enzyme solution.
[0026] Furthermore, in step a, the specific primers are specifically TaGS1;3-S and TaGS1;3-A, whose base sequences are shown in SEQ ID No. 2 and SEQ ID No. 3 of the sequence listing, respectively.
[0027] Furthermore, in step b, the seamless cloning primers are specifically E-TaGS1;3-S and E-TaGS1;3-A, whose base sequences are shown in SEQ ID No. 4 and SEQ ID No. 5 of the sequence listing.
[0028] The present invention also provides the application of the method in detecting glutamic acid content.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] (1) This application reveals the catalytic characteristics and application potential of TaGS1;3 enzyme through a multi-dimensional experimental system, elucidates the temperature adaptability and substrate specificity of TaGS1;3 enzyme, and shows a high degree of consistency with HPLC detection method in cross-validation experiments.
[0031] (2) The method of this invention for detecting glutamate content is significantly superior to other glutamate dehydrogenase detection methods, such as GDH which is often interfered with by α-ketoglutarate.
[0032] (3) The method for detecting glutamic acid content in this invention does not require complex sample pretreatment or expensive instruments, and the cost of a single detection is about 10% of that of HPLC, with high throughput.
[0033] Therefore, based on the unique catalytic properties of TaGS1;3 glutamine synthase, this application has successfully constructed an efficient, economical and highly specific method for the quantitative detection of glutamate. Attached Figure Description
[0034] Figure 1 The effect of different temperatures on the catalytic activity of TaGS1;3 enzyme;
[0035] Figure 2 The inhibitory effect of 20 amino acids on the catalytic activity of TaGS1;3 enzyme;
[0036] Figure 3 The inhibitory effect of a mixture of 19 amino acids on the catalytic activity of TaGS1;3 enzyme;
[0037] Figure 4 This is a standard curve of glutamate concentration gradient. Detailed Implementation
[0038] The technical solution of this invention patent will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this invention.
[0039] In the following examples, the final FeCl3 solution was prepared by mixing equal volumes of 0.37 mol / L FeCl3 solution, 1.47 mol / L trichloroacetic acid solution, and 50% HCl solution.
[0040] 1. Materials and Methods
[0041] 1.1 Cloning of TaGS1;3
[0042] Take 0.2g of Yumai 49-198 grain sample, grind it with liquid nitrogen, extract total RNA with TRIzol Reagent, and reverse transcribe the extracted total RNA with HiScriptIIQ RT SuperMix for qPCR (+gDNAwiper) to obtain the corresponding cDNA;
[0043] The amino acid sequence of the isoenzyme TaGS1;3 is shown in SEQ ID No. 1. Specific primers TaGS1;3-S and TaGS1;3-A (corresponding base sequences are shown in Table 1) were designed based on the TaGS1;3 sequence. Using cDNA as a template, PCR amplification was performed using PhantaEVO Super-Fidelity DNA Polymerase (Vazyme). The amplification system is shown in Table 2. The amplification program was: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 35 s, 35 cycles; 72℃ extension for 5 min.
[0044] Table 1. Base sequences of primers for cloning the isoenzyme TaGS1;3
[0045] Primer name Primer base sequence (5′-3′) sequence list TaGS1; 3-S GAAGAAGAAGAAGAGGTAGCCATG SEQ ID No.2 TaGS1; 3-A AACAGAACCCATCAAAGCCAC SEQ ID No. 3
[0046] Table 2. Isoenzyme TaGS1;3 Cloning PCR Amplification Program
[0047] Components volume 2×PhantaMaxBuffer 10 μL TaGS1; 3-S 1μL TaGS1; 3-A 1μL dNTPMix 0.5μL template 0.5μL PhantaMax 0.5μL <![CDATA[ddH2O]]> 0.5μL
[0048] The amplified products were purified using the Mini BEST DNA Fragment Purification Kit Ver. 4.0 (TaKaRa). The purified DNA fragments were ligated into the T vector, and then heat-shocked into DH5α Escherichia coli competent cells (heat-shocked in a water bath at 42℃ for 45 seconds, followed immediately by cooling on ice for 2-3 minutes). After transformation, carbenicillin was used for antibiotic selection. Single colonies were picked, cultured, plasmids were extracted, and electrophoresis was performed. Transformed strains that were correctly identified were selected for sequencing identification. After successful sequencing, the strains were aliquoted and stored at -80℃.
