Method for differentiating CXCL13OE stem cells into T cells

CXCL13OE stem cells were prepared by gene editing and pure liquid differentiation, and differentiated into efficient CD8+CXCL13+Texp T cells, solving the problems of limited proliferation ability and low expression, realizing the preparation and application of efficient lethal T cells, and enhancing the therapeutic effect of ICB.

CN120519397APending Publication Date: 2025-08-22FUDAN UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510681385.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-26
Publication Date
2025-08-22

AI Technical Summary

Technical Problem

In existing T cell therapies, the patient's autologous T cell proliferation ability is limited and he cannot effectively overexpress CXCL13. The expression of natural T cells is low and cannot be supplemented with reactive T cells. In addition, hybrid cells are easily introduced during the differentiation of traditional iPSCs, and the operating space is limited.

Method used

CXCL13OE stem cells were constructed using gene editing technology, and differentiated into CXCL13+CD8+Texp T cell subsets using iPSCs. Through pure liquid differentiation method and specific cytokine induction, the trophoblast-free differentiation kit and small molecule inducer were used during the differentiation process to closely observe the cell status and prevent contamination.

Benefits of technology

The highly targeted and lethal CD8+CXCL13+Texp T cell subpopulation was successfully prepared, which solved the problem of lack of T cells in tumor patients, enhanced the effect of ICB treatment, and had high operating space and reliability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519397A_ABST
    Figure CN120519397A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of cell biology, and particularly discloses a method for differentiating CXCL13OE stem cells into T cells, which comprises the following steps: (i) culturing iPSC; (ii) carrying out lentivirus transfection to construct a CXCL13 overexpression iPSC; (iii) the CXCL13OE-iPSC differentiates the CXCL13 < + > CD34 < + > hematopoietic progenitor cells; (iv) differentiating the T progenitor cells from the CXCL13 + CD34 + hematopoietic progenitor cells; (v) differentiating the CXCL13 + T progenitor cell into a double positive cell CXCL13 + DP-T cell; and (vi) differentiating a CD8 + CXCL13 + Texp T cell subset by using the double positive CXCL13 + DP-T cells. The CD8 + CXCL13 + Texp T cell subset is further prepared on the basis of constructing CXCL13OE stem cells from the iPSC level, so that on one hand, the problem of low expression of CXCL13 by T cells differentiated by the iPSC is solved, and on the other hand, the difficulty that CXCL13 overexpression and screening cannot be carried out on the CD8 + T cells is solved. Therefore, the complementation of high-targeting and lethality CD8 + T cells lacking in the body of a tumor patient is facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of cell biology, and in particular to a method for utilizing CXCL13 OE Methods for differentiating stem cells into T cells. Background Art

[0002] Our research team conducted the NATION-1907 study (NCT04215471), the world's first neoadjuvant immunotherapy for esophageal squamous cell carcinoma. We demonstrated for the first time the good safety and positive efficacy of neoadjuvant immunotherapy and found that immunotherapy produces distinct therapeutic responses in patients with esophageal cancer. The dynamic changes of T cell clones in esophageal cancer can be used to distinguish people with different treatment responses. Among them, the CD8+CXCL13+Texp subpopulation may play an important role in the treatment of esophageal cancer. The basis is: (1) Single-cell sequencing results suggest that this type of T cell is the most lethal T cell subpopulation and is significantly enriched in patients with good immune response; (2) After the use of PD-L1 monoclonal antibody, the expression of CXCL13 in the tumor-reactive T cell subpopulation was significantly increased; and the expression of CXCL13 in the tumor-reactive T cell subpopulation was also significantly increased compared with the good immune response group and the poor response group; (3) Literature has shown that CXCL13 expression can effectively distinguish tumor-reactive T cells from bystander T cells and is positively correlated with the efficacy of immune checkpoint blockade (ICB). In various cancers, including non-small cell lung cancer (NSCLC), basal cell carcinoma (BCC), esophageal squamous cell carcinoma (ESCC), and breast cancer, the abundance of CXCL13+CD8+ T cells before treatment can predict patients' response to ICB (immune checkpoint blockers). [1]-[2] In the tumor microenvironment (TME), CXCL13 is mainly secreted by exhausted precursor T cells (Texp) or T follicular helper cells (Tfh), which can recruit B cells and T cells to the tumor site, enhancing the immune response and the efficacy of ICB. [3]-[4]

