Bacillus capable of tolerating various organic solvents and application thereof

By screening and transforming the Bacillus YL23 strain that is resistant to high temperature and high concentration organic solvents, the strict requirements on raw materials and conditions in industrial microbial fermentation are solved, and the efficient production of L-alanine and proteases is achieved under high temperature, high acid and high concentration organic solvents are achieved, and the efficiency and economicality of biomanufacturing are improved.

CN120519332APending Publication Date: 2025-08-22MICROCYTO BIOTECHNOLOGY (BEIJING) CO LTD
View PDF 0 Cites 3 Cited by

Patent Information

Application Number
CN202510717736.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-30
Publication Date
2025-08-22

AI Technical Summary

Technical Problem

The existing industrial microbial fermentation lacks strains that tolerate organic solvents such as high temperature, high concentrations of alcohols and acids, which leads to strict requirements on raw materials, products and processes in the fermentation production process, making it difficult to use low-cost alternative raw materials such as methanol for efficient biomanufacturing.

Method used

A high-temperature, high-concentration organic solvent, acid-resistant Bacillus sp.YL23 strain (CGMCC NO.29579) was screened and obtained, and applied it to industrial fermentation. Recombinant strains were constructed by introducing alanine dehydrogenase encoding genes, and target products such as L-alanine and protease were produced under high-temperature, high-acid, and high-concentration organic solvent conditions.

Benefits of technology

It realizes efficient production of L-alanine and protease under high temperature, high acid and high concentration organic solvents, reduces the cost of fermentation production and dependence on raw materials, and improves the conversion rate and production efficiency of biomanufacturing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses bacillus capable of tolerating various organic solvents and application of the bacillus. The invention provides a bacillus sp. YL23 strain, and the preservation number of the bacillus sp. YL23 strain is CGMCC (China General Microbiological Culture Collection Center) NO.29579. Also provided is the use thereof in the preparation of recombinant microorganisms for industrial fermentation. YL23 has potential application value in the technical field of industrial biology, including that substitute raw materials such as xylose can be utilized to ferment and produce target chemicals under acidic and high-temperature conditions. The characteristic can realize high-temperature production in the field of fermentation, and the processes of sterilization and the like are reduced. Meanwhile, the acid fermentation condition and the good organic solvent tolerance characteristic are beneficial to accumulation of target products such as organic acid.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a Bacillus strain tolerant to multiple organic solvents and application thereof. Background Art

[0002] Bacillus is usually referred to as the genus Bacillus in taxonomy. Bacillus Bacillus is a type of Gram-positive bacterium that produces spores and lives aerobically or facultatively anaerobically. Its spores are highly resistant to heat, radiation, and desiccation. Bacillus is closely associated with human society and has a wide range of applications in industry, agriculture, and medicine. Bacillus can secrete large quantities of enzymes such as amylase and protease. Through screening and genetic modification of Bacillus, industrial strains of Bacillus can be obtained for the production of enzyme preparations. Bacillus has low requirements for the cost of fermentation media and is easy to grow. Because it does not produce endotoxins, it is considered GRAS (Generally Recognized as Safe) and is generally considered safe for use in the production of food ingredients and other products. Bacillus can synthesize active substances that inhibit the growth of pathogens, making it a suitable alternative to antibiotics in agriculture, aquaculture, and other fields. Bacillus can also be used as probiotics and drug surface display carriers in the medical and environmental fields.

[0003] At present, the Bacillus used in industry, agriculture and medicine is mainly concentrated in Bacillus subtilis ( Bacillus subtilis) are relatively well-studied Bacillus species. Discovering Bacillus species that are suited to specialized growth conditions and possess unique metabolic properties will not only expand their application areas but also address challenges in existing Bacillus production and application. In Bacillus fermentation and production of industrial products such as enzymes, vitamins, and amino acids, Bacillus species typically utilize common culture medium raw materials such as glucose. Cultivation is typically performed at room temperature. However, since the primary source of glucose raw materials is corn starch, its price is affected by various factors, including regional location, and is also influenced by policy factors such as competition for grain and land. Furthermore, different products require different fermentation conditions. Higher fermentation temperatures are beneficial for the production of thermophilic enzymes. Tolerance to organic solvents facilitates the production of products such as alcohols and acids, as well as the utilization of alternative raw materials such as methanol and formaldehyde. Both methanol and formaldehyde are inexpensive and readily available organic one-carbon raw materials. They have higher energy densities than raw materials like glucose and can provide more reducing power for biosynthesis, thereby improving conversion rates in biomanufacturing, making them ideal raw materials for biomanufacturing. Methanol is primarily produced synthetically. Currently, methanol is primarily synthesized industrially through pressurized catalytic hydrogenation of carbon monoxide (CO). The raw CO can come from processed products such as coal, petroleum, and natural gas. Alternatively, CO2 hydrogenation coupled with water electrolysis is a potential and highly efficient route for methanol synthesis. The cost of methanol is lower than that of glucose, and only one-fifth that of glycerol.

