Cordyceps militaris double gene knockout engineering strain CM0207 and application thereof in improving cordycepin content of cordyceps militaris

Abstract

The present application belongs to the field of molecular genetics and breeding of large filamentous fungi, and particularly relates to a double-gene knockout engineering strain of Cordyceps militaris CM0207 , a preparation method thereof and application of the double-gene knockout engineering strain in improving the content of cordycepin in Cordyceps militaris C. militaris . The present application provides a double-gene knockout engineering strain of Cordyceps militaris CM0207 , which is obtained by simultaneously or sequentially performing directional inactivation on adenosine deaminase related isozyme genes CCM_02911 (ada02) and CCM_07169 (ada07) of a starting strain of Cordyceps militaris; the engineering strain is Δ ada02 Δ ada07 . The present application also simultaneously provides application of the double-gene knockout engineering strain of Cordyceps militaris CM0207 in the production of cordycepin. The engineering strain obtained by the present application can be used in liquid fermentation production or solid cultivation application for improving the content of cordycepin in Cordyceps militaris.

Description

Technical Field

[0001] This invention pertains to molecular genetic breeding of large filamentous fungi, and specifically relates to the double-gene knockout engineered strain CM0207 of Cordyceps militaris and its application in increasing the cordycepin content of Cordyceps militaris. Background Technology

[0002] Cordyceps militaris, an important medicinal and edible fungus, is rich in nucleoside active ingredients such as cordycepin and has attracted widespread attention in the fields of functional foods and biopharmaceutical raw materials. However, the metabolic network of Cordyceps militaris is complex, and the intracellular distribution of cordycepin may be affected by the action of related nucleoside metabolic enzymes, leading to limited accumulation levels. Increasing the content of Cordyceps militaris and obtaining strains and breeding methods with high cordycepin production are essential requirements for high-quality Cordyceps militaris to meet the needs of stable high-content raw materials and large-scale production.

[0003] In existing technologies, mutagenesis, protoplast fusion, and genetic engineering are commonly used breeding methods. However, Cordyceps militaris exhibits host specificity, mycelial growth, fruiting body formation, and complex metabolism. Mutagenesis or protoplast fusion alone cannot easily meet the needs of rapid breeding, and these methods are time-consuming and genetically unstable, resulting in less than ideal results. With the advancement of biotechnology, molecular breeding techniques, such as protoplast transformation or Agrobacterium tumefaciens-mediated transformation (ATMT), have been adopted. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a double gene knockout engineered strain of Cordyceps militaris CM0207 and its application in increasing the cordycepin content of Cordyceps militaris.

[0005] To address the aforementioned problems, this invention provides a double-gene knockout engineered strain CM0207 from Cordyceps militaris. This engineered strain is obtained by simultaneously or sequentially inactivating the adenosine deaminase-related isoenzyme genes CCM_02911 (ada02) and CCM_07169 (ada07) from a Cordyceps militaris starting strain. The engineered strain is Δada02Δada07.

[0006] As an improvement to the Cordyceps militaris double gene knockout engineered strain CM0207 of the present invention: the key coding regions of CCM_02911 and CCM_07169 in the genome are both destroyed and inactive; the inactivation includes, but is not limited to: deletion, insertion, substitution or frameshift mutation of the coding region of the gene, or replacement by exogenous expression cassette, thereby resulting in loss of function of the corresponding gene product; the inactivation can be identified by PCR verification and / or sequencing verification across the integration site.

[0007] As a further improvement to the Cordyceps militaris double gene knockout engineered strain CM0207 of the present invention: the full-length coding region nucleotide sequence of the CCM_02911 gene is shown in SEQ ID No.1, and the full-length coding region nucleotide sequence of the CCM_07169 gene is shown in SEQ ID No.2.

[0008] As a further improvement to the Cordyceps militaris double gene knockout engineered strain CM0207 of the present invention: the key coding region of the CCM_02911 site was replaced by the bar expression cassette, and the key coding region of the CCM_07169 site was replaced by the hph expression cassette.

[0009] This invention also provides a method for preparing the above-mentioned Cordyceps militaris double-gene knockout engineered strain CM0207, characterized by comprising the following steps:

[0010] 1) Construction of the first target gene ada02 knockout strain (Δada02)

[0011] S11. Using the genomic DNA of the Cordyceps militaris strain as a template, amplify the upstream and downstream homologous arms of the first target gene CCM_02911 (ada02), place the first selection marker gene expression cassette between the two homologous arms, and construct the first gene knockout vector or linear knockout fragment.

[0012] S12. The first gene knockout vector is introduced into Agrobacterium competent cells to obtain Agrobacterium carrying the knockout vector; and co-cultured with Cordyceps militaris spores or hyphae under induction conditions containing acetosyringone (AS) to allow the knockout fragment to be integrated into the genome through homologous recombination.

[0013] S13. Screen transformants on selective medium containing screening agent and identify the Δada02 knockout strain that is inactivated by CCM_02911 (by at least one of colony PCR and / or sequencing), that is, obtain the first gene knockout strain (Δada02).

[0014] 2) Obtaining the double knockout strain CM0207 (Δada02Δada07)

[0015] S21. Using the Δada02 knockout strain as a recipient, amplify the upstream and downstream homologous arms of the second target gene CCM_07169, place the second selection marker gene expression cassette between the two homologous arms, and construct the second gene knockout vector or linear knockout fragment.

[0016] S22. The second gene knockout vector is introduced into Agrobacterium competent cells and co-cultured with Cordyceps militaris spores or hyphae under acetylsyringone-containing induction conditions, so that the knockout fragment is integrated into the genome through homologous recombination.

[0017] S23. Screen transformants on selective medium containing screening agent and identify the double gene knockout engineered strain CM0207 (Δada02Δada07) obtained (by at least one of colony PCR and / or sequencing).

[0018] That is, using Δada02 as the recipient, a second target gene (ada07) knockout vector is constructed using the same or equivalent strategy as in steps S11-S13, and then transformed and screened by ATMT to inactivate CCM_07169, thereby obtaining the double gene knockout engineered strain CM0207 (Δada02Δada07).

[0019] As an improvement to the method of the present invention:

[0020] The screening markers are recycled or removed to achieve marker reuse. The recycling or removal is carried out using Cre / loxP, FLP / FRT or homologous recombination self-excision method.

[0021] Targeted inactivation employs a homologous recombination substitution strategy, using a selection marker gene expression cassette to replace the key coding region of the target gene, thereby inactivating the target gene; the selection marker gene is the bar gene and / or the hph gene.

[0022] That is, knockout employs a homologous recombination substitution strategy, using screening marker genes (preferably bar genes and / or hph genes) to replace the key coding regions of the target gene, thereby inactivating the target gene.

[0023] The selection marker gene expression cassette includes a fungal promoter, a selection marker gene coding sequence, and a terminator.