[0003] Based on the above research background, the use of CD8+CXCL13+Texp T cell subsets to treat patients with solid tumors has broad application prospects. This cell not only has strong killing ability, but also can secrete a large amount of chemokine CXCL13, recruiting other immune cells to the tumor site for collaborative killing. At the same time, in many tumor patients treated with ICB, the enrichment of this cell in the tumor site is a sign of good responsiveness, and this cell can be used to supplement the reactive T cells in the tumor microenvironment of patients who are insensitive to ICB treatment. Existing T cell therapy has the following main shortcomings: (1) The use of the patient's autologous T cells for expansion is highly dependent on the patient's immune status. Advanced cancer patients often cause T cell aging and loss of function (such as high expression of PD-1 and shortened telomeres) due to chemotherapy or the tumor microenvironment. (2) The proliferation capacity of mature T cells is limited. There is little room for operation when overexpressing and screening CXCL13, and it is impossible to establish a patient-personalized cell bank and continuously produce it. (3) Natural T cells have low CXCL13 expression and limited killing ability, and cannot be used as reactive T cells to supplement patients who are insensitive to ICB treatment.

[0004] So far, no studies have been conducted to directly identify CXCL13 OE Stem cells differentiate into T cells. After comprehensive consideration, pluripotent stem cells (iPSC) have high differentiation potential, strong growth capacity, and simple culture conditions. This invention will mainly use iPSC-CXCL13 OE Differentiate into CD8+CXCL13+Texp T cell subsets. Summary of the Invention

[0005] One of the purposes of the present invention is to provide a method for OE The method of differentiating stem cells into T cells (CD8+CXCL13+Texp T cells) aims to address the following issues: first, the limited proliferation capacity of CD8+ T cells derived from tumor patients (primarily from peripheral blood), which makes it difficult to overexpress and screen CXCL13. Second, the method aims to address the low expression of CXCL13 in T cells differentiated from natural iPSCs.

[0006] This invention uses gene editing technology for the first time to construct CXCL13 OE While stem cells are beneficial for storage, they can differentiate into CXCL13+CD8+Texp T cell subsets as needed to supplement the lack of highly targeted and lethal CXCL13+CD8+Texp T cells for cancer patients. The technical method we use can convert 1×10 7 stem cells, induced into 5.78×10 6 CD8+CXCL13+Texp T cell subsets.

[0007] The difficulty of the present invention lies in: converting the cutting-edge clinical research results (enrichment of CD8+CXCL13+Texp T cells in patients with good ICB responsiveness) into a treatment plan; converting the patient's peripheral blood mononuclear cells into iPSCs, it is necessary to introduce four genes, Sox2, Oct3 / 4, Klf4, and c-Myc, according to the experimental method of Shinya Yamanaka of Japan, and then select ideal monoclonal cells for purification and amplification to finally obtain iPSCs; in the process of overexpressing CXCL13, it is necessary to use puromycin to screen out overexpressing cell lines, which has high requirements for screening drug concentration and operation methods (such as cell passaging), and it is necessary to prevent damage and stress of iPSCs, which leads to irreversible differentiation; traditional iPSC differentiation to T cells requires trophoblast cells and a large number of cytokines, which are easy to introduce foreign cells (mouse MEF cells). The method used in the present invention is a pure liquid differentiation method, and additional cytokines are only required during the final T cell maturation and induction of exhaustion of precursor T cells; CXCL13 OE It takes 47 days for stem cells to differentiate into CXCL13+CD8+Texp T cells. The cell status needs to be closely observed to prevent cell contamination. At the same time, the key step requires flow cytometry to quantitatively detect the conversion rate.

[0008] In order to achieve the above object, the specific technical solutions adopted by the present invention are as follows:

[0009] A method utilizing CXCL13 OE The method of differentiating stem cells into T cells is based on induced pluripotent stem cells (iPSCs). Gene editing technology is used to overexpress CXCL13 in the stem cells to obtain CXCL13. OE -iPSC stem cells; then using the feeder-free differentiation kit STEMdiff and a variety of small molecule inducers (CD3 / CD28 / CD2 activators, IL-15, etc.), CXCL13 OE -iPSCs differentiate into effector CD8+CXCL13+Texp T cell subsets.