[0004] Currently, industrial microbial fermentation lacks strains that can tolerate high temperatures, high concentrations of alcohols, acids, and other organic solvents. This leads to stringent requirements for raw materials, products, and processes during fermentation production. Therefore, it is necessary to find a strain that can tolerate high temperatures, high concentrations of alcohols, acids, and other organic solvents and can be used in fermentation production. Summary of the Invention

[0005] The purpose of the present invention is to provide a Bacillus strain tolerant to multiple organic solvents and application thereof.

[0006] In a first aspect, the present invention provides a Bacillus sp. Bacillus sp. YL23 strain, its deposit number is CGMCCNO.29579.

[0007] The Bacillus described above has at least one of the following characteristics: 1) High temperature resistance; In the above, high temperature is greater than or equal to 43°C, and in the embodiment, 43°C or 55°C is specifically used as an example; This strain is resistant to high temperatures and can also grow normally at 37°C, thus having the advantages of being able to undergo genetic modification operations under conventional conditions and being able to be produced under high temperatures.

[0008] 2) Resistance to organic solvents; In the above, organic solvent resistance specifically refers to resistance to high concentration organic solvents. Furthermore, the high concentration is greater than or equal to 5%. In the embodiment, resistance to 5% organic solvents is taken as an example. The organic solvent is specifically acetone, toluene or methanol. 3) Acid resistant.

[0009] In the above, acid resistance specifically refers to growth at a pH value of 2-6, and further, growth at a pH value of 2.

[0010] In a second aspect, the present invention provides the use of the Bacillus described in the first aspect in industrial fermentation; Or, use of the Bacillus described in the first aspect as an industrial fermentation chassis cell to produce a target product; Or, use of the Bacillus described in the first aspect in industrial fermentation production of a target product; Or, use of the Bacillus according to the first aspect in preparing a recombinant microorganism for industrial fermentation.

[0011] In the applications described above, the industrial fermentation conditions are high temperature, organic solvents and / or high acid.

[0012] Furthermore, the industrial fermentation is to ferment the strain or the recombinant bacteria constructed with the strain as the base cell to produce the desired product or target product under high temperature, organic solvent and / or high acid conditions; The recombinant bacteria are obtained by introducing genes required for the production of the target product into the strain serving as the chassis cell.

[0013] In the embodiments of the present invention, taking the industrial fermentation production of L-alanine as an example, specifically, the strain described in the first aspect is used as a base cell to introduce an alanine dehydrogenase encoding gene to produce L-alanine under high acid (pH 2) and high temperature (55°C) conditions.

[0014] The above-mentioned recombinant microorganism for industrial fermentation is obtained by introducing the alanine dehydrogenase encoding gene (SEQ ID NO: 2) into the strain described in the first aspect to obtain a recombinant bacterium expressing alanine dehydrogenase.

[0015] The target product is exemplified by L-alanine; The target product is exemplified by protease, further alkaline protease.

[0016] The organic solvent is acetone, toluene or methanol; The organic solvent is a high concentration of organic solvent, specifically, the concentration of the organic solvent in the system is greater than or equal to 5%; The high temperature is greater than or equal to 37°C; The high acid has a pH value of less than or equal to 6.

[0017] In a third aspect, the present invention provides a method for culturing or fermenting the Bacillus described in the first aspect or a recombinant bacterium constructed using the Bacillus as a chassis cell, comprising the following steps: culturing or fermenting the Bacillus described in the first aspect or a recombinant bacterium constructed using the Bacillus as a chassis cell in an organic solvent under high temperature or high acid conditions; The carbon source used in the culture or fermentation is at least one of glucose, fructose, sucrose, xylose, arabinose, mannitol and sorbitol; The target product is exemplified by L-alanine; The target product is exemplified by protease, further alkaline protease.