[0024] As a further improvement to the method of the present invention:

[0025] The homologous arms are 0.8~1.6 kb in length (preferably 1.2~1.5 kb); the two homologous arms are located on the flanking regions of the 5′ and 3′ ends of the target gene, respectively.

[0026] Specifically:

[0027] The sequence of the upstream homologous arm of CCM_02911 (the upstream homologous fragment 02-5' of ada02) is shown in SEQ ID NO:3;

[0028] The sequence of the downstream homologous arm of CCM_02911 (downstream homologous fragment 02-3' of ada02) is shown in SEQ ID NO:4;

[0029] The sequence of the upstream homologous arm (ada07 upstream homologous fragment 07-5′) of CCM_07169 is shown in SEQ ID No. 7;

[0030] The sequence of the downstream homologous arm (downstream homologous fragment 07-3′ of ada07) of CCM_07169 is shown in SEQ ID No. 8.

[0031] As a further improvement to the method of the present invention:

[0032] The co-culture temperature for Agrobacterium-mediated transformation (ATMT) is 20–28°C (preferably 23–28°C); the co-culture time is 4–6 days.

[0033] When the screening label is bar, the screening agent is glufosinate-ammonium (PPT), and its final concentration is 300~800 μg / mL (preferably about 400 μg / mL).

[0034] When the screening marker is hph, the screening agent is hygromycin B, and its final concentration is 50~600 μg / mL (the preferred range can be determined according to the sensitivity of the recipient strain, for example, preferably 200~600 μg / mL, more preferably about 400 μg / mL).

[0035] As a further improvement to the method of the present invention:

[0036] The selection medium contains an antibiotic for inhibiting Agrobacterium (preferably cefotaxime 200-600 μg / mL, more preferably about 400 μg / mL).

[0037] This invention also provides the application of the above-mentioned Cordyceps militaris double gene knockout engineered strain CM0207 in cordycepin production.

[0038] This invention provides a method for producing cordycepin and / or related nucleoside metabolites. The engineered strain CM0207 is inoculated into a liquid or solid culture medium and cultured. The mycelium and / or fermentation broth obtained from fermentation are collected, and the cordycepin and / or related nucleoside metabolites therein are extracted or enriched to obtain cordycepin and / or related nucleoside metabolites. Specifically, CM0207 is used for liquid fermentation culture, the mycelium obtained from fermentation is collected, and the cordycepin content is detected; or CM0207 is used for solid-state cultivation culture to obtain cultivated products.

[0039] This invention, based on ATMT technology, addresses the need to enhance the activity of cordycepin in bacterial strains. It involves genetic modification by knocking out adenosine deaminase-related isoenzyme genes, successfully obtaining strains with double gene knockout and increased cordycepin content. These strains were validated through bottle and pot cultivation experiments, yielding high-yielding cordycepin-producing strains suitable for commercial cultivation. Therefore, this invention represents a reproducible, efficient, and easily scalable molecular breeding strategy for obtaining engineered Cordyceps militaris strains with increased cordycepin content, enabling their application in fermentation production or cultivation practices.

[0040] This invention knocks out specific genes to increase the content of metabolic bioactive functional products; specifically, this invention relates to the molecular genetic breeding modification of Cordyceps militaris, knocking out adenosine deaminase-related isoenzyme genes, increasing the content of cordycepin in Cordyceps militaris, thereby improving the level of active ingredients in Cordyceps militaris-related products, and the application of the bred strains in production fermentation engineering or cultivation technology.

[0041] In summary, this invention provides a molecular breeding method for Cordyceps militaris, which obtains breeding strains with increased cordycepin content through targeted genetic modification of specific target genes, and provides the application of these strains in fermentation production or cultivation practices to improve the levels of active ingredients such as cordycepin in related products.

[0042] This invention provides a molecular breeding method for increasing cordycepin content in Cordyceps militaris: using a Cordyceps militaris strain as the recipient, the adenosine deaminase-related isoenzyme genes ada02 and ada07 are directionally inactivated (preferably knocked out sequentially) to obtain a dual-gene engineered strain CM0207 (Δada02Δada07); this strain is then used for liquid fermentation to obtain a solid sample of fermented mycelium with increased cordycepin content (mycelium obtained from liquid fermentation), preferably for liquid fermentation production. Corresponding culture products or cultivated products can also be obtained under other culture methods (such as solid-state cultivation), but the cordycepin level is affected by conditions such as culture medium formulation, temperature, light, and culture cycle, and can be further optimized according to production needs. The dual-gene knockout engineered strain is obtained by sequentially knocking out two target genes related to cordycepin metabolism in Cordyceps militaris or its homologous strains.

[0043] Compared with the original strain, the double-gene knockout strain CM0207 obtained in this invention exhibits a phenotype with increased cordycepin content under specific culture conditions, specifically:

[0044] Under liquid fermentation conditions, samples were taken from days 5 to 25 of cultivation. The fermented mycelium was collected as a solid sample and quantified by HPLC. The quantitative detection method is not limited to HPLC; conventional methods in the field such as UPLC and LC-MS / MS can also be used. Results are expressed in mg / kg. Within the above detection window, the cordycepin content in CM0207 mycelium showed an increase; for example, on day 25 of cultivation, CM0207 was 2570.54 mg / kg, and WT was 2209.06 mg / kg. During liquid fermentation, cordycepin (expressed in mg / mL) was also detected in the culture medium, indicating that cordycepin can be distributed in the extracellular medium and mycelium. The distribution of cordycepin at different time points and in different sample forms is affected by culture conditions, including but not limited to culture medium formulation, aeration / shaking rate, temperature, and culture period. The detection results of cordycepin in the culture medium are used to describe the product distribution morphology and are not considered as limiting indicators of increased cordycepin content.

[0045] Therefore, the molecular breeding method and the obtained strains provided by this invention can be used for fermentation production or cultivation applications to increase the cordycepin content of Cordyceps militaris.

[0046] The beneficial effects of this invention are mainly reflected in:

[0047] (1) This invention establishes a targeted molecular breeding method for Cordyceps militaris, which adopts a technical route combining homologous recombination substitution and Agrobacterium-mediated transformation, and can achieve the sequential knockout of ada02 and ada07, which has clearness, operability and good reproducibility;

[0048] (2) The present invention obtained a double gene knockout engineered strain CM0207 (Δada02Δada07), which showed an increased cordycepin content under specific culture conditions; for example, on the 25th day of liquid fermentation culture, the cordycepin content of its mycelium was 2570.54 mg / kg, which was higher than the 2209.06 mg / kg of the starting strain WT.

[0049] (3) The engineered strains obtained in this invention can be used for liquid fermentation production or solid cultivation applications to increase the cordycepin content of Cordyceps militaris, and have good application prospects. Attached Figure Description

[0050] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0051] Figure 1 Agarose gel electrophoresis verification image of inserting the 02-3′ homologous arm fragment into the pPk2-bar-GFP-b plasmid vector.

