Recombinant escherichia coli for producing astaxanthin and method for synthesizing astaxanthin
By transferring the cyanobacterial deacylase gene CddA into E. coli and induced by IPTG, the problems of low yield and high cost in astaxanthin production were solved, and efficient and low-cost astaxanthin synthesis was achieved, providing a feasible way for industrial production.
Patent Information
- Application Number
- CN202510520209.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-24
- Publication Date
- 2025-08-22
AI Technical Summary
The existing astaxanthin production methods have problems such as low yield, high cost, strong pollution sensitivity and poor antioxidant of optical isomers, which limits their wide application.
By transferring the cyanobacterial deacylase gene CddA into the E. coli BW-ASTA strain, recombinant E. coli was constructed and overexpressed using IPTG to coordinate the resource allocation of bacterial growth and astaxanthin anabolic flow, achieving efficient synthesis of astaxanthin.
It improves the synthesis efficiency of astaxanthin in E. coli, provides a feasible path for green production and industrial production of astaxanthin, and achieves a balance between high yield and low cost.
Smart Images

Figure CN120519359A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of astaxanthin synthesis, and in particular to an astaxanthin-producing recombinant Escherichia coli and a method for synthesizing astaxanthin. Background Art
[0002] Astaxanthin, a potent antioxidant, is widely used in food, medicine, and cosmetics. Astaxanthin's optical isomers, including levorotatory (3S, 3'S), dextrorotatory (3R, 3'R), and meso (3R, 3'S), exist in nature. Different optical isomers may differ in their chemical properties and biological activities. Studies have shown that levorotatory astaxanthin exhibits stronger antioxidant capacity than dextrorotatory astaxanthin.
[0003] Currently, the main methods for obtaining astaxanthin on the market include fermentation with rhodozyma, chemical synthesis, and production with Haematococcus pluvialis. The astaxanthin produced by fermentation with rhodozyma is mainly in the right-hand configuration. This method is relatively environmentally friendly, but the antioxidant properties of its product are not as good as those of L-astaxanthin. It is currently mainly used in the feed industry. The chemical synthesis method can obtain a mixture of astaxanthin containing three different configurations. However, this method is expensive and may involve the risk of residual raw materials or by-products and environmental pollution. In addition, the application of chemically synthesized astaxanthin is also limited to the feed field.
[0004] The astaxanthin produced by Haematococcus pluvialis is mainly L-astaxanthin, but its production cycle is long and the yield is low. In addition, this algae is highly sensitive to pollution (polluting microorganisms induce Haematococcus pluvialis to enter a state of stress), and its growth conditions are difficult to precisely control. These factors lead to a high unit production cost of astaxanthin, limiting its widespread application.
[0005] Given the limitations of these methods, genetic engineering of chassis strains to achieve astaxanthin biosynthesis has emerged as a promising approach. Escherichia coli is widely used in metabolic engineering due to its rapid growth, clear genetic background, and ease of genetic manipulation. However, E. coli itself lacks the ability to synthesize astaxanthin. However, appropriate genetic engineering can enable it to acquire this ability, providing a new and potentially efficient pathway for astaxanthin production. Summary of the Invention
[0006] (1) Technical issues to be resolved
[0007] In view of the above-mentioned problems in the prior art, the present invention provides a recombinant Escherichia coli that produces astaxanthin and a method for synthesizing astaxanthin. By introducing the cyanobacterial deacylase gene CddA into the Escherichia coli BW-ASTA strain, it is overexpressed in Escherichia coli, thereby achieving efficient synthesis of astaxanthin in Escherichia coli, thereby providing a new approach for the industrial production of astaxanthin.
[0008] (2) Technical solution
[0009] In a first aspect, the present invention provides a recombinant Escherichia coli for producing astaxanthin, which is obtained by using the Escherichia coli BW-ASTA strain as a chassis strain and transferring the cyanobacterial deacylase gene CddA into the chassis strain; the nucleotide sequence of the cyanobacterial deacylase gene CddA is shown in SEQ ID NO.1.
[0010] According to a preferred embodiment of the present invention, the construction method of the recombinant Escherichia coli is as follows:
[0011] S1. Amplify the cyanobacterial CddA gene from the cDNA library using PCR;
[0012] S2. Construction of an expression vector for overexpressing the cyanobacterial CddA gene;
[0013] S3. Transform the expression vector constructed in step S2 into the Escherichia coli BW-ASTA strain, screen out transformants, and obtain the recombinant Escherichia coli.