[0049] 1.2 Construction of prokaryotic expression vectors
[0050] Seamless cloning primers E-TaGS1;3-S and E-TaGS1;3-A (corresponding base sequences are shown in Table 3) were designed based on the CDS sequence of TaGS1;3 for the construction of prokaryotic expression vectors. PCR amplification was performed using the TaGS1;3 T vector as a template. The amplification system is shown in Table 4. The amplification program was: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s, 72℃ annealing and extension for 50 s, 30 cycles; 72℃ extension for 5 min.
[0051] Table 3 Seamless cloning primer base sequences
[0052] Primer name Primer base sequence (5′-3′) sequence list E-TaGS1; 3-S CTTTAAGAAGGAGATATACATATGTCTCCGCTCGCCGACCTTC SEQ ID No. 4 E-TaGS1; 3-A TGCTCGAGTGCGGCCGCAAGCTTCTTGCCATTGGAGAGACCGGCC SEQ ID No. 5
[0053] Table 4. PCR amplification system constructed using expression vector method
[0054] Components system Linearized carrier 0.03 pmol Insert fragment 0.06 pmol 5×CEⅡBuffer 4μL Exnasell 2μL <![CDATA[ddH2O]]> To 20μL
[0055] The amplification products were purified using the Mini BEST DNAFragment Purification Kit Ver. 4.0 (TaKaRa), and the pET-21a-TaGS1;3 recombinant vector was constructed using the Clon Express One Step Cloning Kit (Vazyme). The correctly sequenced recombinant vector was transformed into Rosetta(DE3)pLysS Escherichia coli competent cells (heat-shocked in a 42℃ water bath for 45s, then immediately cooled on ice for 2-3min). After antibiotic selection and sequencing verification, the bacterial strains were aliquoted and stored at -80℃.
[0056] 1.3TaGS1;3 Prokaryotic Expression
[0057] Take 5 μL of Rosetta(DE3)pLysS bacterial culture containing the pET-21a-TaGS1;3 recombinant vector, inoculate it into 5 mL of LB liquid medium (10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, and sterile water to a final volume of 1 L, adjusting the pH to 7.4; containing 1 mmol / L Carb and 34 μg / mL Crm), and activate overnight at 37 °C and 220 rpm.
[0058] Inoculate the activated bacterial culture into 500 mL of LB liquid medium (containing 1 mmol / L Carb and 34 μg / mL Crm), and culture at 37 °C and 220 r / min until OD is reached. 600 The value was 0.6, and IPTG was added to a final concentration of 1 mmol / L. Expression was induced at 37℃ for 5 h. After induction, the cells were collected by centrifugation at 4℃ and 8000g for 5 min and stored at -20℃.
[0059] 1.4 Analysis of the catalytic characteristics of TaGS1;3 enzyme
[0060] The bacterial cells were resuspended in a disruption buffer and 0.1 mmol / L LMSF was added to a final concentration of 1 mmol / L. The cells were then autoclaved on ice at 1000 bar for 5-6 cycles until the bacterial suspension was clear. The bacterial suspension was then centrifuged at 4°C and 12000 rpm for 25 min, and the supernatant was collected as TaGS1.3 crude enzyme solution for catalytic activity analysis.
[0061] The disruption buffer consisted of 50 mmol / L NaH2PO4·2H2O, 300 mmol / L NaCl, 0.1 mmol / L MgCl2·6H2O, and 10 mmol / L imidazole, with the pH adjusted to 8.0 using NaOH solution.
[0062] 1.4.1 Screening for optimal catalytic temperature of TaGS1;3 enzyme
[0063] Add the reaction system from Table 5 to 2 mL centrifuge tubes respectively. Replace the crude enzyme solution with the broken buffer as a control group. Level the reaction system to 1.2 mL with deionized water. After mixing well, incubate at their respective reaction temperatures for 5 min. Then add 0.1 mL of 1 mol / L hydroxylamine reagent and react at their respective reaction temperatures for 30 min.
[0064] The reaction temperature gradient was set to 0℃, 4℃, 10℃, 15℃, 20℃, 25℃, 28℃, 37℃, 40℃, 45℃, 50℃ and 55℃. After the reaction was completed, 0.5 mL of FeCl3 stop solution was added, mixed well and centrifuged at 8000g for 5 min. The supernatant was collected and the absorbance of the supernatant at 540 nm was measured using an ELISA reader.
