A beta vaccine for preventing and treating Alzheimer's disease and preparation method thereof
By preparing phage and recombinant gene vaccines, combined with aluminum hydroxide adjuvant, the Aβ1-42-specific immune response in AD mice was induced, Aβ plaques were eliminated in the brain, and cognitive function was improved, and the safety and effectiveness of the existing Aβ vaccine were solved, and better therapeutic effects were achieved.
Patent Information
- Application Number
- CN202510738121.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2025-08-22
AI Technical Summary
There are many problems with the safety and effectiveness of the existing Aβ vaccine, including the safety risks of the full-length Aβ1-42 vaccine and the insufficient immune response of the Aβ short peptide vaccine, which cannot effectively prevent the development of Alzheimer's disease.
Phage vaccines and recombinant gene vaccines were used to integrate Aβ3-10 and Aβ25-35 gene fragments into pCOMB3X phage coat protein PIII or pcDNA vectors, and combined with aluminum hydroxide adjuvant, YXL1, YXL2, pcDNA Aβ3-10 and pcDNA Aβ25-35 vaccines were prepared, which induces Aβ1-42-specific humoral immune response, clears Aβ plaques in the brain and improves cognitive function.
In AD mouse model, the novel vaccine can induce a strong Aβ1-42-specific immune response, clear Aβ plaques in the brain, improve cognitive function, inhibit abnormal glial cell proliferation, reduce inflammatory response and cerebral hemorrhage, and has better safety and effectiveness.
Smart Images
Figure CN120514833A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to an Aβ vaccine for preventing and treating Alzheimer's disease and a preparation method thereof. Background Art
[0002] With the aging of the population, the incidence of Alzheimer's disease (AD) is rapidly increasing, becoming a major global public health issue. However, existing disease-modifying drugs for AD have limited efficacy and are unable to effectively intervene in the progression of AD. Therefore, the development of drugs that can halt the progression of AD, or even prevent or delay its onset, is of great clinical significance.
[0003] The widely accepted pathogenesis of AD is a series of pathological processes, including the imbalanced production and clearance of amyloid-β (Aβ) and Tau protein hyperphosphorylation, leading to inflammation, neuronal death, and other pathological processes. Excessive Aβ deposition in the brain is considered a core process in the neuropathological changes of AD, and the development of vaccines targeting pathological Aβ in the brain has attracted widespread attention in recent years.
[0004] However, at present, Aβ vaccines are still in the research and development stage, and no safe and effective Aβ vaccine has been successfully launched on the market. Existing Aβ immunotherapy still has many drawbacks. On the one hand, the full-length Aβ 1-42 Vaccines that use Aβ as epitopes have exposed obvious safety issues such as cerebral hemorrhage and brain swelling. On the other hand, although subsequent Aβ vaccines mostly use short Aβ peptides that do not contain T cell epitopes as epitopes to ensure safety, shorter Aβ peptides are difficult to induce strong humoral immune responses in the body, and there are still problems such as low antibody levels and poor therapeutic effects. Summary of the Invention
[0005] In view of this, in one aspect, some embodiments disclose Aβ vaccines for preventing and treating Alzheimer's disease, wherein the Aβ vaccines include phage vaccines and recombinant gene vaccines; wherein:
[0006] Phage vaccines include YXL1 vaccine obtained by integrating the gene sequence shown in SEQ ID NO: 001 as the target gene into pCOMB3X phage coat protein PIII, and YXL2 vaccine obtained by integrating the gene sequence shown in SEQ ID NO: 002 as the target gene into pCOMB3X phage coat protein PIII;
[0007] The recombinant gene vaccine includes pcDNA Aβ obtained by integrating the gene sequence shown in SEQ ID NO: 003 as the target gene into the pcDNA vector. 3-10Vaccine, and pcDNA Aβ obtained by integrating the gene sequence shown in SEQ ID NO: 004 as the target gene into the pcDNA vector 25-35 vaccine.
[0008] Furthermore, some embodiments disclose an Aβ vaccine for preventing and treating Alzheimer's disease, further comprising at least one of a pharmaceutically acceptable adjuvant and an excipient.
[0009] Some embodiments disclose an Aβ vaccine for preventing and treating Alzheimer's disease, wherein the adjuvant is at least one of aluminum hydroxide, aluminum phosphate, aluminum sulfate, 3-de-O-acylated monophosphoryl lipid A (MPL), QS-21, TQL1055, QS-18, QS-17, QS-7, oil-in-water emulsion, CpG, polyglutamic acid, polylysine, and AddaVax™, or a combination of two or more thereof.
[0010] Some embodiments disclose an Aβ vaccine for preventing and treating Alzheimer's disease. The dosage form of the Aβ vaccine includes oral administration, injection, or aerosol inhalation.