[0014] According to a preferred embodiment of the present invention, the primer pairs used to amplify the cyanobacterial CddA gene are as follows:
[0015] The forward primer is:
[0016] CCGGAATTCATGATTCATCTGATTTATTCTGATCAATTTCTTGA CCA; (see SEQ ID NO. 2)
[0017] The reverse primer is: CCGCTCGAGCTGAGCAAAGGGTTCGAGGGT (see SEQ ID NO. 3).
[0018] According to a preferred embodiment of the present invention, in S2, the target gene fragment amplified in S1 is digested with EcoRI and XhoI, and the target gene fragment is ligated into the pGEX-4T-1 expression vector digested with EcoRI and XhoI using T4 DNA ligase to obtain an expression vector overexpressing the cyanobacterial CddA gene.
[0019] According to a preferred embodiment of the present invention, in S3, the expression vector constructed in S2 is transformed into competent Escherichia coli BW-ASTA cells using a heat shock transformation method, and transformants are screened using agar plates containing ampicillin and chloramphenicol. The transformants are Escherichia coli that have successfully been transformed with the CddA gene.
[0020] In a second aspect, the present invention provides a method for synthesizing astaxanthin, comprising: obtaining astaxanthin by culturing the recombinant Escherichia coli.
[0021] Preferably, the culture process comprises: adding 0.1-0.5 mM IPTG to the culture medium of the astaxanthin-producing recombinant Escherichia coli, and using IPTG to induce overexpression of the CddA gene in the recombinant Escherichia coli, so that the Escherichia coli synthesizes astaxanthin.
[0022] The present invention utilizes IPTG to induce overexpression of the CddA gene in recombinant E. coli. Commonly used expression vectors in E. coli, such as the pET or pGEX series, carry T7 or tac promoters, which are typically regulated by the lac operon. IPTG (isopropyl-β-D-thiogalactopyranoside) can be used to induce expression systems based on the lac operon. For example, when constructing an expression vector to overexpress the cyanobacterial CddA gene, the pGEX-4T-1 expression vector, which carries the tac promoter, can be induced with IPTG to promote target gene expression and astaxanthin synthesis.
[0023] IPTG can be used as a trigger factor for astaxanthin synthesis. Therefore, in actual production, the growth kinetic parameters of E. coli (such as OD 600 , real-time monitoring of the specific growth rate μ), using IPTG to induce Escherichia coli to initiate the synthesis of astaxanthin, and by avoiding the resource competition between the logarithmic growth phase of the bacteria and the exogenous metabolic pathway, the carbon source is directed to the carotenoid synthesis module, ultimately achieving the dual optimization of astaxanthin unit volume yield and production cost-effectiveness.
[0024] (3) Beneficial effects
[0025] The present invention transfers the cyanobacterial CddA gene into Escherichia coli, which carries the pathways required for astaxanthin synthesis, to produce recombinant E. coli capable of efficiently synthesizing astaxanthin. By overexpressing CddA in engineered E. coli, the method improves the efficiency of astaxanthin synthesis in E. coli, providing a viable path for the green and industrialized production of astaxanthin and promising commercial applications.
[0026] The present invention dynamically monitors E. coli growth parameters (cell density, metabolic state) and accurately controls the timing of IPTG induction to coordinate resource allocation between bacterial growth and astaxanthin synthesis metabolic flow, achieving a balance between high yield and low cost. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 Color changes observed with the naked eye after liquid culture of recombinant E. coli carrying the CddA gene, the negative control strain (E. coli BW-ASTA without the CddA gene), and the positive control strain (E. coli BW-ASTA with the β-carotene ketolase gene).
[0028] Figure 2 The expression levels of target genes in recombinant Escherichia coli carrying the CddA gene, the BW-negative control group strain (Escherichia coli BW-ASTA without the CddA gene) and the BKT-positive control group (Escherichia coli BW-ASTA with the β-carotene ketolase gene) were detected based on western-blot.
[0029] Figure 3 These are secondary spectra of mass spectrometry detection of astaxanthin and standard substances in three types of bacteria: recombinant Escherichia coli carrying the CddA gene in liquid culture, the negative control strain (Escherichia coli BW-ASTA without the CddA gene), and the positive control strain (Escherichia coli BW-ASTA with the β-carotene ketolase gene).