[0065] Table 5 Reaction System
[0066] reagents Added amount concentration Imidazole-hydrochloric acid (pH 7.6) 0.3mL 0.5 mol / L <![CDATA[MgSO4 solution]]> 0.1mL 0.5 mol / L <![CDATA[Sodium ATP solution]]> 0.2mL 30mmol / L Sodium glutamate solution 0.2mL 0.3 mol / L TaGS1;3 crude enzyme solution 0.2mL --
[0067] 1.4.2 Interference of 220 amino acids on the catalytic activity of TaGS1;3 enzyme
[0068] Twenty amino acids—glycine, alanine, valine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine—were each prepared into stock solutions of specific concentrations. The concentrations were as follows: tyrosine 2.5 mmol / L, aspartic acid 30 mmol / L, and the remaining 18 amino acids 50 mmol / L. These solutions were stored at 4°C for later use.
[0069] Add 0.3 mL of 0.5 mol / L imidazole-hydrochloric acid (pH 7.6), 0.1 mL of 0.5 mol / L MgSO4, 0.2 mL of 30 mmol / L ATP-Na2, 0.2 mL of 0.3 mol / L sodium glutamate, and 0.2 mL of TaGS1;3 crude enzyme solution to 2 mL centrifuge tubes. The treatment group that replaced the crude enzyme solution with a disruption buffer served as the control group. The treatment group that did not add any exogenous amino acids served as the conventional treatment group. The treatment groups that added low-concentration exogenous amino acids and high-concentration exogenous amino acids served as the amino acid treatment groups. For the low-concentration exogenous amino acid treatment group, add 0.12 mL of the corresponding amino acid stock solution; for the high-concentration exogenous amino acid treatment group, add 0.24 mL of the corresponding amino acid stock solution. The reaction volume was then leveled to 1.2 mL with deionized water.
[0070] Incubate at 37℃ for 5 min, add 0.1 mL of 1 mol / L hydroxylamine reagent and react at 37℃ for 30 min; after the reaction is complete, add 0.5 mL of FeCl3 stop solution, mix well, centrifuge at 8000 g for 5 min, take the supernatant, and measure the absorbance of the supernatant at 540 nm using an ELISA reader.
[0071] 1.4.3 Interference of a mixture of 319 amino acids on the catalytic activity of TaGS1;3 enzyme
[0072] Equal volumes of the mother liquors of 19 amino acids (excluding glutamic acid) were mixed to obtain an amino acid mixture. In the amino acid mixture, the concentration of tyrosine was 0.132 mmol / L, the concentration of aspartic acid was 1.58 mmol / L, and the concentrations of the remaining 17 amino acids were approximately 2.63 mmol / L. 0.3 mL of 0.5 mol / L imidazole-hydrochloric acid (pH 7.6), 0.1 mL of 0.5 mol / L MgSO4, 0.2 mL of 30 mmol / L ATP-Na2, and 0.2 mL of TaGS1;3 crude enzyme solution were added to 2 mL centrifuge tubes, respectively. Different final concentration gradients of glutamic acid were added to the reaction system to achieve final concentrations of 0 mM, 0.5 mM, 1 mM, 1.5 mM, 2 mM, 3 mM, 5 mM, and 10 mM. Three reaction systems were prepared, and each system was brought to a final volume of 1.2 mL with deionized water. The specific details of the three reaction systems are as follows:
[0073] Group 1: No mixed amino acids added;
[0074] Group 2: Different concentrations of mixed amino acids were added, with final concentrations of the mixed amino acids being: 0.125mM, 0.25mM, 0.375mM, 0.5mM, 0.75mM, 1.25mM, and 2.5mM, respectively.
[0075] Group 3: Add different concentrations of mixed amino acids. The final concentrations of the mixed amino acids are 0.25mM, 0.5mM, 0.75mM, 1mM, 1.5mM, 2.5mM, and 5mM, respectively.
[0076] Incubate at 37℃ for 5 min, add 0.1 mL of 1 mol / L hydroxylamine reagent and react at 37℃ for 30 min; after the reaction is complete, add 0.5 mL of FeCl3 stop solution, mix well, centrifuge at 8000 g for 5 min, take the supernatant, and measure the absorbance of the supernatant at 540 nm using an ELISA reader.
[0077] 2. Determination of glutamate content based on TaGS1;3 enzyme
[0078] 2.1 Drawing the standard curve
[0079] Take seven 2mL centrifuge tubes and add 0.3mL of 0.5mol / L imidazole-hydrochloric acid (pH 7.6), 0.1mL of 0.5mol / L MgSO4, 0.2mL of 30mmol / L ATP-Na2, and 0.2mL of TaGS1;3 crude enzyme solution to each tube, respectively. Then add different amounts of glutamic acid to each of the seven centrifuge tubes to make their final concentrations 0mM, 0.25mM, 0.5mM, 0.75mM, 1mM, 1.5mM, and 2mM, respectively. Then, add deionized water to each tube to bring the total volume of the reaction mixture to 1.2mL.