[0011] On the other hand, some embodiments disclose a method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, comprising: 3-10 The gene fragment was integrated into the pCOMB3X phage coat protein PIII to obtain the YXL1 vaccine.
[0012] Some embodiments disclose a method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, comprising: 25-35 The gene fragment was integrated into the pCOMB3X phage coat protein PIII to obtain the YXL2 vaccine.
[0013] Some embodiments disclose a method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, comprising: 3-10 The gene fragment was recombined with the GRP94 (no KDEL) gene fragment to obtain pcDNA Aβ 3-10 vaccine.
[0014] Some embodiments disclose a method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, comprising: 25-35 The gene fragment was recombined with the GRP94 (no KDEL) gene fragment to obtain pcDNA Aβ 25-35 vaccine.
[0015] The four vaccines obtained by the preparation method of the Aβ vaccine for preventing and treating Alzheimer's disease disclosed in the embodiment of the present invention can induce the formation of strong Aβ in AD mice. 1-42Specific humoral immune response mediates the clearance of Aβ plaques in the brains of AD mice and improves cognitive function, effectively inhibits the abnormal proliferation of microglia and astrocytes in the brains of AD mice, and tends to promote the shift of cellular immune response towards Th2, without causing obvious inflammatory response, cerebral hemorrhage and mental and behavioral abnormalities. It has better effectiveness and safety than traditional vaccines. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 The maps of the pCOMB3X vector and pcDNA3.1 vector in Examples 1 and 2 are shown;
[0017] Figure 2 The titer of Aβ-specific antibodies and the antibody IgG typing results in the serum of each group of mice in Example 4 are shown;
[0018] Figure 3 This is the affinity result of Aβ-specific antibodies induced by the vaccine in Example 5;
[0019] Figure 4 These are the behavioral evaluation results of mice in each group after vaccination in Example 6;
[0020] Figure 5 、 Figure 6 This is the result of Example 7 showing the effect of the vaccine on Aβ plaque deposition in the brains of APP / PS1 mice;
[0021] Figure 7 、 Figure 8 、 Figure 9 This is the effect of the vaccine in Example 8 on abnormally proliferating astrocytes and microglia during the course of AD;
[0022] Figure 10 The results of Example 9 show the effect of the vaccine on inflammatory factors in the brain of APP / PS1 mice;
[0023] Figure 11 The results of Prussian blue staining of mouse brain tissue to detect cerebral hemorrhage in Example 10;
[0024] Figure 12 The results of Example 11 are the effects of the vaccine YXL2 on neurons in the brains of APP / PS1 mice;
[0025] Figure 13 These are the results of the effect of the vaccine YXL2 in Example 11 on the levels of synaptic-related proteins SYP, PSD-95, and Tau protein in brain tissue homogenates of APP / PS1 mice. DETAILED DESCRIPTION
[0026] The term "embodiment" is used herein specifically to describe any embodiment as "exemplary," and should not be construed as superior or preferable to other embodiments. Performance indicators in the embodiments of the present invention were tested using conventional testing methods in the art, unless otherwise specified. It should be understood that the terms used in the embodiments of the present invention are intended solely to describe specific implementations and are not intended to limit the disclosure of the embodiments of the present invention.
[0027] Unless otherwise specified, the technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the embodiments of the present invention pertain; any experimental methods and technical means not otherwise specified in the embodiments of the present invention refer to experimental methods and technical means commonly used by those skilled in the art.
[0028] As used herein, the terms "substantially" and "approximately" are used to describe small fluctuations. For example, they can refer to less than or equal to ±5%, such as less than or equal to ±2%, such as less than or equal to ±1%, such as less than or equal to ±0.5%, such as less than or equal to ±0.2%, such as less than or equal to ±0.1%, such as less than or equal to ±0.05%. Numerical data expressed or presented in range format herein are used for convenience and brevity only and should therefore be interpreted flexibly to include not only the values explicitly listed as the limits of the range, but also all independent values or subranges contained within the range. For example, a numerical range of "1-5%" should be interpreted to include not only the explicitly listed values of 1% to 5%, but also the independent values and subranges within the indicated range. Thus, included in this numerical range are independent values such as 2%, 3.5%, and 4%, and subranges such as 1% to 3%, 2% to 4%, and 3% to 5%, etc. This principle also applies to ranges that only list a single value. Furthermore, this interpretation applies regardless of the width of the range or the characteristics described.
[0029] Throughout this document, including in the claims, transitional terms such as "comprises," "includes," "with," "having," "contains," "involving," and "accommodating" are understood to be open-ended, meaning "including but not limited to." Only the transitional terms "consisting of" and "composed of" are closed transitional terms.
[0030] In order to better illustrate the present invention, numerous specific details are provided in the following specific examples. It should be understood by those skilled in the art that the present invention can be practiced without certain specific details. In the examples, some methods, means, instruments, and equipment well known to those skilled in the art are not described in detail in order to highlight the main purpose of the present invention.