[0018] The organic solvent is acetone, toluene or methanol; The concentration of the organic solvent in the system is greater than or equal to 5%; The high temperature is greater than or equal to 37°C; specifically 43°C or 55°C; The high acid has a pH value less than or equal to 6, and a specific pH value is 5, 4.5, 4, 3.5, 3, 2.5 or 2.

[0019] In a fourth aspect, the present invention provides a method for producing a target product using the Bacillus described in the first aspect as a chassis cell, comprising the following steps: 1) introducing a gene encoding a protein related to the production of a target product into the Bacillus described in the first aspect to obtain a recombinant bacterium; 2) fermenting the recombinant bacteria under high acid and / or high temperature conditions to produce the target product.

[0020] In the above method, the high acid condition is that the pH value of the fermentation system is 2; The high temperature condition is 55°C.

[0021] The carbon source for the fermentation is xylose.

[0022] The target product is L-alanine; The gene related to the production of the target product is an alanine dehydrogenase encoding gene.

[0023] The nucleotide sequence of the alanine dehydrogenase encoding gene is sequence 2.

[0024] In a fifth aspect, the present invention provides a method for producing a target product by fermenting the Bacillus described in the first aspect, comprising the following steps: fermenting the Bacillus described in the first aspect under high concentration organic solvent and / or high temperature conditions to produce the target product; The high concentration organic solvent refers to an organic solvent having a concentration greater than or equal to 5% in the fermentation system; The high temperature is 55°C.

[0025] The organic solvent is methanol.

[0026] The target product is protease.

[0027] Experiments conducted in this study have demonstrated that the strain YL23, obtained through screening, is tolerant to high temperatures and high concentrations of organic solvents. It can rapidly accumulate biomass using a variety of carbon sources, including xylose. It can tolerate high temperatures (55°C), high concentrations of organic solvents (such as 5% acetone, toluene, and methanol), and high acidity (pH = 2), and it can also be effectively genetically edited. These properties suggest that YL23 has potential applications in industrial biotechnology, including the ability to ferment alternative feedstocks such as xylose to produce target chemicals under acidic or high-temperature conditions. For example, it could serve as a base for L-alanine production. This characteristic enables high-temperature production in fermentation, reducing sterilization and other processes. Furthermore, the acidic fermentation conditions and good organic solvent tolerance facilitate the accumulation of target products, such as organic acids.

[0028] Preservation Instructions Bacteria name: Bacillus Latin name: Bacillus sp. Strain ID: YL23 Classification name: Bacillus Bacillus sp. Depository: General Microbiology Center of China Culture Collection Administration Abbreviation of depository institution: CGMCC Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing Deposit date: January 12, 2024 CGMCC registration number: CGMCC No.29579 BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 This is the colony morphology of Bacillus YL23.

[0029] Figure 2 is the tolerance of YL23 strain to different organic solvents.

[0030] Figure 3 The growth of YL23 strain under different culture conditions. DETAILED DESCRIPTION

[0031] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0032] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0033] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0035] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0036] Unless otherwise specified, the percentages in the following examples are by mass.

[0037] Escherichia coli BW25113 was kindly donated by the group of Yong Tao at the Institute of Microbiology, Chinese Academy of Sciences. It is disclosed in the document "Xiaoyu Piao, Lei Wang, Baixue Lin, Hao Chen, Weifeng Liu, Yong Tao. Metabolic engineering of Escherichia coli for production of L-aspartate and its derivative β-alanine with high stoichiometric yield. Metabolic Engineering. 2019 54:244-254." The public can obtain the above-mentioned biological material from the applicant. The obtained biological material is only for use in repeating the experiments of the present invention and cannot be used for other purposes.

[0038] Plasmid pHP13 (Genebank No. DQ297764.1, 07-APR-2006) can be constructed by total gene synthesis. Plasmid pUC57 is a product of Shanghai Dibai Biotechnology Co., Ltd., catalog number S201464A.

[0039] Bacillus subtilis NT is preserved in our laboratory and is available to the public from institutions such as the China Industrial Culture Collection Center (No. CICC 24713).

[0040] The culture medium used for Bacillus YL23 culture is as follows: The basic nutrient medium formula is: 1% tryptone, 0.5% yeast powder, 0.5% NaCl, the balance is water, pH 7.0.