[0080] Incubate at 37℃ for 5 min, add 0.1 mL of 1 mol / L hydroxylamine reagent, and react at 37℃ for 30 min. After the reaction, add 0.5 mL of FeCl3 stop solution, mix well, centrifuge at 8000g for 5 min, collect the supernatant, and measure the absorbance of the supernatant at 540 nm using an ELISA reader. Plot the glutamate content as the x-axis. 540nm Use absorbance values as the ordinate to plot a standard curve.
[0081] 2.2 Determination of glutamic acid content in the sample
[0082] Take three 2mL centrifuge tubes and add 0.3mL of 0.5mol / L imidazole-hydrochloric acid (pH 7.6), 0.1mL of 0.5mol / L MgSO4, 0.2mL of 30mmol / L ATP-Na2, and 0.2mL of TaGS1;3 crude enzyme solution to the centrifuge tubes respectively; add 0.2mL of deionized water to the first centrifuge tube as a blank control; dilute the test sample 5 times and 10 times respectively, and add 0.2mL of the diluted test sample to the other two centrifuge tubes respectively, and make up the reaction system to 1.2mL with deionized water.
[0083] Incubate at 37℃ for 5 min, add 0.1 mL of 1 mol / L hydroxylamine reagent and react at 37℃ for 30 min; after the reaction is complete, add 0.5 mL of FeCl3 stop solution, mix well, centrifuge at 8000g for 5 min, take the supernatant, and measure the absorbance of the supernatant at 540 nm using an ELISA reader. Substitute the absorbance value into the standard curve to calculate the glutamic acid content.
[0084] 3. Determination of glutamate content based on HPLC
[0085] Take 2 mL centrifuge tubes and add 0.3 mL of 0.5 mol / L imidazole-hydrochloric acid (pH 7.6), 0.1 mL of 0.5 mol / L MgSO4, 0.2 mL of 30 mmol / L ATP-Na2, 0.2 mL of TaGS1;3 crude enzyme solution, and 0.2 mL of the sample to be tested. Replace the crude enzyme solution with a crushing buffer as a blank control, and level the reaction system to 1.2 mL with deionized water.
[0086] Incubate at 37℃ for 5 min, add 0.1 mL of 1 mol / L hydroxylamine reagent and react at 37℃ for 30 min; after the reaction is complete, incubate in a 96℃ water bath for 5 min, centrifuge at 10000 rpm for 10 min, take the supernatant, flash freeze in liquid nitrogen and store at -80℃, and determine the glutamic acid content in the reaction by HPLC.
[0087] 4. Results and Analysis
[0088] 4.1 Screening for optimal catalytic temperature of TaGS1;3 enzyme
[0089] The effect of different temperatures on the catalytic activity of TaGS1;3 enzyme is shown in the figure. Figure 1 .
[0090] Depend on Figure 1 It was found that within a temperature gradient range of 0-40℃, its catalytic activity exhibited a significant temperature-dependent change. When the reaction system temperature gradually increased from 0℃ to 40℃, the enzyme activity showed a positive response to temperature increase, reaching its peak catalytic activity at 40℃. Notably, when the temperature exceeded this critical value, the enzyme activity showed a sharp decline, indicating that high temperatures caused irreversible denaturation of the enzyme protein structure. Based on the above experimental results, this study determined that the optimal catalytic temperature for TaGS1;3 is approximately 40℃.
[0091] However, it is worth noting that 37℃ was chosen as the standard reaction temperature in the subsequent experimental design. This decision was based on the following dual considerations: First, 37℃ is the optimal temperature for inducing the expression of this enzyme protein. Under this temperature condition, the host strain maintains its optimal physiological state, enabling efficient expression of TaGS1;3. Second, although the in vitro catalytic activity is slightly higher at 40℃, the enzyme activity at 37℃ still maintains more than 90% of its peak activity. By comprehensively balancing the enzyme protein expression efficiency and in vitro catalytic activity, 37℃ was ultimately determined as the optimal reaction temperature for the experimental system.