[0031] Under the premise of no conflict, the technical features disclosed in the embodiments of the present invention can be arbitrarily combined, and the resulting technical solutions belong to the contents disclosed in the embodiments of the present invention.
[0032] In some embodiments, the Aβ vaccine for preventing and treating Alzheimer's disease comprises a phage vaccine and a recombinant gene vaccine; wherein:
[0033] Phage vaccines include YXL1 vaccine obtained by integrating the gene sequence shown in SEQ ID NO: 001 as the target gene into pCOMB3X phage coat protein PIII, and YXL2 vaccine obtained by integrating the gene sequence shown in SEQ ID NO: 002 as the target gene into pCOMB3X phage coat protein PIII;
[0034] The recombinant gene vaccine includes pcDNA Aβ obtained by integrating the gene sequence shown in SEQ ID NO: 003 as the target gene into the pcDNA vector. 3-10 Vaccine, and pcDNA Aβ obtained by integrating the gene sequence shown in SEQ ID NO: 004 as the target gene into the pcDNA vector 25-35 vaccine.
[0035] The sequence of the target gene of the YXL1 vaccine is:
[0036] gagttccgtcatgatagcggttatggtggcggcggtagcgaatttcgtcatgattcaggctatggtggcggtg gtagtgaatttcgccatgatagcggctatggcggcgg tggtagc;
[0037] The sequence of the target gene of the YXL2 vaccine is:
[0038] ggtagtaacaagggtgcaattattggcctgatgggcggcggtggtagtggtagcaataaaggcgcaattatt ggtctgatgggcggtggtggtagcggttcaaataaaggcgcgattattggcttaatgggtggtggcggtagc;
[0039] pcDNA Aβ 3-10 The sequence of the target gene of the vaccine is:
[0040]
[0041] pcDNA Aβ 25-35 The sequence of the target gene of the vaccine is:
[0042]
[0043] Typically, Aβ 3-10 It is the key part of AβN-terminus that is specifically recognized by Aβ antibody. 3-10 As an epitope, it can ensure high immunogenicity while avoiding T cell-mediated inflammatory response as much as possible. 25-35 It is the shortest fragment that retains the toxicity of the full-length Aβ, contains the extracellular hydrophilic and transmembrane hydrophobic domains, and itself has a β sheet structure. 25-35 Its unique structure and neurotoxicity make it have great potential in inducing high levels of Aβ antibodies and mediating the clearance of pathological Aβ. 3-10 or Aβ 25-35 Designing new Aβ epitope vaccines as functional epitopes provides a basis for determining the optimal Aβ epitope for AD immunotherapy and solving the shortcomings of current Aβ epitope vaccines.
[0044] Typically, pCOMB3X phage or pcDNA3.1 plasmid as vaccine vectors both use the organism's own translation mechanism to form natural conformational products, making it easier to induce an immune response. Among them, pCOMB3X phage can integrate Aβ peptides into the coat protein and copy them at high cost to enhance the immune effect. It has strict host specificity and is relatively safe. The pcDNA3.1 plasmid vector format allows the Aβ target gene to be expressed and synthesized into peptides in host cells, effectively stimulating an immune response. The introduction of the GRP94 fragment can act as an adjuvant to enhance the immune response and may also play a role as a molecular chaperone in regulating protein homeostasis.
[0045] The embodiment of the present invention uses Aβ 3-10 or Aβ 25-35 The fragment was used as an Aβ epitope, and pCOMB3X phage or pcDNA3.1 plasmid was used as a vector to construct four vaccines, including two phage peptide vaccines: pCOMB3X-YXL1 (denoted as: YXL1), pCOMB3X-YXL2 (denoted as: YXL2); and two recombinant gene vaccines: pcDNA-Aβ 3-10 -GRP94 (denoted as: pcDNA Aβ 3-10 ), pcDNA-Aβ 25-35 -GRP94 (denoted as: pcDNA Aβ 25-35 ).
[0046] The phage and recombinant gene Aβ epitope vaccines constructed in the present invention were used to subcutaneously immunize APP / PS1 mice, a double-transformed AD model, to explore their immune effects and mechanisms of action in AD mice. The results confirmed that the four constructed vaccines could induce strong Aβ formation in AD mice. 1-42Specific humoral immune response mediates the clearance of Aβ plaques in the brains of AD mice and improves cognitive function, effectively inhibits the abnormal proliferation of microglia and astrocytes in the brains of AD mice, and tends to promote the shift of cellular immune response towards Th2, without causing obvious inflammatory response, cerebral hemorrhage and mental and behavioral abnormalities. It has better effectiveness and safety than traditional vaccines.