[0030] Figure 4 The astaxanthin content in liquid culture of recombinant Escherichia coli carrying the CddA gene, the negative control strain (Escherichia coli BW-ASTA without the CddA gene) and the positive control strain (Escherichia coli BW-ASTA with the β-carotene ketolase gene) was compared. DETAILED DESCRIPTION
[0031] In order to better explain the present invention and facilitate understanding, the present invention is described in detail below through specific implementation methods in conjunction with the accompanying drawings.
[0032] The present invention provides a recombinant Escherichia coli for producing astaxanthin. The recombinant Escherichia coli is obtained by inserting an exogenous cyanobacterial sirtuin encoding gene (CddA) into the genome of the Escherichia coli BW-ASTA strain through genetic engineering technology or allowing the gene to exist in the Escherichia coli in the form of a plasmid. The recombinant Escherichia coli can efficiently synthesize astaxanthin.
[0033] The implementation process of the present invention includes: amplifying the target gene CddA from the cDNA library of cyanobacteria, inserting CddA into an Escherichia coli expression vector (either pET series or pGEX series) using recombinant DNA technology, and transforming the constructed expression vector into the Escherichia coli BW-ASTA strain to obtain recombinant Escherichia coli. The Escherichia coli BW-ASTA strain was first reported by the synthetic biology team of the Massachusetts Institute of Technology (MIT) in 2020. As the core achievement of the "Microbial Synthesis of Astaxanthin" project, related research was published in "Nature Biotechnology". The Escherichia coli BW-ASTA strain can be used as a chassis strain for biosynthesis. It has been engineered to carry the relevant pathways required for astaxanthin synthesis and can synthesize astaxanthin on its own, but its synthesis efficiency is low and its application potential is poor. The E. coli BW-ASTA strain is based on the E. coli BW series (e.g., BW25113), a K-12 derivative strain with the following advantages: (1) genome simplification: knockout of non-essential genes (e.g., lacZ, araBAD) to reduce metabolic interference; (2) compatibility with the λ-Red recombination system: facilitating gene editing and multi-module integration. The E. coli BW-ASTA strain used in this invention was commercially purchased.
[0034] After obtaining recombinant E. coli carrying the cyanobacterial cDNA gene, the recombinant E. coli is cultured in a culture medium. When the culture reaches a certain density, a certain concentration of isopropyl-β-D-1-thiogalactopyranoside (IPTG) is added to the culture medium to induce overexpression of the inserted gene CddA in the recombinant E. coli, thereby promoting more efficient synthesis of astaxanthin in the E. coli. The present invention has verified the effective improvement in astaxanthin synthesis efficiency through high-performance liquid chromatography (HPLC) detection or visual observation.
[0035] The following is a detailed description with reference to the embodiments of the present invention.
[0036] Example 1
[0037] In this example, an expression vector for overexpressing the cyanobacterial CddA gene was constructed. The construction method is as follows:
[0038] (1) The target gene (CddA) sequence was amplified from a laboratory-existing cyanobacterial cDNA library using PCR. The primers used (see Table 1) were designed based on the reference open reading frame (ORF) from the transcriptome data. To facilitate cloning, recognition sequences compatible with the multiple cloning site of the pGEX-4T-1 expression vector were added to both ends of the primers during design. Specifically, the forward and reverse primers contained sequences for the EcoRI and XhoI restriction sites, respectively, to facilitate subsequent vector ligation.
[0039] Nucleotide sequence of CddA (SEQ ID NO.1):
[0040] ATGATTCATCTGATTTATTCTGATCAATTTCTTGACCATGGCACGGGGCGTTCCCACCCAGAAAGCGCACGACGGTTAACGGCGATCGCCCAAGCCCTGAAAGCCGTCTCCTGGGCGAACCAAATTCAGTGGCACGAACCAACAGCGATCGCCTTTCGAGATCCTTTGCCCTGGGTGCGCCAATTGCATGACGACTACTATTTGAAAGAACTGCAAAAATTGGCAGAATCTGGCGGTGGCTATTGGGATCCGGATACTCCTGTTTCACCCCAAAGTTTTGACGTGGCACTTTTGGCGGTCAATGCTTGTTTAGATGGGGTGGATTTAGCGCTTCAAACCAAGGAGCCTGTATTTGCCTTGGTGCGGCCCCCCGGTCATCACGCCACCCGCAGCACAGGGATGGGATTTTGCCTGTTGGGAAATGTGGCGATCGCCGCCCATTATGCCTTGGGTTTAGCGGGCATTAAAAAAGTGGCGATCCTCGATTGGGATGTCCACCACGGCAACGGCACAGAATATTTAGTCGAGGAAAATCCCCAGATTATTTATTGTTCTCTCCATCAGGATCCGGCTTATCCGGGCACTGGCCAGGCTCACCATCATGGTCGCCACCAAAATATTTTAAATATTCCCCTCAAGCCAGGTGCAGATCGAAGGATCTATGTCCAAAAATTCCAGGACGTGGTTTTACCATACTTGCAAGAGTTTCAACCGGATCTGTTAATTGTCAGTGCGGGCTACGATGCCACCGCCAAAGATCCCTTAGCGGGAATGAATCTCCAGCCCCAGGATTACAAAGTTTTTAGCGAATTTTGCCAGCAGTTACCTTGTCCAATCCTGTTTGCCCTAGAAGGGGGCTATCATCTCCAAACCTTGGCAGAATCGGTGGTGGCCACCCTCGAACCCTTTGCTCAGTAA。
[0041] Table 1:
[0042]
[0043] (2) The amplified CddA gene fragment was digested with EcoRI and XhoI at 37°C, and then ligated into the pGEX-4T-1 expression vector digested with EcoRI and XhoI at 16°C using T4 DNA ligase (BM121, Transgen BioTech, Beijing) to construct a CddA overexpression vector.