[0092] 4.2 Interference of amino acids and amino acid mixtures on the catalytic activity of TaGS1;3 enzyme
[0093] This study investigated the regulatory effects of different amino acid components on the TaGS1;3-catalyzed reaction of glutamate and hydroxylamine to synthesize GMH. The inhibitory effects of 20 amino acids on the catalytic activity of TaGS1;3 enzyme are shown in [reference needed]. Figure 2 The inhibitory effect of a mixture of 19 amino acids on the catalytic activity of TaGS1;3 enzyme is shown in [the table below]. Figure 3 .
[0094] Depend on Figure 2 It was found that when 20 amino acids were added individually, only glutamic acid showed a specific activating effect. Specifically, when low or high concentrations of glutamic acid were added exogenously, the catalytic activity of TaGS1;3 enzyme increased by 10.91% and 20.43%, respectively, while the addition of the other 19 amino acids did not show significant activation or inhibition effects.
[0095] Depend on Figure 3It was found that in reaction systems containing different concentrations of glutamate (0-10 mM), when 19 mixed amino acids (excluding glutamate) were added simultaneously, the catalytic activity of TaGS1;3 enzyme still exhibited a typical substrate concentration-dependent growth curve. Furthermore, the absorbance values measured at each concentration gradient were highly consistent with those of the treatment without added exogenous amino acids, with differences all less than 10%. This indicates that the mixed amino acid composition has little effect on the binding characteristics of the enzyme to the substrate, further confirming the high specificity of TaGS1;3 for the substrate glutamate.
[0096] 4.3 Determination of glutamate content based on TaGS1;3 enzyme
[0097] The constructed standard curve of glutamate concentration gradient is shown below. Figure 4 .
[0098] Depend on Figure 4 A quantitative detection system for TaGS1;3 enzyme activity was successfully established. Data showed that enzyme activity and substrate concentration exhibited an excellent linear relationship within the test range, with the regression equation being y = 0.0262x - 0.0007, R0. 2 The value of 0.9986 indicates that the detection system has high reliability.
[0099] To verify the accuracy of the method, this study used HPLC-calibrated samples for cross-validation: the standard was diluted 5-fold and 10-fold and used as substrates for the reaction. Absorbance values of 0.0345 and 0.01575 were detected at 540 nm, respectively. Based on the standard curve equation, the corresponding glutamate concentrations were 1.342 mmol / L and 0.637 mmol / L, respectively. Compared with the direct HPLC measurements of 1.334 mmol / L and 0.667 mmol / L, the relative deviations were only 0.598% and 4.601%. It is particularly noteworthy that the absolute differences between the results obtained by the two detection methods were 0.008 mmol / L and 0.030 mmol / L, respectively, both within the allowable range of instrumental analysis error. This series of data fully demonstrates that the glutamate quantification method established based on the TaGS1;3 enzyme activity detection system is equivalent to the classical HPLC detection method, providing reliable technical support for subsequent research.
[0100] In summary, this application reveals the catalytic characteristics and application potential of the TaGS1;3 enzyme through a multi-dimensional experimental system. First, the temperature adaptability and substrate specificity of the TaGS1;3 enzyme are elucidated, demonstrating a high degree of consistency with HPLC detection methods in cross-validation experiments. Second, the method for detecting glutamate content in this invention is significantly superior to other glutamate dehydrogenase detection methods, such as GDH, which is often interfered with by α-ketoglutarate. Furthermore, this method requires no complex sample pretreatment or expensive instruments, with a single detection cost approximately 10% of that of HPLC, and offers high throughput. Therefore, based on the unique catalytic characteristics of TaGS1;3 glutamine synthase, this application has successfully constructed an efficient, economical, and highly specific method for the quantitative detection of glutamate.
[0101] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.
Claims
1. An application of a glutamine synthetase isozyme TaGS1;3 in detecting glutamate content, characterized in that: The amino acid sequence of the glutamine synthetase isozyme TaGS1;3 is shown in Table SEQ ID No.
1.