[0047] A series of experiments further confirmed that among the four constructed vaccines, the phage vaccine YXL2 showed a better effect. In the AD mouse model, the YXL2 vaccine can induce the production of high levels of Aβ 1-42 Antibodies can clear Aβ plaques in the brain, effectively inhibit the hyperphosphorylation of Tau protein in the brain, maintain neuronal and synaptic function, mediate the improvement of learning and memory function, inhibit abnormal proliferation of glial cells, relieve excessive inflammatory response and cerebral hemorrhage, and are safe and effective.
[0048] The Aβ vaccine for preventing and treating Alzheimer's disease disclosed in some embodiments further includes at least one of a pharmaceutically acceptable adjuvant and an excipient.
[0049] Some embodiments disclose an Aβ vaccine for preventing and treating Alzheimer's disease, wherein the adjuvant is at least one of aluminum hydroxide, aluminum phosphate, aluminum sulfate, 3-de-O-acylated monophosphoryl lipid A (MPL), QS-21, TQL1055, QS-18, QS-17, QS-7, oil-in-water emulsion, CpG, polyglutamic acid, polylysine, and AddaVax™, or a combination of two or more thereof.
[0050] Aluminum hydroxide adjuvant is one of the most commonly used adjuvants in vaccine development. It primarily functions by forming a reservoir at the injection site, improving antigen utilization and enhancing immune responses. Furthermore, aluminum hydroxide adjuvants primarily induce Th2 immune responses, providing a means to minimize the induction of specific T cell-mediated inflammatory responses. Therefore, the four Aβ vaccines prepared in the examples of the present invention can ultimately be added with aluminum hydroxide adjuvant at a 1:1 (vol / vol) ratio to induce a stronger Th2 immune response.
[0051] Some embodiments disclose an Aβ vaccine for preventing and treating Alzheimer's disease. The dosage form of the Aβ vaccine includes oral administration, injection, or aerosol inhalation.
[0052] Some embodiments disclose a method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, comprising: 3-10 The gene fragment was integrated into the pCOMB3X phage coat protein PIII to obtain the YXL1 vaccine.
[0053] Some embodiments disclose a method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, comprising: 25-35 The gene fragment was integrated into the pCOMB3X phage coat protein PIII to obtain the YXL2 vaccine.
[0054] Some embodiments disclose a method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, comprising: 3-10 The gene fragment was recombined with the GRP94 (no KDEL) gene fragment to obtain pcDNA Aβ 3-10 vaccine.
[0055] Some embodiments disclose a method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, comprising: 25-35 The gene fragment was recombined with the GRP94 (no KDEL) gene fragment to obtain pcDNA Aβ 25-35 vaccine.
[0056] The technical details are further illustrated below with reference to embodiments.
[0057] Example 1
[0058] The method for preparing the recombinant gene vaccine disclosed in Example 1 comprises the following steps:
[0059] Artificial synthesis of Aβ encoding 4 copies carrying the GRP94 (no KDEL) fragment 3-10 The gene was constructed into the pcDNA3.1 vector; the ligation product was transformed into E. coli DH5α competent cells using BamHI and xhoI double enzyme digestion, positive clones were screened, plasmids were extracted, and sequencing was performed for identification; the pcDNA3.1 vector structure is as follows Figure 1 As shown in the upper middle picture;
[0060] Finally, the recombinant plasmid with the correct sequence was obtained, namely pcDNA-Aβ 3-10 -GRP94, as pcDNA Aβ 3-10 vaccine;
[0061] Artificially synthesized Aβ carrying a GRP94 (no KDEL) fragment encoding two copies 25-35 The gene was constructed into the pcDNA3.1 vector; the ligation product was double-digested with BamHI and xhoI, and transformed into Escherichia coli (E. coli) DH5α competent cells, and positive clones were screened, plasmids were extracted, and sequencing was performed for identification;
[0062] Finally, the recombinant plasmid with the correct sequence was obtained, namely pcDNA-Aβ 25-35 -GRP94, as pcDNA Aβ25-35 vaccine.