[0010] Specifically, the use of CXCL13 OE The method of differentiating stem cells into T cells comprises the following steps:

[0011] (i) iPSC culture;

[0012] (ii) Construction of CXCL13-overexpressing iPSCs by lentiviral transfection, i.e., CXCL13 OE -iPSCs;

[0013] (iii)CXCL13 OE -iPSC differentiation into CXCL13+CD34+ hematopoietic progenitor cells;

[0014] (iv) CXCL13 + CD34 + hematopoietic progenitor cells differentiate into T progenitor cells, i.e., CXCL13 + T progenitor cells;

[0015] (v) CXCL13+ T progenitor cells differentiate into double-positive cells CXCL13+ DP-T cells;

[0016] (vi) Double-positive CXCL13+DP- T cells differentiate into CD8+CXCL13+Texp T cell subsets.

[0017] Furthermore, in step (i), the iPSC is an induced pluripotent stem cell hiPSC derived from human peripheral blood cells, and the culture method is: using serum-free DMEM / F12 medium to dilute the stem cell culture matrix gel, the dilution is added to a six-well plate for matrix gel pretreatment; after the pretreatment is completed, the dilution is discarded, and the iPSC is resuspended in mTeSR plus serum-free complete medium and added to the well plate for culture, and the medium is changed every other day.

[0018] Furthermore, the operation method of step (ii) is as follows: when the density of iPSCs in the six-well plate in step (i) reaches 70-80%, a lentivirus carrying an overexpression CXCL13 plasmid is added to the culture medium in combination with a transfection agent, and a stable transfected CXCL13 cell line is screened. OE -iPSCs.

[0019] Furthermore, the operation method of step (iii) is as follows:

[0020] Day 0: CXCL13 OE - After iPSCs were cultured according to the iPSC culture method, differentiated cells were removed and digested; after digestion, they were resuspended in STEMdiff Hematopoietic EB A medium containing Y-27632; and added to AggreWell treated with anti-adhesion solution. TM Incubate at 37°C and 5% CO2 in 400 μL to form EB spheres;

[0021] Days 5-12: On day 5, collect the EB sphere suspension and use STEMdiff Hematopoietic EB B medium to blow the EB spheres into a new well plate and culture at 37°C and 5% CO2; thereafter, use STEMdiff Hematopoietic EB B medium for rehydration and half-medium replacement every two days.

[0022] Furthermore, in step (iv), the operation method of step (iv) is as follows:

[0023] Day 13: Collect CD34+ hematopoietic progenitor cells differentiated in step (iii); separate CD34+ cells using magnetic beads or flow cytometry, and culture in 24-well plates at 37°C and 5% CO2;

[0024] Day 14-26: The medium was changed every 3-4 days and the culture was maintained at 37°C and 5% CO2.

[0025] Furthermore, the operation method of step (v) is as follows:

[0026] Day 27: At this time, CD34+ hematopoietic progenitor cells have differentiated into T progenitor cells, and cells in all wells are collected; use StemSpan TM Resuspend in T Cell Progenitor Maturation Medium and add to a 24-well plate and culture at 37°C and 5% CO2;

[0027] Day 28-40: Change the medium every 3-4 days and maintain the culture at 37°C and 5% CO2.

[0028] Furthermore, the operation method of step (vi) is as follows:

[0029] Day 41: At this time, the T progenitor cells have been transformed into double-positive DP-T cells. After changing the medium, StemSpan is added. TM T Cell Progenitor Maturation Medium and human recombinant IL-15 and CD3 / CD28 / CD2 activator were used, and the culture was maintained at 37°C and 5% CO2;

[0030] Days 42-47: Add StemSpan 3-4 days after stimulation TM T Cell Progenitor Maturation Medium, no additional IL-15 and CD3 / CD28 / CD2 activators are needed. Cells can be harvested on day 47, at which time they are CD8+CXCL13+ T cells.

[0031] The second object of the present invention is to provide a CD8+CXCL13+Texp T cell subset prepared by the above method.