[0044] Example 2
[0045] In this example, the expression vector overexpressing the cyanobacterial CddA gene constructed in Example 1 was transferred into the E. coli BW-ASTA strain to obtain recombinant E. coli with high astaxanthin production. PTG was then used to induce the recombinant E. coli to synthesize astaxanthin. The experimental method is as follows:
[0046] (1) The expression vector constructed in Example 1 was transformed into competent Escherichia coli BW-ASTA cells using the heat shock transformation method; transformation conditions: incubation on ice for 20 min, heat shock at 42°C for 90 s, addition of antibiotic-free basal liquid culture medium (its composition is shown in Table 2), and incubation in a shaker at 37°C and 180 rpm for 1 h.
[0047] Table 2: Basic liquid culture medium formula
[0048] Components Concentration (g / L) <![CDATA[KH2PO4]]> 3 <![CDATA[K2HPO4]]> 12 <![CDATA[(NH4)2SO4]]> 5 <![CDATA[MgSO4×7H2O]]> 0.3 <![CDATA[CaCl2×2H2O]]> 0.015 NaCl 0.1 Glucose monohydrate 5 <![CDATA[FeSO4×7H2O / sodium citrate]]> 15ml / L <![CDATA[MnSO4·H2O]]> 10 <![CDATA[ZnSO4-7H20]]> 2 <![CDATA[COCl2]]> 4 <![CDATA[CuCI2.2H20]]> 1 <![CDATA[Na2MoO4-2H20,]]> 2 <![CDATA[H3BO4]]> 0.5 <![CDATA[AICI3-6H20]]> 10
[0049] Surviving Escherichia coli were screened on an agar plate supplemented with 100 μg / mL ampicillin and 25 μg / mL chloramphenicol, and the screened strains were sequenced to confirm the correct insertion of the CddA gene, thereby obtaining recombinant Escherichia coli with high astaxanthin production.
[0050] (2) The recombinant E. coli was transferred to a basal liquid culture medium containing equal concentrations of antibiotics (100 μg / mL ampicillin and 25 μg / mL chloramphenicol), incubated at 37°C, and shaken at 180 rpm until the optical density at 600 nm (OD600) reached 0.4-0.5. 0.5 mM IPTG was then added to induce overexpression of the CddA gene in the recombinant E. coli, and the culture was continued at 30°C and 200 rpm for 48 h.
[0051] After the culture was completed, subsequent streak culture was performed and the BW-negative control group (E. coli BW-ASTA without the CddA gene) and the BKT-positive control group (E. coli BW-ASTA with the β-carotene ketolase gene) were used as references to observe the color change of the cells with the naked eye. Figure 1 As shown, the negative control group was colorless or light yellow ( Figure 1 ). The positive control group and the experimental group (recombinant E. coli overexpressing CddA) displayed a distinct red color, confirming that the positive and experimental groups had higher astaxanthin content than the negative control group. The β-carotene ketolase gene, abbreviated as BKT, is one of the key rate-limiting enzymes in the astaxanthin biosynthesis pathway of Haematococcus pluvialis and is commonly used in the engineering of astaxanthin-biosynthesizing bacteria.