[0063] Example 2
[0064] The preparation method of the phage vaccine disclosed in Example 2 includes:
[0065] 1. Recombinant plasmid digestion
[0066] The pCOMB3X vector and the target gene fragment were digested with sfiI, and the digestion system was reacted in a 50°C water bath for 30 minutes, and then the gel was cut and recovered; the vector recovered by gel cutting was ligated with the target fragment and reacted at 16°C for 1 hour to obtain a ligation system; wherein, the structure of the pCOMB3X vector is as follows Figure 1 As shown in the figure below;
[0067] 2. Conversion
[0068] The obtained ligation system was transformed into X-Blue competent cells. The specific steps are as follows:
[0069] (1) Take out one tube of X-Blue competent cells from the -80℃ freezer and place it on ice immediately; (2) Add the ligation system (no more than 10μL), mix gently, and place on ice for 30 minutes; (3) Accurately heat shock in a 42℃ water bath for 90 seconds, and then quickly place on ice to cool for 3-5 minutes; (4) Add 500μL of 2YT liquid culture medium (without antibiotics) to the tube, mix well, and shake and culture at 37℃ and 200rpm for 1 hour to allow the bacteria to return to normal growth state; (5) Centrifuge the above bacterial solution, remove the supernatant, and mix the remaining culture medium by pipetting and spread it on a screening plate containing the corresponding antibiotics; (6) Invert the culture dish and culture at 37℃ for 16-24 hours; pick the bacteria from the transformed plate and sequence the cloned bacterial solution;
[0070] 3. Phage Expression
[0071] (1) Pick a single colony from the transformed plate and transfer it to 2YT-ATG (40%) medium, and culture it at 37°C, 250 rpm overnight; (2) Transfer 5-100 μL of the overnight culture to 2YT-ATG (0.1%) medium, and culture it at 37°C, 250 rpm for 4 h; (3) Add helper phage, let it stand at 37°C for 30 min, and then culture it with shaking at 37°C, 250 rpm for 1.5 h; (4) Add 300 μL of 2YT-ATK medium, and culture it with shaking at 30°C, 250 rpm overnight; (5) After centrifugation of the overnight culture, add 7% DMSO to the supernatant and freeze it;
[0072] 4. Titer Detection
[0073] The expressed phage was diluted to an appropriate gradient, 10 μL was taken and added to 100 μL X-Blue, and the plate was allowed to stand at 37°C for 30 min. The plate was taken out and inverted to culture overnight. The number of clones was observed on the next day and the titer was calculated.
[0074] Example 3
[0075] Phage and recombinant gene Aβ vaccine immunizes AD double transgenic model APP / PS1 mice, specifically including:
[0076] The experiments required 80 6-week-old APP / PS1 mice and 10 wild-type mice of the same age with a C57 / BL6J background, half male and half female, all from Beijing Huafukang Biotechnology Co., Ltd.
[0077] APP / PS1 mice were randomly divided into 5 groups, with 16 mice in each group, 8 males and 8 females, including AD control group, YXL1 / YXL2 phage immunization group, pcDNA Aβ 25-35 Immunization group and pcDNA Aβ 3-10 For the immunization group, 10 wild-type mice of the same age on a C57 / BL6J background served as the WT control group;
[0078] All mice were first immunized at intervals of 2 weeks, and then at intervals of 4 weeks after the third immunization, for a total of 7 immunizations, all by subcutaneous injection; among them, the YXL1 / YXL2 phage immunization group received 1×10 11 pfu YXL1 / YXL2 phage vaccine, pcDNAAβ 25-35 Immunization group and pcDNA Aβ 3-10 The immunization groups received 100 μg of the corresponding pcDNA vector vaccine, while the WT and AD control groups received the same volume of PBS and aluminum hydroxide adjuvant mixture each time. Starting from the second immunization, blood samples were collected from the mice's orbits 10 days after each immunization.
[0079] Example 4
[0080] Detection of Aβ-specific antibody titer and antibody IgG typing in mouse serum, including:
[0081] For the blood samples collected in Example 3, all were allowed to stand at room temperature for 2 hours, then centrifuged at 1000 g for 15 minutes, the supernatant was aspirated, and the samples were stored at -80°C. The Aβ-specific antibody titer in the serum was detected by ELISA. At the same time, HRP-conjugated anti-mouse IgG2a and IgG2b antibodies were used as secondary antibodies to detect the levels of different IgG types.
[0082] The results are as follows Figure 2As shown in Figure 2, after multiple immunizations, it can be observed that each vaccine group can induce the production of high levels of Aβ-specific antibodies in APP / PS1 mice. Figure 2 As shown in Figure A, phage vaccines YXL1 and YXL2 showed higher levels of Aβ antibody induction ability compared to the two recombinant gene vaccines; Aβ antibody typing results showed that the vaccine mainly induced the production of IgG1 antibodies, such as Figure 2 As shown in Figures B and C, the Th2 immune response is dominant, and its possibility of inducing inflammatory response is relatively low, which is conducive to safety assessment.
[0083] Example 5
[0084] Binding capacity of vaccine-induced Aβ-specific antibodies
[0085] The ability of Aβ antibodies induced by each vaccine group to bind to different forms of Aβ was evaluated by frozen sections of AD mouse brains and ELISA.