[0052] Figure 2Electrophoresis image of colony PCR verification of the recombinant ada02 knockout vector in E. coli DH5α.

[0053] Figure 3 Electrophoresis image of colony PCR verification of Agrobacterium AGL1 transformed with the recombinant ada02 knockout vector.

[0054] Figure 4 Electrophoresis diagram of PCR identification of the ada02 single-gene knockout Cordyceps militaris transformant.

[0055] Figure 5 Agarose gel electrophoresis image of the validation of inserting the 07-5' fragment into the pPk2-hyg-GFP-b plasmid vector.

[0056] Figure 6 Electrophoresis image of E. coli DH5a (left) and Agrobacterium AGL1 (right) transformants transformed with the recombinant pPk2-hyg-GFP-b-07 knockout plasmid for PCR verification.

[0057] Figure 7 Electrophoresis image for PCR identification of the Cordyceps militaris double gene knockout transformant at the ada02 site.

[0058] Figure 8 Electrophoresis image of PCR identification of the Cordyceps militaris double gene knockout transformant at the ada07 site. Detailed Implementation

[0059] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto. Unless otherwise stated, the reagents used in the present invention are all conventional commercial reagents, and those skilled in the art can make equivalent substitutions as needed.

[0060] Example 1: Construction of the first target gene ada02 knockout strain (Δada02)

[0061] The full-length coding region (CDS) nucleotide sequence of CCM_02911 (ada02) is as described in SEQ ID No. 1.

[0062] 1. Primer design

[0063] The 1300 bp fasta sequences upstream and downstream of the open reading frame (OPF) of the *Cordyceps militaris* CM01 strain CCM_02911 gene (GeneID: 18164938) were obtained from the NCBI website, and the restriction enzyme sites of the amplified target fragment sequence were detected using the NEBcutter 3.0 website. Primers for the upstream homologous arm of ada02 (02911 5-1 / 5-2) and the downstream homologous arm (02911 3-1 / 02911 3-2) were designed using SnapGene software, and corresponding restriction enzyme sites were added to the primers. The upstream homologous fragment was designated 02-5', and its upstream and downstream primers were designed with Xba I and EcoRI restriction enzyme sites and corresponding protective bases, respectively. The downstream homologous fragment was designated 02-3', and its upstream and downstream primers were designed with EcoRI V and Spe I restriction enzyme sites and corresponding protective bases, respectively.

[0064] 02911 3-1: GGACTAGTGTGGTATGGTCGTGGATGGTTG

[0065] 02911 3-2: CGGATATCGAGCGCTTCCTCAATGATCACG

[0066] 02911 5-1:TCTAGAAGCAACTGGAAGATTTGGAG

[0067] 02911 5-2:GAATTCTCTATGTAGGGAGGACTGGGAG.

[0068] 2. Homologous fragment amplification

[0069] The template used for amplifying homologous fragments was Cordyceps militaris genomic DNA. The Cordyceps militaris strain was the original experimental strain *Cordyceps militaris*, kindly provided by Shenyang Normal University. This *Cordyceps militaris* strain was described in the paper "Identification of differential proteins in *Cordyceps militaris* cultured with different nitrogen sources via proteomic analysis".

[0070] The Cordyceps militaris genomic DNA was extracted using a conventional method, specifically: 100 μL of freshly prepared spore suspension (concentration 1×10⁻⁶) was used. 7Inoculate 100 mL of SDY liquid medium with mycelia (number of mycelia / mL) and culture at 23±2 ℃ and 220 rpm for 3 days with shaking. Collect the mycelia and transfer them to a pre-cooled liquid nitrogen mortar, and grind them into a fine powder in liquid nitrogen. Take an appropriate amount of powder (about 300 mg) and place it in a 1.5 mL centrifuge tube, add 400 μL of DNA lysis buffer and mix well, then add an equal volume of pH 7.0 balanced phenol solution, shake to extract, and centrifuge at 12000 rpm for 10 min at room temperature. Take 350 μL of supernatant and transfer it to a new centrifuge tube, add 5 μL of RNase, and incubate in a 37 ℃ water bath for 1 h. Add an equal volume of balanced phenol solution and centrifuge at 12000 rpm for 10 min at room temperature. Take 300 μL of supernatant and transfer it to a new centrifuge tube, add 2.5 times the volume of anhydrous ethanol, incubate at -20 ℃ for 30 min, then centrifuge at 14000 rpm at room temperature for 10 min, discard the supernatant, and add 300... Wash the precipitate with μL of 70% ethanol and centrifuge for 2 min under the same conditions, then discard the ethanol. Place the open centrifuge tube in a 37 ℃ oven to dry for about 1 h to allow the ethanol to evaporate completely. Finally, add an appropriate amount of ddH2O to dissolve the DNA precipitate. The resulting solution is Cordyceps militaris genomic DNA.

[0071] Using Cordyceps militaris genomic DNA as a template, the upstream homologous fragment 02-5' of ada02 was amplified using primer pairs 02911 5-1 / 02911 5-2; and the downstream homologous fragment 02-3' of ada02 was amplified using Cordyceps militaris genomic DNA as a template using primer pairs 02911 3-1 / 02911 3-2.

[0072] The PCR system consisted of 25 μL 2×PhantaMax Master Mix (Dye Plus), 2 μL upstream primer, 2 μL downstream primer, 2 μL template, and ddH2O to a final volume of 50 μL. The PCR conditions were: 95 ℃ for 3 min; 95 ℃ for 30 s, 53 ℃ for 30 s, 72 ℃ for 90 s, for 30 cycles; and 72 ℃ for 5 min. All PCR products were subjected to agarose gel electrophoresis. After confirming correct band size, the fragments were purified and recovered using a column gel DNA recovery kit. The concentration of the purified DNA solution was determined using a NanoDrop spectrophotometer and stored at -20 ℃.

[0073] The sequence of the upstream homologous fragment 02-5' of ada02 is as described in SEQ ID NO:3.

[0074] The downstream homologous fragment 02-3' of ada02 is as described in SEQ ID NO:4.

[0075] 3. Amplified homologous fragments, digestion, ligation, and transformation with pPk2-bar-GFP-b vector.

[0076] The 02-3' fragment and the pPk2-bar-GFP-b vector were double-digested with EcoRV and SpeI, respectively.

[0077] The double digestion system for the 02-3' fragment is as follows: 25 μL of purified and recovered fragment (the homologous fragment 02-3' downstream of ada02), 1 μL of restriction endonuclease EcoRV, 1 μL of restriction endonuclease Spe I, 5 μL of 10×Flycut Buffer, and ddH2O to a final volume of 50 μL;

[0078] The double digestion system for pPk2-bar-GFP-b plasmid is as follows: 43 μL pPk2-bar-GFP-b plasmid (i.e., pPK2-bar-GFP), 1 μL restriction endonuclease EcoRV, 1 μL restriction endonuclease Spe I, and 5 μL 10×Flycut Buffer.