[0041] The screening medium formula is: 1% tryptone, 0.5% yeast powder, 0.5% NaCl, 1% acetone, 1% ethanol, the balance is water, and the pH is natural.

[0042] Complete nutrient medium is prepared by adding sucrose to the basal nutrient medium to a final concentration of 10%.

[0043] The basic growth medium formula is as follows: 1L contains: 8.5 g Na2HPO4·2H2O, 3 g KH2PO4, 2.4 gNH4Cl, 0.5 g NaCl, 0.246 g MgSO4·7H2O, 1.7 mg ZnCl2, 0.43 mg CuCl2·2H2O, 0.6 mgCoCl2·6H2O, 0.6 mg Na2MoO4·2H2O, 1.11 mg CaCl2, 4.3 mg FeCl2, 0.5 g yeast powder, 0.5 mg vitamin B1, 0.05 mg riboflavin, and the balance is water, pH 7.0.

[0044] The growth medium is a basic growth medium supplemented with carbon sources at different concentrations.

[0045] The culture medium used for Escherichia coli was LB medium.

[0046] LB medium contained the following components: 1% tryptone, 0.5% yeast extract, 1% NaCl, and the remainder was water, pH 7.0.

[0047] Plasmids constructed during genetic manipulation of Bacillus are constructed in Escherichia coli DH5α. E. coli is typically grown at 37°C in liquid or solid Luria-Bertani (LB) medium supplemented with appropriate antibiotics. The pUC18 plasmid (Genebank sequence number L08752.1, 27-APR-1993) is used as a helper plasmid during genetic manipulation and can be constructed using whole-genome synthesis.

[0048] E. coli plasmid transformation was performed using the CaCl2 transformation method, and E. coli chromosome editing was performed using the electroporation method. The relevant methods can be performed according to the literature (Molecular Cloning: A Laboratory Manual (Fourth Edition). ISBN978-1-936113-42-2).

[0049] The genomic DNA of the strain was extracted using a bacterial DNA rapid extraction kit (Quanshijin Biotechnology, product number EE161-01), which is referred to as the genomic extraction kit in the following examples.

[0050] DNA gel recovery was performed using a small agarose gel DNA recovery kit (Zhuangmeng Biotechnology, product number ZP202-3), referred to as the gel recovery kit in the following examples.

[0051] Gibson assembly was performed using 2× MultiF Seamless Assembly Mix (Wuhan Abotek Biotechnology Co., Ltd., catalog number RK21020), which is referred to as the Gibson assembly kit in the following examples.

[0052] Example 1. Discovery of Bacillus YL23 1. Isolation and acquisition of strain YL23 Soil samples were collected from various locations, including the Nanjing Chemical Industrial Park, and mixed. 1 g of each sample was weighed and added to 50 mL of sterile saline. The sample was shaken with glass beads for 30 minutes. A 50 μL aliquot was transferred to 100 mL of screening medium and incubated at 40°C until the OD600 reached 0.5. 100 μL of the culture was transferred back to 100 mL of screening medium and incubated at 40°C for 20 hours. The aliquot was then plated onto a plate containing the screening medium and incubated at 40°C until a single colony formed. A single colony with large colonies was selected. One strain, which exhibited excellent resistance to organic solvents and wide temperature adaptability, was designated YL23.

[0053] 2. Morphological identification of strain YL23 Strain YL23 was inoculated onto solid LB medium plates and cultured at 37°C for 20 h. The colony morphology was observed. The colonies were milky white, round, with neat edges and a smooth surface.

[0054] The morphology of strain YL23 under optical microscope is as follows Figure 1 As shown, it can be seen that the strain shows a short rod-shaped morphology of Bacillus and is Gram-positive.

[0055] 3. 16s rDNA identification of YL23 Strain YL23 was inoculated into liquid LB medium and cultured at 37°C for 20 hours. After harvesting the cells, genomic DNA from strain YL23 was extracted using a genomic extraction kit. Using the YL23 genome as a template, PCR amplification was performed with primers 27F (sequence: 5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (sequence: 5'-GGTTACCTTGTTACGACTT-3') to obtain 16s rDNA. The nucleotide sequence was sequenced and is shown as SEQ ID NO: 1.

[0056] After comparison, the sequence was blasted on NCBI and the similarity with the existing Bacillus sequence was 98%.