[0086] Frozen sections of AD mouse brains were pretreated with hydrogen peroxide solution and 10% horse serum, and then incubated with serum from the WT control group, serum from the AD control group, and serum obtained after immunization with the four vaccines. Finally, Aβ plaque staining in the brain was observed after DAB staining. The results are shown in Figure 2. Figure 3 As shown in Figure A, the sera of mice immunized with the four vaccines were able to specifically bind to Aβ plaques in the brains of AD mice, indicating that the Aβ-specific antibodies induced by the vaccine have the ability to recognize and bind to Aβ plaques in the brain; Figure 3 The scale bars in all figures are 200 μm;
[0087] The affinity of serum Aβ antibodies to Aβ monomers, Aβ oligomers and Aβ fibers in each group of mice was tested by ELISA. Figure 3 As shown in Figure B, vaccine-induced antibodies can simultaneously recognize Aβ monomers, oligomers, and fibrils.
[0088] Example 6
[0089] Behavioral evaluation of APP / PS1 mice after vaccination:
[0090] In Example 3, all mice underwent behavioral testing (open field test, novel object recognition test, Y maze test, and water maze test) after the last booster immunization to evaluate the effects of the four constructed Aβ vaccines on learning and memory, autonomic activity, and mental state of AD mice;
[0091] (1) Open field test: The open field box was 40 cm high and 50 cm long. Each mouse was placed in the center of the open field at the same direction and angle and allowed to freely explore the environment for 5 min. The total distance moved (cm) and the time spent in the center of the field (s) were recorded.
[0092] (2) Novel object recognition experiment: The novel object recognition experiment was conducted over three days. On the first day, mice were allowed to freely explore the environment in the open field box for 5 minutes. On the second day, two identical objects A and B were placed in two corners on the same side of the open field box, and mice were then placed in the box for testing. Each test lasted 5 minutes. On the third day, object B was replaced with a new object C, and the mice were tested again for 5 minutes. Recognition memory was tested by exposing mice to a familiar object and a new object. The time the mice spent exploring and sniffing each object was recorded.
[0093] (3) Y-maze experiment: The Y-maze apparatus consists of three 40 cm equal-length arms, with an angle of 120° between each two arms, and all arms remain open. Mice were placed at the end of a specific arm of the Y-maze and allowed to explore freely for 7 min. The order and number of times the mice entered each maze arm were recorded.
[0094] (4) Water maze experiment: A platform was placed in a 120 cm diameter round iron pool, and the water level was such that the platform was submerged 1 cm. All mice underwent three rounds of learning every day until all mice could learn to find the platform. After the learning phase, the platform was removed and the mice were allowed to explore the pool for 30 s. The time the mice stayed in the correct quadrant (s) and the latency to find the platform (s) were recorded.
[0095] Behavioral results such as Figure 4 As shown in the figure, we explored the effects of each vaccine group on learning and memory in APP / PS1 mice through Y-maze test, novel object recognition test and water maze test; the results showed that in the water maze, which is a classic test for exploring spatial memory in mice, Figure 4 As shown in Figures D to H, phage vaccines YXL1 and YXL2 showed good effects. The phage vaccines YXL1 and YXL2 could significantly reduce the platform-finding latency of mice during the training period (p < 0.01). After the platform was withdrawn, the platform-finding latency of the immunized mice tended to decrease compared with the AD control group, and the time they stayed in the correct quadrant increased, and the number of platform crossings increased. At the same time, in the Y maze experiment, Figure 4 As shown in Figure C, the accuracy rate of YXL2-immunized mice increased significantly compared with the AD control group (p<0.05), while in the NOR novel object recognition experiment, Figure 4 As shown in Figure B, pcDNA Aβ 3-10 There was a significant difference in the recognition index between immunized mice and AD mice (p<0.01);
[0096] In summary, except for pcDNA Aβ 25-35Vaccines, each group of vaccines can effectively improve the learning and memory impairment of APP / PS1 mice, especially the phage YXL2 vaccine showed a better improvement effect on the learning and memory impairment of APP / PS1 mice; at the same time, the results of the open field test showed that Figure 4 As shown in Figure A, none of the four vaccine groups had a significant effect on the mice's autonomous behavior and mental state, which was in line with expectations.
[0097] Example 7
[0098] Detection of the effect of vaccine on Aβ plaque deposition in the brain of APP / PS1 mice
[0099] To investigate the effects of each vaccine group on brain Aβ pathology in APP / PS1 mice, the Aβ plaque burden in the cortex and hippocampus of mice was assessed, e.g. Figure 5 、 Figure 6 As shown; Figure 5 The scale bars in all figures are 200 μm;
[0100] Anti-human Aβ monoclonal antibody D54D2 was used for immunolabeling and thioflavin S was used for fluorescence labeling to assess the load of diffuse and mature / fibrillar Aβ plaques. The results showed that no Aβ plaques were detected in the brains of WT mice, while obvious D54D2 was observed in the cortex and hippocampus of AD mice. + Aβ and ThS + Aβ plaques. Compared with AD mice, each vaccine group can reduce the deposition of Aβ plaques in the brain; among them, D54D2 in the hippocampus of YXL2-immunized mice + Aβ and ThS + The Aβ plaque burden was significantly reduced (p<0.05), and the D54D2 + Aβ and ThS + Aβ plaque burden also showed a downward trend compared with AD mice, and YXL1 and pcDNA Aβ 3-10 Vaccines are effective in clearing ThS + Aβ plaque burden also showed a significant effect (p < 0.05), while pcDNA Aβ 25-35 The effectiveness of the vaccine is still not very significant;
[0101] In summary, each group of vaccines can reduce the deposition of Aβ plaques in the brain, and the Aβ plaque clearance effect of YXL2 vaccine is more significant.