[0079] After brief centrifugation, the enzyme digestion system was incubated at 37°C for 3 h in a PCR instrument. All enzyme digestion products were subjected to agarose gel electrophoresis. Once the bands were correctly displayed, the DNA was purified using a column gel DNA recovery kit, and the concentration of the recovered product was determined using NanoDrop. The 02-3' fragment, double-digested with EcoRV and SpeI and recovered via gel electrophoresis, was ligated with the linearized pPk2-bar-GFP-b vector at 22°C for at least 3 h using T4 DNA Ligase. The ligation reaction mixture consisted of 100–150 ng of linearized pPk2-bar-GFP-b plasmid, 0.2 μL of T4 DNA Ligase, 1 μL of 10×T4 DNA Ligase Buffer, and the restriction endonuclease-treated 02-3' fragment, brought to a final volume of 10 μL.

[0080] 4. Transformation of E. coli by enzyme-linked products

[0081] After thawing E. coli DH5α competent cells on ice, 10 μL of the enzyme ligation product (obtained in step 3 above) was added and gently mixed by pipetting. The mixture was then placed on ice for 30 min, followed by a 90 s heat shock at 42 °C. Immediately after heat shock, the centrifuge tubes were returned to ice for 5 min to cool, then 1 mL of LB broth was added and the cells were incubated at 37 °C and 200 rpm for 1 h. The cells were collected by centrifugation at 5000 rpm for 5 min at room temperature. Most of the supernatant was carefully discarded, and the cell pellet was resuspended in the remaining culture medium. The pellet was then evenly spread on LB agar plates containing 50 μg / mL kanamycin and incubated overnight at 37 °C.

[0082] 5. Identification and sequencing of positive transformants

[0083] Take the kanamycin-containing LB agar plate obtained in step 4 above, cultured overnight, and pick a single colony with a toothpick into a PCR tube. Perform colony PCR identification using primers CP-1 / CP-2. The transformant verification PCR system consisted of 10 μL 2×Taq MasterMix (Dye plus), 1 μL CP-1, 1 μL CP-2, a small number of single colonies as template, and ddH2O to a final volume of 20 μL. The PCR reaction conditions were: 95 ℃ for 3 min; 95 ℃ for 30 s, 53 ℃ for 1 min, 72 ℃ for 3 min, 30 cycles; 72 ℃ for 5 min. The PCR products were identified and analyzed by 1% agarose gel electrophoresis. The results of the vector recombinant colony PCR identification are as follows: Figure 1 As shown (primer pair: CP-1 / CP-2).

[0084] Positive bacteria with expected electrophoretic band sizes were selected for sequencing analysis. Sequencing results showed that transformants with correct insertion direction, correct linkage sites, and no base deletions, insertions, or mutations were identified as correct recombinant transformants. Transformants with correct sequencing results were inoculated into 3 mL LB medium (containing 50 μg / mL kanamycin) and cultured overnight at 37 ℃ and 200 rpm. 50% glycerol was added at a 1:1 ratio, mixed well, and stored at -80 ℃ for later use. The resulting transformant was named pPk2-bar-GFP-b-02-3'.

[0085] CP-1: TATTACGCCAGCTGGCGAA

[0086] CP-2: ATGGGGATGAGGGCAATTGG

[0087] Figure 1 Colony PCR electrophoresis verification image after inserting the 02-3′ homologous arm fragment into the pPk2-bar-GFP-b plasmid vector. Figure 1 In the diagram, lane M represents the DNA molecular weight standard; lanes 1, 4, and 5 showed the target bands at the expected positions, while lanes 2 and 3 did not show any bands that clearly met the expectations. The results indicate that recombinant plasmids containing the 02-3′ homologous arm insert fragment were successfully obtained from some transformants; after further sequencing confirmation, the recombinant plasmid pPk2-bar-GFP-b-02-3′ was obtained.

[0088] 6. Extraction of pPk2-bar-GFP-b-023' plasmid

[0089] The transformed cells (pPk2-bar-GFP-b-02-3' obtained in step 5) were streaked onto LB agar plates (containing 50 μg / mL kanamycin). After culturing for 12 h, a single colony was picked and inoculated into 50 mL LB medium (containing 50 μg / mL kanamycin) and cultured overnight at 37 ℃ and 200 rpm. The pPk2-bar-GFP-b-02-3' plasmid was extracted using the Simmgem rapid plasmid DNA extraction kit, and the extracted plasmid DNA solution was stored at -20 ℃.

[0090] 7. Amplified fragment 02-5' was digested and ligated with the pPk2-bar-GFP-b-02-3' vector.

[0091] The 02-5' fragment and the pPk2-bar-GFP-b-02-3' vector were double-digested with Xba I and EcoRI, respectively. The digestion system is as described in step 3.

[0092] Right now:

[0093] The double digestion system for the 02-5' fragment is as follows: 25 μL of purified and recovered fragment (02-5', the homologous fragment downstream of ada02), 1 μL of restriction endonuclease EcoR I, 1 μL of restriction endonuclease Xba I, 5 μL of 10×Flycut Buffer, and ddH2O to a final volume of 50 μL;

[0094] The double digestion system for pPk2-bar-GFP-b-02-3' plasmid is as follows: 43 μL pPk2-bar-GFP-b-02-3' plasmid, 1 μL restriction endonuclease EcoR I, 1 μL restriction endonuclease Xba I, and 5 μL 10×Flycut Buffer.

[0095] After brief centrifugation of the enzyme digestion system, the cells were incubated in a PCR instrument at a constant temperature for 3 h. All enzyme digestion products were subjected to agarose gel electrophoresis. Once the bands were correctly displayed, the DNA was purified and recovered using a column gel DNA recovery kit. The concentration of the recovered product was determined using NanoDrop. The 02-5' fragment, which had been double-digested with Xba I and EcoRI and recovered via gel electrophoresis, was ligated with the linearized pPk2-bar-GFP-b-02-3' vector at 22 °C for at least 3 h (overnight is acceptable) using T4 DNA Ligase.

[0096] 8. E. coli transformation and identification and sequencing of positive transformants

[0097] The transformation of *E. coli* and identification of positive transformants were performed according to steps 4 and 5. The 02-5′ homologous fragment was ligated into the linearized pPk2-bar-GFP-b-02-3′ vector, and then transformed into *E. coli* DH5α competent cells. The cells were plated on LB agar containing 50 μg / mL kanamycin and incubated overnight at 37 °C. Single colonies were picked and identified by colony PCR using primer pairs CP-1 / CP-2. The pPk2-bar-GFP-b-02-3′ plasmid was used as a negative control. The colony PCR electrophoresis results are shown below. Figure 2 As shown. Figure 2 The *E. coli* transformants of the ada02 knockout plasmid shown in lanes 1-3 of the middle swim swab are the transformants obtained by transforming *E. coli* DH5α after inserting the 02-5′ homologous fragment into the pPk2-bar-GFP-b-02-3′ vector in this step. Positive transformants with expected electrophoretic band sizes were selected for sequencing analysis. Sequencing results showed that the nucleotide sequence of the newly inserted 02-5′ homologous arm in the recombinant plasmid was consistent with the sequence shown in SEQ ID NO:4, and the insertion direction, linkage site, and absence of base deletions, insertions, or mutations were correct. The correctly sequenced transformants were inoculated into 3 mL of LB liquid medium (containing 50 μg / mL kanamycin) and cultured overnight at 37°C and 200 rpm. Subsequently, the bacterial culture was mixed with 50% glycerol at a 1:1 volume ratio, thoroughly mixed, and stored at -80°C for later use. The resulting recombinant plasmid was named pPk2-bar-GFP-b-02.