[0057] Strain YL23 was deposited on January 12, 2024, at the General Microbiology Center of the China Culture Collection Administration Committee. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC NO.29579. Its classification name is Bacillus Bacillus sp. .

[0058] Example 2: Carbon source utilization level of Bacillus YL23 Single colonies of Bacillus YL23 and the control strain Bacillus NT were inoculated into liquid basal nutrient medium containing 1% glucose and cultured at 200 rpm at 37°C for 20 hours to obtain seed liquid. The seed liquid was diluted with physiological saline to an OD600 of 0.05 and then transferred to growth medium containing 1% of different carbon sources. The inoculation volume was 100 μL and the cells were cultured at 43°C for 24 hours. The OD600 was then measured. The utilization level was determined based on the OD600. An OD600 greater than 1 indicates good carbon source utilization (+++).

[0059] The carbon sources are glucose, fructose, sucrose, xylose, arabinose, mannitol, sorbitol, ethanol, formic acid and acetic acid, respectively, and the concentration (mass percentage) of the carbon sources in the growth medium is 1%.

[0060] Basal growth medium without carbon source was used as control.

[0061] The results are shown in Table 1. Compared with the control strain Bacillus NT, Bacillus YL23 can well utilize raw materials such as glucose, fructose, sucrose, xylose, arabinose, mannitol and sorbitol.

[0062] Table 1 shows the results of carbon source utilization level

[0063] Example 3. Ability of Bacillus YL23 to tolerate stress conditions 1. Organic solvent tolerance After activation, strain YL23 and the control strain NT were inoculated into basal nutrient medium at an inoculum size of 2%. Different organic solvents (acetone, toluene, and methanol) were added to different final concentrations (volume percentage). The OD600 was measured after static culture at 43°C for 48 hours.

[0064] The results are as follows Figure 2As shown, YL23-M: growth of strain YL23 in methanol; YL23-A: growth of strain YL23 in acetone; YL23-T: growth of strain YL23 in toluene; NT-M: growth of strain NT in methanol; NT-A: growth of strain NT in acetone; NT-T: growth of strain NT in toluene. It can be seen that the biomass of Bacillus YL23 in 5% methanol, acetone, and toluene was significantly higher than that of the control strain Bacillus NT, indicating that it has good tolerance to high-concentration organic solvents.

[0065] 2. Temperature tolerance After the strain YL23 was activated, it was inoculated into a basic nutrient medium at an inoculum size of 2%, and statically cultured at 37°C, 43°C, and 55°C for 48 hours, and then the OD600 was measured.

[0066] 3. Acid tolerance After activation, strain YL23 and control strain NT were inoculated into basal nutrient medium at an inoculum size of 2%, and the pH was adjusted to 5, 4.5, 4, 3.5, 3, 2.5, and 2 with lactic acid. The OD600 was measured after static culture at 37°C for 48 hours.

[0067] Temperature resistance and acid resistance results are as follows Figure 3 As shown, it can be seen that Bacillus YL23 can tolerate high temperature (55°C) and acid (pH 2.0).

[0068] Further expansion of the pH and temperature ranges for YL23 cultivation revealed that the OD of Bacillus YL23 reached 0.72 at pH 2, 50% of that at pH 7. YL23 failed to grow at pH below 1, while the control strain, Bacillus NT, failed to grow at pH below 4. YL23 also failed to grow at temperatures above 70°C, and NT failed to grow at temperatures above 55°C.

[0069] Example 4: Production of L-alanine using YL23 strain as chassis cells under acidic conditions 1. Bacillus YL23 electroporation plasmid: a. Prepare competent cells: Take Bacillus YL23 strain from the freeze-dried tube and inoculate it into 100 mL of basal nutrient medium. Grow at 37°C for 16 hours to obtain a culture. Transfer 2 mL of the culture into 100 mL of complete nutrient medium (basic nutrient medium supplemented with 10% sucrose at a final concentration) and continue growing at 37°C until the OD reaches 0. 600= 0.25. Centrifuge at 3,000 g for 5 min to harvest the cells, wash twice in 3.5 ml of EP buffer (1 mM HEPES, 25% polyethylene glycol 8000, pH 7.0), and resuspend in 0.2 ml of EP buffer. After treatment with liquid nitrogen, competent cells were obtained. Store at 80°C.