[0102] Example 8
[0103] Evaluation of the effects of vaccines on abnormally proliferating astrocytes and microglia during AD
[0104] Literature reports that GFAP + Astrocytes and Iba1+ Excessive activation of microglia is often involved in the pathological process of AD, promoting the occurrence and development of amyloid lesions, inflammation, neuronal loss, cognitive impairment, etc. Therefore, GFAP expression in the brain (cortex and hippocampus) of APP / PS1 mice was detected by immunofluorescence. + Astrocytes and Iba1 + The number and distribution of microglia were evaluated, and the results were as follows Figure 7 、 Figure 8 、 Figure 9 As shown; Figure 7 、 Figure 8 The scale bars in all figures are 100 μm.
[0105] The evaluation results showed that compared with the WT control group, the number of astrocytes and microglia in the cortex and hippocampus of AD mice increased significantly (p < 0.001 ~ 0.01), and the vaccines in each group showed no significant effect on cortical astrocytes, but significantly reduced the number of microglia in the cortex and hippocampus of mice and the number of astrocytes in the hippocampus, effectively inhibiting the abnormal proliferation of astrocytes and microglia in the brain of AD mice. Among them, the vaccines YXL2 and pcDNA Aβ 25-35 The effect is more obvious.
[0106] Example 9
[0107] Evaluation of the effect of vaccines on brain inflammation in APP / PS1 mice
[0108] The levels of inflammatory factors (TNF-α, IL-1β) in the brain tissue homogenates of mice in each group were detected by ELISA kit to evaluate the safety of the vaccine; the results were as follows: Figure 10 The results showed that compared with WT mice, the levels of TNF-α and IL-1β in the brains of AD mice were significantly increased (p<0.05), while the levels of TNF-α and IL-1β in the brains of immunized mice in each group showed a downward trend compared with the AD control group, indicating that the vaccines in each group did not trigger excessive inflammatory reactions, met the safety assessment, and could alleviate the excessive inflammatory reactions caused by AD to a certain extent.
[0109] Example 10
[0110] Detection of cerebral hemorrhage by Prussian blue staining of mouse brain tissue
[0111] Perls staining kit (G1422; Solarbio) was used to detect intracerebral hemorrhage in mice. The Prussian blue-positive contours of the entire hemibrain section were counted, and the average value of each section was calculated; the results are shown in Figure 11 As shown, Figure 11The scale bars of the figures are all 100 μm. Compared with the WT control group, the number of Prussian blue positive particles in the brain of AD mice increased significantly, indicating that AD mice had cerebral hemorrhage. 3-10 The number of Prussian blue positive particles in the brain of mice after intervention was significantly reduced (p<0.05), indicating that the vaccine YXL2 and pcDNA Aβ 3-10 It can reduce cerebral hemorrhage in AD mice, which may be related to the vaccine's effective removal of Aβ plaque deposition in the brain and relief of brain inflammation; and YXL1 and pcDNA Aβ 25-35 The number of Prussian blue-positive particles in the brains of immunized mice also showed a downward trend compared with AD mice, and intracerebral hemorrhage was not aggravated.
[0112] The results showed that the vaccines in each group did not cause obvious cerebral hemorrhage pathology, which was in line with the safety assessment. 3-10 It plays a positive role in improving the pathology of cerebral hemorrhage in AD mice.
[0113] Example 11
[0114] Detect the effects of the preferred vaccine YXL2 on the levels of neurons, synapse-related proteins SYP, PSD-95, and Tau proteins in the brains of APP / PS1 mice
[0115] Based on the results of the above examples, it can be considered that among the four Aβ vaccines constructed, the YXL2 vaccine exhibits a more significant effect in APP / PS1 mice. It can induce the production of higher titers of Aβ-specific antibodies, mediate the clearance of Aβ in the brain cortex and hippocampus, improve learning and memory impairment in APP / PS1 mice, inhibit the abnormal proliferation of astrocytes and microglia, reduce the content of inflammatory factors in the brain, and effectively improve cerebral hemorrhage. Therefore, the YXL2 vaccine will be used for further research and optimization in the future.