[0098] Figure 2 Electrophoresis image of colony PCR verification of the recombinant ada02 knockout vector in E. coli DH5α. Figure 2 In the diagram, lane M represents the DNA molecular weight standard; NC represents the amplification band of the pPk2-bar-GFP-b-02-3' plasmid verification primer; lanes 1-3 represent the verification bands of E. coli transformants of the ada02 knockout plasmid.

[0099] according to Figure 2It can be seen that the 02-5′ homologous arm fragment has been successfully inserted into the pPk2-bar-GFP-b-02-3′ vector, resulting in an ada02 knockout recombinant plasmid containing both the 02-5′ and 02-3′ homologous arms.

[0100] 9. Agrobacterium-mediated transformation and transformant verification

[0101] Thaw frozen *Agrobacterium tumefaciens* AGL1 competent cells on ice, add 7 μL of the recombinant ada02 knockout plasmid pPk2-bar-GFP-b-02 obtained in step 8, and gently pipette to mix. After incubating on ice for 30 min, quickly transfer the mixture to liquid nitrogen for 5 min, then heat shock it in a 37 °C water bath for 5 min, and cool it again on ice for 5 min. Then, add 1 mL of LB liquid medium to the tube and incubate at 28 °C and 220 rpm with shaking for 3 h. Collect the cells by centrifugation at 5000 rpm for 5 min at room temperature, carefully discard most of the supernatant, resuspend the cell pellet in the remaining medium, and then evenly spread it on LB agar plates containing 50 μg / mL kanamycin. Incubate at 28 °C for 2–3 days.

[0102] Single colonies of the above transformants were picked and placed in PCR tubes. Colony PCR identification was performed using primer pairs CP-1 / CP-2. The PCR system and reaction conditions were as described in step 5. The PCR products were analyzed by 1% agarose gel electrophoresis. The results are as follows: Figure 3 As shown. A single Agrobacterium AGL1 colony that tested positive by colony PCR was named an A. tumefaciens AGL1 positive single colony carrying a gene knockout vector. The A. tumefaciens AGL1 positive single colony carrying the gene knockout vector was selected for expansion culture, then mixed with 50% glycerol at a 1:1 volume ratio, and stored at -80 ℃ for later use.

[0103] Figure 3 This is an electrophoresis diagram of colony PCR verification of the transformants obtained by transforming Agrobacterium AGL1 with the recombinant ada02 knockout plasmid pPk2-bar-GFP-b-02 obtained in step 8 in step 9. Figure 3 In the diagram, lane M represents the Trans 5K DNA Marker, and lanes 1, 2, 3, 4, and 5 correspond to the colony PCR amplification bands of five Agrobacterium AGL1 single colony transformants, respectively. Figure 3It can be seen that lanes 1, 2, 3, 4, and 5 all amplified the target bands of the same size as expected, indicating that the recombinant ada02 knockout plasmid pPk2-bar-GFP-b-02 obtained in step 8 has been successfully transformed into Agrobacterium AGL1 and positive Agrobacterium transformants have been obtained.

[0104] 10. Agrobacterium tumefaciens-mediated gene knockout fungal transformation (ATMT)

[0105] From the *A. tumefaciens* AGL1-positive single colonies carrying the gene knockout vector obtained in step 9, single colonies were picked and streaked onto LB agar plates containing 50 μg / mL kanamycin and cultured at 28 °C for 2–3 days. Subsequently, fresh single colonies were inoculated into 10 mL of LB liquid medium containing the corresponding antibiotic and cultured at 28 °C and 220 rpm for 16–20 h until the OD 660 reached 0.6–0.8. The bacterial culture was diluted to an OD 660 of 0.15 using IMAS liquid medium containing 40 mM MES and 200 μM AS, and cultured in the dark at 28 °C and 200 rpm until the OD 660 reached 0.4–0.5 (approximately 4 h). The resulting culture was named the *Agrobacterium* induced culture. Meanwhile, Cordyceps militaris mycelia were collected from PDA plates cultured at 25 °C for 15 days. Spore suspensions were prepared using sterile ddH2O and serially diluted to a concentration of 1×10⁻⁶ using the aforementioned IMAS medium. 6 100 μL of diluted Cordyceps militaris spore suspension was mixed with an equal volume of Agrobacterium induction culture. After gentle pipetting and mixing, the mixture was evenly spread onto IMAS solid induction medium containing 40 mM MMEs and 200 μM AS, with black sterile filter paper (Neumann, Germany) as a base. The medium was incubated upright at 25 °C for 4–6 days. After incubation, the filter paper with white, fluffy hyphae was transferred to M-100 selection medium containing 400 μg / mL cefotaxime and 400 μg / mL glufosinate (or hygromycin). Then, another layer of M-100 medium containing the corresponding antibiotic was poured on top of the filter paper to form a "sandwich" structure. After the medium solidified, the medium was incubated upside down at 25 °C for 4–6 days. Finally, the grown transformants were seeded onto M-100 selection medium containing the corresponding antibiotic for secondary screening and cultured upside down at 25 ℃ for 3-5 days; then transferred to PDA plates containing 400 μg / mL glufosinate (or hygromycin) and cultured upside down for 5-7 days.

[0106] 11. Positive test result (Δada02)

[0107] The resistant colonies obtained in step 10 were picked up with toothpicks and identified by PCR using KOD FX (KOD FX DNA polymerase). For the ada02 site, two sets of primer pairs were used for closed-loop identification: "No verification" and "Yes verification": primer pair 02911CF-1 / 02911 CF-2 was used for "No verification"; primer pair 02911 CF-2 / Bar down was used for "Yes verification". Simultaneously, primer pairs covering the target gene can be used to detect its deletion.

[0108] Specifically as follows:

[0109] The ada02 site was identified using two sets of primer pairs: "No Verification" and "Yes Verification". The PCR No verification reaction system for the Cordyceps militaris gene knockout transformants was: 0.6 μL 02911 CF-1, 0.6 μL 02911 CF-2, 4 μL dNTPs, 10 μL 2x FX Buffer, 4.4 μL ddH2O, and 0.4 μL KOD FX. The PCR Yes verification reaction system for the Cordyceps militaris gene knockout transformants was: 0.6 μL Bar down, 0.6 μL 02911 CF-2, 4 μL dNTPs, 10 μL 2x FX Buffer, 4.4 μL ddH2O, and 0.4 μL KOD FX. The PCR reaction conditions for transformant verification were: 95℃ for 3 min; 98℃ for 10 s, 53℃ for 30 s, 68℃ for 3 min, 30 cycles; 68℃ for 5 min.