[0070] b. Electroporation: Competent cells (100 μL) were mixed with approximately 1 μg of pHP13 plasmid and incubated on ice for 30 min. The mixture was transferred to a pre-chilled electroporation cuvette (0.2 cm; Bio-Rad Laboratories) and electroporated using a Bio-Rad Gene-Pulser (200 Ω; 25 μF; 2.5 kV).

[0071] c. Recovery culture: After electroporation, culture the cells in 5 mL of nutrient medium at 37°C for 16 h. Transfer 4 mL of the cell culture to 100 mL of complete nutrient medium supplemented with chloramphenicol and continue incubating at 37°C for 6 h. Spread the culture onto solid basal complete nutrient medium containing chloramphenicol and incubate at 37°C overnight to obtain a recovered bacterial plate.

[0072] d. Strain preservation: Pick a single colony from the plate and transfer it to a shake flask containing 100 mL of growth medium with antibiotics and 1% glucose. Incubate at 37°C overnight, add 15% glycerol to preserve the culture, and store at -80°C.

[0073] The results showed that YL23 transformed with pHP13 plasmid could obtain 10 3 / μg positive clones.

[0074] 2. Construction of plasmid pHPAlaD: The artificially synthesized gene fragment AD fragment (SEQ ID NO: 2) contains the P43 promoter (SEQ ID NO: 1-461) and the Rrn terminator (SEQ ID NO: 1581-1738), and the alanine dehydrogenase AlaD (SEQ ID NO: 462-1580) from Geobacillus stearothermophilus.

[0075] The fragment containing the P43-alaD-TRrn expression cassette was amplified by PCR using primers AF (tgtcgacgtgcatgcaggccggggcatatg) and AR (aaggcccagtctttcgactgagcctttcgt) and the synthetic AD fragment as a template. The target fragment was recovered by agarose gel electrophoresis.

[0076] The plasmid backbone was amplified by PCR using primers HPF (ggcctgcatgcacgtcgacaaagcttggcgtgtcgacgtgcatgcaggccggggcatatg) and HPR (cagtcgaaagactgggccttgttttacaacaaggcccagtctttcgactgagcctttcgt) using plasmid pHP13 as a template. The target fragment was recovered by agarose gel electrophoresis. DNA fragments were assembled using the Gibson kit, and the two fragments were ligated to obtain a ligation product.

[0077] The ligation product was transformed into competent E. coli DH5α cells using the CaCl2 method. The cells were evenly plated on LB plates containing ampicillin and cultured overnight at 37°C. Clones were selected and identified using primers HF1 (atgaccatgattacgccaagctt) / AR to amplify the target fragment (1800 bp). These clones were sequenced, and the target fragment of the positive clones was approximately 2400 bp. Plasmids were extracted from the selected positive clones, and the resulting plasmid was named pHPALaD.

[0078] According to the method in 1 above, pHPAlaD was transformed into YL23 to obtain strain YL-D.

[0079] 3. Synthesize L-alanine using YL-D: The overnight cultured YL-D was inoculated into a 200 mL shake flask containing 1% (mass percentage) xylose growth medium (pH = 2) at a 1% inoculum size, cultured at 55°C for 48 hours, and the culture product was collected.

[0080] The growth medium containing 1% (mass percentage) xylose is obtained by adding xylose to the growth medium at a final concentration of 1% (mass percentage).

[0081] The culture product was centrifuged at 12,000 g for 10 minutes, and the supernatant was filtered through a 0.22 μM pore size filter. The filtrate was derivatized and analyzed by HPLC for L-alanine content. This experiment was repeated five times in a single flask. For HPLC analysis, 50 μL of the filtered supernatant was first added to 50 μL of a 0.5 M aqueous sodium bicarbonate solution (Aladdin, Catalog No. S112331) and 50 μL of a 1% (v / v) aqueous solution of 2,4-dinitrofluorobenzene (McLean, Catalog No. F830061). The solutions were mixed thoroughly and heated in a 60°C metal bath for 1 hour. Finally, 150 μL of deionized water was added, filtered, and analyzed. L-alanine content was determined using a Shimadzu C18 column (Shim-pack GIST C18 5 μm, 4.6 × 250 mm) (mobile phase: 0.1% formic acid (65%), 100% acetonitrile (35%); flow rate: 1 mL / min; detection wavelength: 350 nm). L-alanine (China Food and Drug Inspection Institutes, catalog number 140680) was used as a standard for qualitative analysis based on the retention time of the standard and for quantitative analysis using a calibration curve (external standard method).