[0116] Furthermore, the effects of the preferred vaccine YXL2 on the levels of neurons, synaptic-related proteins SYP, PSD-95, and phosphorylated Tau protein in the brains of APP / PS1 mice were examined; beta-amyloid protein is highly neurotoxic and can cause damage to brain neurons and synapses in vivo, and cause excessive phosphorylation of the microtubule-associated protein Tau protein, thereby aggravating cognitive impairment. Figure 12 As shown, Figure 12 The scale bars in the figures are 100 μm. Compared with WT mice, APP / PS1 mice showed obvious neuronal loss in the cortex and hippocampal CA1 regions, while YXL2 immunization could significantly maintain neuronal survival in APP / PS1 mice, p < 0.01-0.05. In addition, Figure 13As shown in Figures A to F, compared with AD mice, the levels of presynaptic protein SYP and postsynaptic protein PSD95 in the brains of YXL2-immunized mice were increased, which can prevent synaptic damage caused by AD; and the WB results of phosphorylated Tau protein are as shown in Figures Figure 13 Figures G to K show that compared with the WT control group mice, the phosphorylated Tau protein (p-tauT181, p-tauS396) in the cortex and hippocampus of AD mice were significantly increased (p<0.05), and the vaccine YXL2 could significantly inhibit the hyperphosphorylation of Tau protein in AD mice (p<0.01~0.05), providing a basis for its effective improvement of the course of AD.
[0117] The four vaccines obtained by the preparation method of the Aβ vaccine for preventing and treating Alzheimer's disease disclosed in the embodiment of the present invention can induce the formation of strong Aβ in AD mice. 1-42 Specific humoral immune response mediates the clearance of Aβ plaques in the brains of AD mice and improves cognitive function, effectively inhibits the abnormal proliferation of microglia and astrocytes in the brains of AD mice, and tends to promote the shift of cellular immune response towards Th2, without causing obvious inflammatory response, cerebral hemorrhage and mental and behavioral abnormalities. It has better effectiveness and safety than traditional vaccines.
[0118] The technical solutions and technical details disclosed in the embodiments of the present invention are merely illustrative of the inventive concept of the present invention and do not constitute a limitation on the technical solutions of the embodiments of the present invention. Any conventional changes, replacements or combinations of the technical details disclosed in the embodiments of the present invention have the same inventive concept as the present invention and are within the scope of protection of the claims of the present invention.
Claims
1. An Aβ vaccine for preventing and treating Alzheimer's disease, characterized in that: The Aβ vaccine includes a phage vaccine and a recombinant gene vaccine; wherein: The phage vaccines include the YXL1 vaccine obtained by integrating the gene sequence shown in SEQ ID NO: 001 as the target gene into the pCOMB3X phage coat protein PIII, and the YXL2 vaccine obtained by integrating the gene sequence shown in SEQ ID NO: 002 as the target gene into the pCOMB3X phage coat protein PIII; The recombinant gene vaccine comprises pcDNA Aβ obtained by integrating the gene sequence shown in SEQ ID NO: 003 as the target gene into the pcDNA vector. 3-10 Vaccine, and pcDNA Aβ obtained by integrating the gene sequence shown in SEQ ID NO: 004 as the target gene into the pcDNA vector 25-35 vaccine.
2. The Aβ vaccine for preventing and treating Alzheimer's disease according to claim 1, characterized in that The Aβ vaccine further comprises at least one of a pharmaceutically acceptable adjuvant and an excipient.
3. The Aβ vaccine for preventing and treating Alzheimer's disease according to claim 2, characterized in that The adjuvant is at least one of aluminum hydroxide, aluminum phosphate, aluminum sulfate, 3-de-O-acylated monophosphoryl lipid A (MPL), QS-21, TQL1055, QS-18, QS-17, QS-7, oil-in-water emulsion, CpG, polyglutamic acid, polylysine, and AddaVaxTM, or a combination of two or more thereof.
4. The Aβ vaccine for preventing and treating Alzheimer's disease according to claim 2, characterized in that The dosage forms of the Aβ vaccine include oral dosage, injection or aerosol inhalation.
5. A method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, characterized in that: include: The triple copy of Aβ 3-10 The gene fragment was integrated into the pCOMB3X phage coat protein PIII to obtain the YXL1 vaccine.
6. A method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, characterized in that: include: The triple copy of Aβ 25-35 The gene fragment was integrated into the pCOMB3X phage coat protein PIII to obtain the YXL2 vaccine.
7. A method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, characterized in that: include: The quadruple copies of Aβ 3-10 The gene fragment was recombined with the GRP94 (no KDEL) gene fragment to obtain pcDNA Aβ 3-10 vaccine.
8. A method for preparing an Aβ vaccine for preventing and treating Alzheimer's disease, characterized in that: include: Double copies of Aβ 25-35 The gene fragment was recombined with the GRP94 (no KDEL) gene fragment to obtain pcDNA Aβ 25-35 vaccine.