[0032] A third objective of the present invention is to provide the use of the CD8+CXCL13+Texp T cell subset prepared using the above method in the preparation of an anti-tumor drug. The T cell subset prepared by the present invention can supplement the lack of highly targeted and lethal CXCL13+CD8+Texp T cells in cancer patients, achieving the purpose of tumor treatment. It can be used alone or in combination with ICB as an anti-tumor drug.

[0033] The present invention has the following beneficial effects:

[0034] 1. The present invention constructs CXCL13 OEBased on stem cells, we further generate CD8+CXCL13+Texp T cell subsets, addressing the issue of low CXCL13 expression in iPSC-derived T cells and the difficulty of overexpressing and screening CXCL13 in CD8+ T cells. This helps replenish the highly targeted and lethal CD8+ T cells that are lacking in cancer patients.

[0035] 2. The CD8+CXCL13+Texp T cells prepared by the present invention can be expanded in vitro without considering the patient's condition; they can be used as reactive T cells to enhance or reverse the original insensitive therapeutic effect of ICB patients; and their killing performance is stronger than that of ordinary peripheral blood free cells.

[0036] 3. Compared with the T cell level, the iPSC level of the present invention has more operating space and higher fault tolerance, and the culture and cell editing schemes can be continuously optimized.

[0037] 4. The CD8+CXCL13+Texp T cell subset prepared by the present invention is an innovation in tumor immunity and cell therapy. It converts the reactive cell indicators of cancer patients after neoadjuvant therapy into a treatment method. It can be combined with ICB for treatment to enhance the treatment effect and has considerable application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The lentiviral vector system provided by Shanghai GeneCare Gene Technology Co., Ltd. includes the following: vector name: GV492, element sequence: Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin, cloning sites: BamHI / AgeI, control number: CON335. The target gene is CXCL13 (NM_001371558.1), and the species is human.

[0039] Figure 2 (A) Microscopic morphology of human induced pluripotent stem cells; (B) RT-qPCR validation of the efficacy of lentiviral transfection in iPSCs. The 293T, hiPSC WT, and hiPSC CXCL13 OE cells represent the untreated 293T control group, the untransfected hiPSC control group, and the lentiviral-transfected hiPSC experimental group, respectively. RT-qPCR demonstrates successful lentiviral overexpression of CXCL13 in iPSCs, and the iPSC stemness gene Pou5f1 remains highly expressed, unaffected by viral transfection.

[0040] Figure 3 Cell morphology and conversion rate test results during the differentiation process from iPSCs to CD8+CXCL13+Texp T cells. Flow cytometry results showed that the conversion rates at the key steps of day 12, day 40, and day 47 were 84.7%, 77.0%, and 85.3%, respectively.

[0041] Figure 4 Changes in T cell cytotoxicity during exhaustion. The upper and lower figures show the same T cell sample at day 47. The upper figure shows flow cytometry analysis of CD4 and CD8, while the lower figure shows flow cytometry analysis of PD1 and CD107a. The upper figure shows the gated area for T cells and KYSE150 tumor cells at day 54. The lower figure shows flow cytometry analysis of PD1 and CD107a after gating on T cells. Flow cytometry results show that on day 47, when CD8+ T cells were newly differentiated, 90.5% expressed high CD107a, indicating cytotoxicity. On day 54, CD8+ T cells were co-cultured with the human esophageal squamous cell carcinoma cell line KYSE180 for 12 and 24 hours, respectively. Results show that with increasing co-culture time, expression of PD-1, an indicator of CD8+ T cell exhaustion, increased, while CD107a, an indicator of cytotoxicity, decreased. DETAILED DESCRIPTION

[0042] The present invention will be further described below with reference to the accompanying drawings and specific examples. In the following examples, the reagents involved are all commercially available conventional reagents unless otherwise specified, and the experimental operations involved are all conventional operations in the art unless otherwise specified.

[0043] Example 1: Preparation of CD8+CXCL13+Texp T cell subsets

[0044] (i) iPSC culture

[0045] According to the experimental method of Shinya Yamanaka of Japan [5] iPSCs were constructed from human peripheral blood mononuclear cells by introducing four transcription factors: Oct4, Sox2, c-Myc, and Klf4. Six-well plates were pre-treated with stem cell culture matrix gel (Corning, 354277) at a dilution concentration of 800 μL matrix gel / 48 mL serum-free DMEM / F12 medium. 500 μL of matrix gel dilution was added to each well of the six-well plate and placed in a 37°C incubator for 1 hour. The medium was discarded, and the iPSCs were resuspended in mTeSR plus serum-free complete medium (Stemcell, 100-0276) and added to the plate for culture. The medium was changed every other day.