[0110] 02911 CF-1:TGAGCCTCTACGGCTGGAAG

[0111] 02911 CF-2: AGCAGGCGACGACCAAGAGTGA

[0112] Bar down: TGGCATGACGTGGGTTTCTGG

[0113] The results were as follows: the validation fragment for the knockout mutant “YES” is as described in SEQ ID NO:5; the validation fragment for the knockout mutant “NO” is as described in SEQ ID NO:6. Further sequencing verification of the PCR-positive clones showed that the transformants with homologous substitution at the ada02 site and correct sequence were the Δada02 knockout strains.

[0114] The electrophoresis results of PCR identification of the Δada02 transformant at the ada02 site are as follows: Figure 4As shown, the comparison and transformation bands for No verification and Yes verification are included; the No verification primer pair is 02911 CF-1 / 02911 CF-2, and the Yes verification primer pair is 02911 CF-2 / Bar down. Figure 4 In the diagram: CM represents the No verification band of the original Cordyceps militaris strain; AC represents the No verification band of the Cordyceps militaris ada02 gene knockout transformant; cm represents the Yes verification band of the original Cordyceps militaris strain; ac represents the Yes verification band of the Cordyceps militaris ada02 gene knockout transformant. According to... Figure 4 The following conclusions can be drawn: the original Cordyceps militaris strain amplified the target band in the No verification but not in the Yes verification; the ada02 gene knockout transformant amplified the target band in the Yes verification but not in the No verification, indicating that the expected homologous substitution has occurred at the ada02 site, and the Δada02 knockout strain was obtained.

[0115] It should be emphasized in this embodiment that the transformant obtained by the above method and verified by PCR and sequencing to have homologous substitution at the ada02 site is the Cordyceps militaris Δada02 knockout strain, and the present invention has inherent reproducibility.

[0116] Example 2: Obtaining the double knockout strain CM0207 (Δada02Δada07)

[0117] The full-length coding region (CDS) nucleotide sequence of CCM_07169 (ada07) is as described in SEQ ID No. 2.

[0118] SEQ ID No. 2 serves as a reference for the ada07 target gene sequence, used to determine the location of the CCM_07169 gene, and based on this, primers for the upstream and downstream homologous arms of ada07, as well as PCR verification primers for the ada07 site, were designed. Using the Δada02 knockout strain obtained in Example 1 as the recipient strain, a second round of ada07 knockout was performed according to the strategy in Example 1. To achieve double knockout screening, the second round of knockout used a different screening marker than the first, namely a hygromycin resistance expression cassette, and an ada07 knockout vector was constructed.

[0119] 1. Primer design:

[0120] This step is similar to step 1 of Example 1, except that the target gene ada02 in Example 1 is replaced with ada07 (CCM_07169), and primers for the upstream and downstream homologous arms of ada07, as well as subsequent primers for ada07 site verification, are designed accordingly. The designed primers are as follows:

[0121] 07169 3-1: GGACTAGTCATATAGCTTCAGACGGTCCAG

[0122] 07169 3-2: CGGATATCCCTGCGAGATACCAAGTGCAG

[0123] 07169 5-1: AGTACACGAGGACTTCTAGAATACGGTGTAGAGAATGCTCCG

[0124] 07169 5-2: CATCTTCTGTCGAGGAATTCGAAGAGAGAAGTCGACCGAG

[0125] The primers for verifying the ada07 site are as follows: 07169 CF-1: CAGGAGTGGCAGATTCAGTG07169 CF-2: GGACTACCAGCTTCTCAGAGHyg down: ACTGTCGGGCGTACACAAATC

[0126] 2. Homologous arm amplification

[0127] This step is similar to step 2 of Example 1, except that: the template in step 2 of Example 1 is replaced with the genomic DNA of the Δada02 recipient strain obtained in Example 1; the target fragments 02-5′ and 02-3′ are replaced with 07-5′ and 07-3′, respectively; and the primer pairs 02911 5-1 / 02911 5-2 and 02911 3-1 / 02911 3-2 are replaced with 07169 5-1 / 07169 5-2 and 07169 3-1 / 07169 3-2, respectively. The rest is the same.

[0128] The sequences of the upstream homologous fragment 07-5′ of ada07 and the downstream homologous fragment 07-3′ of ada07 are shown in SEQ ID No. 7 and SEQ ID No. 8 in the sequence listing.

[0129] 3. Amplified 07-3′ homologous fragment digested, ligated, and transformed with pPk2-hyg-GFP-b vector.

[0130] This step is similar to step 3 of Example 1, except that the 02-3′ fragment in step 3 of Example 1 is changed to the 07-3′ fragment, the vector pPk2-bar-GFP-b is changed to pPk2-hyg-GFP-b, and the selection marker is changed to the hygromycin resistance expression cassette. The rest is the same.

[0131] 4. Transformation of E. coli by enzyme-linked products

[0132] This step is similar to step 4 of Example 1, except that the transformed enzyme ligation product is the ligation product containing the 07-3′ fragment obtained in step 3, and the antibiotic in the screening plate is changed to the antibiotic corresponding to the vector. The rest is the same.

[0133] 5. Identification and sequencing of positive transformants

[0134] This step is similar to step 5 of Example 1, except that the 02-3′ fragment in step 5 of Example 1 is replaced with the 07-3′ fragment, and the intermediate recombinant plasmid is named pPk2-hyg-GFP-b-07-3′ accordingly. The rest is the same. Positive bacteria with expected electrophoretic band sizes are sequenced. Sequencing results show that transformants with correct 07-3′ homologous arm sequences, correct insertion orientation, correct linkage sites, and no base deletions, insertions, or mutations are considered correct recombinant transformants. After successful sequencing, the transformants are expanded and cryopreserved for later use. The resulting intermediate recombinant plasmid is named pPk2-hyg-GFP-b-07-3′.

[0135] Figure 5 Agarose gel electrophoresis image of the validation of inserting the 07-3′ fragment into the pPk2-hyg-GFP-b plasmid vector. Figure 5 In the diagram, lane M represents the DNA molecular weight standard; lanes 1, 2, 3, 4, and 5 are the PCR verification bands of the E. coli transformant colonies from step 5. The target bands appeared at the expected positions in lanes 1-5, indicating that the 07-3′ homologous arm fragment had been successfully inserted into the vector, yielding a recombinant plasmid containing the 07-5′ homologous arm.

[0136] 6. Extraction of pPk2-hyg-GFP-b-07-3′ plasmid

[0137] This step is similar to step 6 in Example 1, except that the plasmid pPk2-bar-GFP-b-02-3′ is changed to pPk2-hyg-GFP-b-07-3′, and the rest is the same.