[0052] like Figure 2 As shown, three strains were collected, and the total proteins of the three strains were extracted by ultrasonic disruption (ultrasound 3s, interval 3s, power 20%, total time 20min). The same amount of protein was separated by SDS-PAGE gel, and then GST antibody was used to detect the expression of positive control genes BKT (β-carotene ketolase) and CddA in the strains based on the western-blot method.
[0053] Three strains were collected and frozen at -80°C for 4 hours before being transferred to a freeze dryer and freeze-dried for 48 hours. The freeze-dried algae samples were accurately weighed and placed in 2 mL screw-capped centrifuge tubes. 200 μL of acid-washed glass beads (Sigma-Aldrich, USA) were pre-added to each tube to enhance sample disruption. Subsequently, 500 μL of a mixture of dichloromethane and methanol (1:3, v / v, HPLC grade) was added to each tube using a Pasteur tube to serve as the extraction solution for astaxanthin.
[0054] Then, mass spectrometry was used to confirm the configuration of astaxanthin, and high performance liquid chromatography (HPLC) was used to quantitatively detect the content of astaxanthin in the bacteria. After mass spectrometry detection, the secondary mass spectrometry of astaxanthin produced by the three strains and the standard (L-astaxanthin) Figure 1 The results indicate that the astaxanthin synthesized by the three strains is L-astaxanthin, which is a high-quality astaxanthin configuration (such as Figure 3 ), which has the strongest antioxidant activity. Furthermore, the elution time of the HPLC peaks confirmed that the astaxanthin peaks of the three strains were located in the same position, indicating that they produced the same astaxanthin configuration.
[0055] According to the HPLC test results, the peak area of astaxanthin in the three strains was calculated, and the relative content of astaxanthin in the three strains was calculated by normalizing the initial cell dry weight of each strain. Figure 4 As shown, the astaxanthin content in the recombinant Escherichia coli overexpressing the cyanobacterial CddA gene constructed in the present invention is 2.6 times that of the negative control group, indicating that CddA can significantly increase the astaxanthin content in Escherichia coli.
[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or make equivalent replacements for some or all of the technical features therein. These modifications or replacements, or when the technical features in the above embodiments do not conflict with each other, can be combined in the manner described in the embodiments, and these modifications, replacements or combinations do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A recombinant Escherichia coli producing astaxanthin, characterized in that: The cyanobacterial deacylase gene CddA was transferred into the Escherichia coli BW-ASTA strain as a base strain to obtain the cyanobacterial deacylase gene CddA; the nucleotide sequence of the cyanobacterial deacylase gene CddA is shown in SEQ ID NO.
1.
2. The recombinant Escherichia coli according to claim 1, characterized in that The construction method of the recombinant Escherichia coli is as follows: S1. Amplify the cyanobacterial CddA gene from the cDNA library using PCR; S2. Construction of an expression vector for overexpressing the cyanobacterial CddA gene; S3. Transform the expression vector constructed in step S2 into the Escherichia coli BW-ASTA strain, screen out transformants, and obtain the recombinant Escherichia coli.
3. The recombinant Escherichia coli according to claim 2, characterized in that In S1, the primer pairs used to amplify the cyanobacterial CddA gene are as follows: The forward primer is: CCGGAATTCATGATTCATCTGATTTATTCTGATCAATTTCTTGA CCA; The reverse primer is: CCGCTCGAGCTGAGCAAAGGGTTCGAGGGT.
4. The recombinant Escherichia coli according to claim 2, characterized in that In S2, the target gene fragment amplified in S1 was digested with EcoRI and XhoI, and the target gene fragment was ligated into the pGEX-4T-1 expression vector digested with EcoRI and XhoI using T4 DNA ligase to obtain an expression vector that overexpressed the cyanobacterial CddA gene.
5. The recombinant Escherichia coli according to claim 2, characterized in that In S3, the expression vector constructed in S2 was transformed into competent Escherichia coli BW-ASTA cells using a heat shock transformation method, and transformants were screened using agar plates containing ampicillin and chloramphenicol. The transformants were Escherichia coli that had successfully been transformed with the CddA gene.
6. A method for synthesizing astaxanthin, characterized in that: include: Astaxanthin is obtained by culturing the recombinant Escherichia coli according to any one of claims 1 to 5.
7. The method for synthesizing astaxanthin according to claim 6, wherein The culture process comprises: adding 0.1-0.5 mM IPTG to the culture medium of the recombinant Escherichia coli, inducing overexpression of the CddA gene in the recombinant Escherichia coli by IPTG, and promoting the Escherichia coli to synthesize astaxanthin.