[0082] The results showed that the recombinant strain YL-D prepared using YL23 as the chassis bacteria could produce L-alanine in a supernatant with a yield of 12.76±1.52 g / L under high temperature conditions.

[0083] 4. Production of alkaline protease using YL23 YL23 cultured overnight was inoculated into a 200 mL shake flask containing 0.5% (mass percentage) glucose and 5% (volume percentage) methanol growth medium (pH = 7) at a 1% inoculum size, cultured at 55°C for 48 hours, and the culture product was collected.

[0084] The growth medium containing 0.5% (mass percentage) glucose and 5% (volume percentage) methanol is obtained by adding glucose with a final concentration of 0.5% (mass percentage) and methanol with a final concentration of 5% (volume percentage) to the growth medium.

[0085] The culture product was centrifuged at 12000 g for 10 minutes, and the supernatant was filtered through a 0.22 μM pore size filter membrane. The filtrate was collected to determine the protease activity.

[0086] Protease activity was determined using the following method: After the filtrate was diluted to a desired concentration, 1 mL was added to 2 mL of a 1% (g:mL) casein solution in glycine-NaOH buffer (pH 8) and incubated at 60°C for 10 minutes. Then, 3 mL of 10% trichloroacetic acid (TCA) was added and the mixture was allowed to stand at room temperature for 30 minutes. Then, 5 mL of alkaline copper reagent was added to 1 mL of the reaction mixture. After 15 minutes, 0.5 mL of Folin-phenol reagent was added and the mixture was allowed to stand for 30 minutes. The absorbance was read at 700 nm. One unit of enzyme activity was defined as the amount of enzyme that releases 1 μg of tyrosine per minute per mL.

[0087] Testing showed that under the above-mentioned high temperature and high organic solvent conditions, YL23 could synthesize 301.2 U / mL of alkaline protease.

[0088] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Bacillus, for Bacillus sp. YL23 strain, its deposit number is CGMCC NO.29579.

2. Use of the Bacillus according to claim 1 in industrial fermentation; Or, use of the Bacillus according to claim 1 as an industrial fermentation chassis cell to produce a target product; Or, use of the Bacillus according to claim 1 in industrial fermentation production of a target product; Or, use of the Bacillus according to claim 1 in preparing recombinant microorganisms for industrial fermentation.

3. The use according to claim 2, characterized in that: The industrial fermentation conditions are high temperature, organic solvents and / or high acid.

4. A method for culturing or fermenting the Bacillus according to claim 1 or a recombinant bacterium constructed using the Bacillus or a recombinant bacterium as a chassis cell, comprising the following steps: culturing or fermenting the Bacillus according to claim 1 or a recombinant bacterium constructed using the Bacillus or a recombinant bacterium as a chassis cell in an organic solvent under high temperature or high acid conditions.

5. A method for producing a target product using the Bacillus sp. of claim 1 as a base cell, comprising the following steps: 1) introducing a gene encoding a protein related to the production of a target product into the Bacillus sp. according to claim 1 to obtain a recombinant bacterium; 2) fermenting the recombinant bacteria under high acid and / or high temperature conditions to produce the target product.

6. The method according to claim 5, characterized in that: The high acid condition is that the pH value of the fermentation system is 2; The high temperature condition is 55°C.

7. The method according to claim 5 or 6, characterized in that: The target product is L-alanine; The gene related to the production of the target product is an alanine dehydrogenase encoding gene.

8. A method for producing a target product by fermenting the Bacillus of claim 1, comprising the following steps: fermenting the Bacillus of claim 1 in a high concentration organic solvent and / or at a high temperature to produce the target product; The high concentration organic solvent refers to an organic solvent having a concentration greater than or equal to 5% in the fermentation system; The high temperature is 55°C; The organic solvent is methanol.

Citation Information

Cited By

  • Construction and application of a strain for synthesizing polyhydroxybutyrate (PHB) from one-carbon compounds.

    CN122357311A

  • An engineered strain for synthesizing 1,3-propanediol and its preparation and application

    CN122668910A

  • Engineering strain for synthesizing l-lysine from one-carbon compounds and application thereof

    CN122686539A