[0138] 7. Seamless ligation of the 07-5′ fragment with the pPk2-hyg-GFP-b-07-3′ vector.

[0139] The steps differ from step 7 of Example 1. Step 7 of Example 1 uses a restriction endonuclease digestion-ligation method, while in the second round of ada07 vector construction, the insertion of the 07-5′ fragment uses a seamless cloning method. The amplified 07-5′ fragment and the linearized pPk2-bar-GFP-b-07-3′ plasmid were combined to prepare a seamless cloning reaction system according to the ClonExpress® Ultra One Step Cloning Kit C115 instructions and incubated at 50 °C for 10 min; this step can be directly compared to the second round of vector construction using hygromycin labeling.

[0140] 8. E. coli transformation and identification and sequencing of positive transformants

[0141] This step is similar to step 8 of Example 1, except that the 02-5′ homologous fragment in step 8 of Example 1 is replaced with the 07-5′ homologous fragment, and the linearized vector pPk2-bar-GFP-b-02-3′ is replaced with pPk2-hyg-GFP-b-07-3′. The rest is the same. Sequencing results show that the newly inserted 07-5′ homologous arm sequence is correct, the insertion direction and the ligation site are correct, and the final ada07 knockout recombinant plasmid is obtained, named pPk2-hyg-GFP-b-07.

[0142] 9. Agrobacterium-mediated transformation and transformant verification

[0143] This step is similar to step 9 in Example 1, except that the recombinant ada02 knockout plasmid pPk2-bar-GFP-b-02 in Example 1 is replaced with the recombinant ada07 knockout plasmid pPk2-hyg-GFP-b-07, and the Agrobacterium AGL1 single colony that is positive after colony PCR is named A. tumefaciens AGL1 positive single colony carrying the ada07 knockout vector.

[0144] Figure 6 Electrophoresis images of colony PCR verification of E. coli DH5α (left) and Agrobacterium AGL1 (right) transformants transformed with the pPk2-hyg-GFP-b-07 recombinant plasmid. In the left image, lane M represents the DNA molecular weight standard, lane YC represents the amplification band of the ada07 knockout plasmid verification primers, and lanes 1, 2, 3, and 4 represent the colony PCR verification bands of E. coli DH5α transformants with the ada07 knockout plasmid. In the right image, lane M represents the DNA molecular weight standard, lane yc represents the amplification band of the ada07 knockout plasmid verification primers, and lanes A and B represent the colony PCR verification bands of Agrobacterium AGL1 transformants with the ada07 knockout plasmid. Figure 6It can be seen that lanes 1, 3 and 4 of the E. coli DH5α transformant amplified target bands of the same size as expected, and lanes A and B of the Agrobacterium AGL1 transformant amplified target bands of the same size as expected, indicating that the ada07 knockout vector has been successfully constructed and successfully transformed into Agrobacterium AGL1.

[0145] 10. Agrobacterium tumefaciens-mediated dual-gene knockout fungal transformation (ATMT)

[0146] This step is similar to step 10 of Example 1, except that: the recipient strain is changed from the original Cordyceps militaris strain in Example 1 to the Δada02 knockout strain obtained in Example 1; the knockout vector used for transformation is changed to the A. tumefaciens AGL1 positive single colony carrying the ada07 knockout vector obtained in step 9; the final selection marker is changed to the hygromycin resistance selection corresponding to the second round of knockout vector, and the remaining Agrobacterium induction, co-culture with the recipient strain spore suspension, sandwich screening, secondary screening and other operations are the same.

[0147] 11. Positive test results (CM0207, Δada02Δada07)

[0148] The resistant colonies obtained in step 10 were picked up with toothpicks and identified by PCR using KOD FX DNA polymerase. Loop closure identification was performed at the ada02 and ada07 sites using two primer pairs: "No verification" and "Yes verification." The 'YES' verification fragment for the ada07 knockout mutant is shown in SEQ ID No. 9; the 'NO' verification fragment for the ada07 knockout mutant is shown in SEQ ID No. 10.

[0149] Specifically: for ada07 site No verification, primer pair 07169 CF-1 / 07169 CF-2 was used; for ada07 site Yes verification, primer pair 07169 CF-2 / Hyg down was used; for ada02 site No verification, primer pair 02911 CF-1 / 02911CF-2 was still used; for ada02 site Yes verification, primer pair 02911 CF-2 / Bar down was still used.

[0150] 07169 CF-1: CAGGAGTGGCAGATTCAGTG

[0151] 07169 CF-2:GGACTACCAGCTTCTCAGAG

[0152] Hyg down: ACTGTCGGGCGTACACAAATC

[0153] Transformants that tested positive by PCR were further sequenced for verification. Sequencing results showed that the transformants with the expected homologous substitutions at both the ada02 and ada07 sites and the correct sequences were identified as the double knockout strain CM0207 (Δada02Δada07).

[0154] Figure 7 Electrophoresis diagram of PCR identification of Cordyceps militaris double gene knockout transformant at the ada02 site. Figure 7 In the left image, lane M represents the DNA molecular weight standard, lane CM represents the No verification control band of the original Cordyceps militaris strain, and lanes 1-10 represent the No verification bands of the Cordyceps militaris ada02 knockout transformants at the ada02 site. In the right image, lane M represents the DNA molecular weight standard, lane cm represents the Yes verification control band of the original Cordyceps militaris strain, and lanes a-l represent the Yes verification bands of the Cordyceps militaris ada02 knockout transformants at the ada02 site. Figure 7 It can be seen that the recipient strain amplified the control band in the No verification at the ada02 site, while most of the double gene knockout candidate transformants did not amplify the wild-type corresponding band in the No verification; at the same time, most candidate transformants amplified the target band of the same size as expected in the Yes verification, indicating that these candidate transformants maintained the expected knockout genotype at the ada02 site.

[0155] Figure 8 Electrophoresis image of PCR identification of Cordyceps militaris double gene knockout transformant at the ada07 site. Figure 8 In the left image, lane M represents the DNA molecular weight standard, lane CM represents the No verification control band of the original Cordyceps militaris strain at the ada07 site, and lanes 1-9 represent the No verification bands of the Cordyceps militaris ada07 knockout transformants at the ada07 site. In the right image, lane M represents the DNA molecular weight standard, lane CM represents the Yes verification control band of the original Cordyceps militaris strain at the ada07 site, and lanes A-E represent the Yes verification bands of the Cordyceps militaris ada07 knockout transformants at the ada07 site. Figure 8 It can be seen that the double gene knockout candidate transformants amplified the expected band different from the recipient strain in the No verification at the ada07 site, while in the Yes verification, lanes A, B, C and E amplified the target band of the same size as expected, indicating that these candidate transformants have undergone the expected homologous substitution at the ada07 site; after further sequencing confirmation, the double knockout strain CM0207 was obtained.