2. A method for detecting glutamate content based on glutamine synthetase isozyme TaGS1;3, characterized in that: The following steps are involved: S1. Draw a standard curve To multiple centrifuge tubes, 0.3 mL of imidazole-hydrochloric acid solution, 0.1 mL of MgSO₄ solution, 0.2 mL of ATP-Na₂ solution, and 0.2 mL of TaGS₁₃ crude enzyme solution were added. Furthermore, different amounts of glutamate were added to the corresponding centrifuge tubes to achieve final concentrations of 0 mM, 0.25 mM, 0.5 mM, 0.75 mM, 1.0 mM, 1.5 mM, and 2.0 mM, respectively. The reaction system was then filled to 1.2 mL with deionized water. Incubate at 37°C for 5 minutes, add 0.1 mL of hydroxylamine reagent and react at 37°C for 30 minutes, add 0.5 mL of FeCl3 stop solution, mix well, and centrifuge at 8000g for 5 minutes; measure the supernatant A with a microplate reader 540nm Absorbance value; glutamate content is the horizontal axis, A 540nm The absorbance value is the ordinate, and the standard curve is drawn; S2. Determination of glutamate content in the sample To multiple centrifuge tubes, add 0.3 mL of imidazole-hydrochloric acid solution, 0.1 mL of MgSO4 solution, 0.2 mL of ATP-Na2 solution, and 0.2 mL of TaGS1;3 crude enzyme solution. Dilute the test sample 5-fold and 10-fold, respectively, and add 0.2 mL of the diluted test sample to different centrifuge tubes. Use 0.2 mL of deionized water in the centrifuge tube as a blank control. Incubate at 37°C for 5 minutes, add 0.1 mL of hydroxylamine reagent and react at 37°C for 30 minutes, add 0.5 mL of FeCl3 stop solution, mix well, and centrifuge at 8000g for 5 minutes; measure the supernatant A with a microplate reader 540nm Absorbance value; A 540nm The absorbance value was brought into the standard curve to calculate the glutamate content.
3. The method according to claim 2, characterized in that In steps S1 and S2, the concentrations of the imidazole-hydrochloric acid solution, MgSO4 solution, ATP-Na2 solution and hydroxylamine reagent are 0.5 mol / L, 0.5 mol / L, 30 mmol / L and 1 mol / L, respectively.
4. The method according to claim 2, characterized in that In steps S1 and S2, the final FeCl3 solution is prepared by mixing equal volumes of 0.37 mol / L FeCl3 solution, 1.47 mol / L trichloroacetic acid solution and 50% HCl solution.
5. The method according to claim 2, characterized in that In steps S1 and S2, the method for preparing the TaGS1;3 crude enzyme solution comprises the following steps: a. TaGS1;3 clone Yumai 49-198 grain samples were collected and ground with liquid nitrogen. Total RNA was extracted and reverse transcribed to obtain the corresponding cDNA. Specific primers were designed based on the TaGS1;3 sequence, and PCR amplification was performed using the cDNA as a template. The amplified product was purified. The purified DNA fragment was linked to the T vector and heat-shocked to transform DH5α competent Escherichia coli cells. After resistance screening and sequencing verification, the correct strain for sequencing was saved. b. Construction of prokaryotic expression vector Based on the CDS sequence of TaGS1;3, seamless cloning primers were designed. PCR amplification was performed using the TaGS1;3 T vector as a template. The amplified product was purified and the pET-21a-TaGS1;3 recombinant vector was constructed. The correctly sequenced recombinant vector was transformed into Rosetta (DE3) pLysS Escherichia coli competent cells. After resistance screening and sequencing verification, the correctly sequenced strain was preserved. c. TaGS1;3 prokaryotic expression Take the Rosetta (DE3) pLysS bacterial solution containing the pET-21a-TaGS1;3 recombinant vector and inoculate it into LB liquid medium. Incubate it at 37°C and 220 r / min for activation overnight. Inoculate the activated bacterial solution into LB liquid medium and expand it at 37°C and 220 r / min until the OD 600 When the value was 0.6, IPTG was added to a final concentration of 1 mmol / L, and the expression was induced at 37°C for 5 h. The cells were collected by centrifugation at 8000 g for 5 min at 4°C; d. Collection of TaGS1;3 crude enzyme solution Resuspend the cells in disruption buffer, add PMSF to a final concentration of 1 mmol / L, disrupt the cells under high pressure on ice until the bacterial solution is clear, centrifuge at 4°C, 12000 rpm for 25 min, and collect the supernatant as the TaGS1;3 crude enzyme solution.
6. The method according to claim 5, characterized in that In step a, the specific primers are specifically TaGS1;3-S and TaGS1;3-A, and their base sequences are shown in the sequence listing SEQ ID No. 2 and SEQ ID No. 3, respectively.
7. The method according to claim 5, characterized in that In step b, the seamless cloning primers are specifically E-TaGS1;3-S and E-TaGS1;3-A, and their base sequences are shown in SEQ ID No. 4 and SEQ ID No. 5 in the sequence listing.
8. Use of the method according to any one of claims 2 to 5 in detecting glutamate content.