[0156] The CM0207 strain obtained in this example maintained a stable resistance phenotype and knockout genotype after continuous subculturing, making it suitable for subsequent fermentation phenotype evaluation and application.

[0157] Example 3: Second target gene ada07 knockout strain

[0158] Compared to Example 2, “genomic DNA of Δada02 recipient strain” is changed to “template obtained in step 2 of Example 1”, step 7 is the same as step 7 of Example 1, and the rest is the same as Example 2.

[0159] Thus, the second target gene ada07 knockout strain was obtained.

[0160] Example 4: Application of double-knockout strain CM0207 in cordycepin production

[0161] The double-gene knockout strain CM0207 (Δada02Δada07), the first target gene ada02 knockout strain, the second target gene ada07 knockout strain, and the starting strain (WT) were inoculated into the same liquid culture medium (PDB liquid medium) and cultured with shaking at 23-25℃ and 200-220 rpm. Samples were taken on days 5, 10, 15, 20, and 25 of culture. Under the same culture conditions and sample treatment, the mycelium obtained from the liquid culture was collected as a solid sample, washed with sterile water, drained, dried (60℃) to constant weight, ground into powder and mixed evenly. After weighing, the sample was pretreated. The cordycepin content could be quantitatively analyzed by HPLC. A standard curve was established using cordycepin standards, and the detection results were expressed in mg / kg.

[0162] All samples were processed using the same sampling volume / mycelium collection method, the same drying to constant weight standard, and the same extraction procedure. Cordycepin was calculated as dry weight (mg / kg).

[0163] The test results showed that on day 25 of cultivation, the cordycepin content of the CM0207 mycelial sample was 2570.54 mg / kg and the WT was 2209.06 mg / kg. The data are shown in Table 1.

[0164] Table 1. Cordycepin content (mg / kg) in solid samples after liquid fermentation for 5-25 days

[0165] 5 d 307.01 230.77 234.10 218.72 10 d 397.93 222.91 342.53 364.96 15 d 982.75 485.77 1134.96 1102.86 20 d 1997.31 178.12 316.28 1188.51 25 d 2209.06 1673.97 2729.71 2570.54

[0166] In Table 1:

[0167] Cm: Starting strain (WT);

[0168] Cm02: The strain with the first target gene ada02 knocked out;

[0169] Cm07: The ada07 knockout strain, representing the second target gene;

[0170] Cm0207: Double gene knockout strain CM0207 (Δada02Δada07).

[0171] In summary, the double-gene knockout engineered strain CM0207 of Cordyceps militaris obtained by this invention can be used for fermentation production or cultivation applications to increase the cordycepin content of Cordyceps militaris, and is especially suitable for production needs that require obtaining a higher level of cordycepin accumulation within a selected culture window.

[0172] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. A type of Cordyceps militaris ( C. militaris Double gene knockout engineered strains CM0207 Its features are: The engineered strain was obtained from a Cordyceps militaris starting strain by simultaneously or sequentially inactivating the adenosine deaminase-related isoenzyme genes CCM_02911 and CCM_07169; the engineered strain is Δ ada02 Δ ada07 .

2. The Cordyceps militaris double-gene knockout engineered strain according to claim 1 CM0207 Its features are: Both CCM_02911 and CCM_07169 are inactivated due to disruption of key coding regions in their genomes. This inactivation includes, but is not limited to, deletions, insertions, substitutions, or frameshift mutations in the coding regions of the genes, or replacement by exogenous expression cassettes, resulting in the loss of function of the corresponding gene products. This inactivation can be identified by PCR verification and / or sequencing verification across integration sites.

3. The Cordyceps militaris double-gene knockout engineered strain according to claim 1 or 2 CM0207 Its features are: The full-length coding region nucleotide sequence of the CCM_02911 gene is shown in SEQ ID No. 1, and the full-length coding region nucleotide sequence of the CCM_07169 gene is shown in SEQ ID No.

2.

4. The Cordyceps militaris double-gene knockout engineered strain according to claim 3 CM0207 Its features are: The key coding region at CCM_02911 was replaced by the bar expression box, and the key coding region at CCM_07169 was replaced by the hph expression box.

5. Cordyceps militaris double gene knockout engineered strain CM0207 The preparation method is characterized by Includes the following steps: 1) Construction of the first target gene ada02 knockout strain: S11. Using the genomic DNA of the Cordyceps militaris strain as a template, amplify the upstream and downstream homologous arms of the first target gene CCM_02911, place the first selection marker gene expression cassette between the two homologous arms, and construct the first gene knockout vector or linear knockout fragment. S12. The first gene knockout vector is introduced into Agrobacterium competent cells to obtain Agrobacterium carrying the knockout vector; and co-cultured with Cordyceps militaris spores or hyphae under acetylsyringone-containing induction conditions to allow the knockout fragment to be integrated into the genome through homologous recombination. S13. Screen transformants on selective medium containing screening agent and identify the Δada02 knockout strain with CCM_02911 inactivated. 2) Obtaining the double knockout strain CM0207: S21. Using the Δada02 knockout strain as a recipient, amplify the upstream and downstream homologous arms of the second target gene CCM_07169, place the second selection marker gene expression cassette between the two homologous arms, and construct the second gene knockout vector or linear knockout fragment. S22. The second gene knockout vector is introduced into Agrobacterium competent cells and co-cultured with Cordyceps militaris spores or hyphae under acetylsyringone-containing induction conditions, so that the knockout fragment is integrated into the genome through homologous recombination. S23. Transformants were screened on selective medium containing screening agents to obtain the double gene knockout engineered strain CM0207.

6. The method according to claim 5, characterized in that: The screening markers are recycled or removed to achieve marker reuse. The recycling or removal is carried out using Cre / loxP, FLP / FRT or homologous recombination self-excision method. Targeted inactivation employs a homologous recombination substitution strategy, using a selection marker gene expression cassette to replace the key coding region of the target gene, thereby inactivating the target gene; the selection marker gene is the bar gene and / or the hph gene. The selection marker gene expression cassette includes a fungal promoter, a selection marker gene coding sequence, and a terminator.

7. The method according to claim 6, characterized in that: The homologous arms are 0.8 to 1.6 kb in length; the two homologous arms are located on the flanking regions of the 5′ and 3′ ends of the target gene, respectively.

8. The preparation method according to any one of claims 5 to 7, characterized in that: The co-culture temperature for Agrobacterium-mediated transformation was 20–28 °C; the co-culture time was 4–6 days. When the screening label is bar, the screening agent is glufosinate-ammonium, and its final concentration is 300~800 μg / mL; When the screening marker is hph, the screening agent is hygromycin B, with a final concentration of 50~600 μg / mL.

9. The preparation method according to claim 8, characterized in that: The selection medium contains antibiotics to inhibit Agrobacterium.

10. The Cordyceps militaris double-gene knockout engineered strain as described in any one of claims 1 to 4 CM0207 Application in cordycepin production.

Images