[0046] (ii) CXCL13 lentivirus and CXCL13 OE - iPSC construction

[0047] CXCL13 lentiviral construction:

[0048] The gene information is CXCL13 (NM_001371558.1), human species. Primers with restriction enzyme cleavage sites were designed based on the CXCL13 gene sequence. The designed primers were used to amplify the CXCL13 gene fragment by PCR. The primer sequences used are:

[0049] ID seq CXCL13(103041-2)-p1 AGGTCGACTCTAGAGGATCCCGCCACCATGAAGTTCATCTCGACATC CXCL13(103041-2)-p2 TCCTTGTAGTCCATACCGGTGGGAATCTTTCTCTTAAACACTG

[0050] by Figure 1 The plasmid shown is a lentiviral vector provided by Shanghai GeneCare Gene Technology Co., Ltd.; vector name: GV492; element sequence: Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin; cloning site: BamHI / AgeI, control number: CON335.

[0051] The vector was digested with enzymes, and the amplified CXCL13 gene fragment was ligated with the digested vector to obtain a recombinant plasmid vector. The recombinant plasmid vector was transfected into 293T cells, and the cell supernatant rich in lentiviral particles was collected and concentrated to obtain a lentivirus overexpressing CXCL13.

[0052] CXCL13 OE -iPSC construction:

[0053] When the density of iPSC in the well plate reaches 70-80% ( Figure 2 A), lentivirus overexpressing CXCL13 was transferred into iPSCs through a transfection aid, iPSC clones with green fluorescence were screened, and then puromycin (1-5ug / mL per day, it is recommended to start with a concentration of 1ug / L and gradually increase to 3ug / L if necessary) was given until all wild-type stem cells in the control group died. At this time, CXCL13 was obtained. OE -iPSC lines. qRT-PCR identification of the screened cell lines showed that CXCL13 was significantly overexpressed in iPSCs transfected with lentivirus, while the expression of stemness genes (such as OCT3 / 4 (Pou5f1)) was not affected ( Figure 2 B) Based on this, we obtained CXCL13 OE -iPSC cell lines.

[0054] (iii) EB sphere preparation, CXCL13 OE -iPSC differentiation of CXCL13+CD34+ hematopoietic progenitor cells

[0055] Day 0: CXCL13 OEAfter iPSCs were cultured according to the iPSC preparation steps, differentiated cells were removed, the culture plate was washed 2-3 times with D-PBS, digested with Accutase enzyme, and the cells were blown off the culture plate with serum-free DMEM / F12 medium, collected in a centrifuge tube, blown evenly into a single cell suspension and counted to ensure that there were an average of 850±150 cells per chamber. Resuspended in STEMdiff Hematopoietic EB A medium (with 10μM Y-27632 added), and added to the AggreWell treated with anti-adhesion solution (Stemcell, 07010). TM 400 in. AggreWell TM Centrifuge at 100g for 3 min at 400°C and observe under a microscope whether all cells are centrifuged in the chamber. Incubate at 37°C and 5% CO2.

[0056] Days 5-12: On day 5, gently pipette out all EB spheres from the chambers. Collect the EB sphere suspension and gently pipette the collected EB spheres onto a new plate using STEMdiff Hematopoietic EB B medium. Incubate at 37°C and 5% CO2. Replenish and partially change the medium every two days with STEMdiff Hematopoietic EB B medium to ensure the medium does not turn significantly yellow and that the cells are in good condition.

[0057] (iv) CXCL13+CD34+ hematopoietic progenitor cells differentiate into T progenitor cells

[0058] Day 13: Collect all EB balls in a centrifuge tube, add an appropriate amount of Accutase digestion enzyme (usually 10-15 times the volume), and place in a cell culture incubator for digestion for 10-20 minutes. During this period, repeatedly blow and flick the tube wall to speed up the digestion rate. After digestion is completed, add an equal volume of serum-free DMEM / F12 medium to terminate the digestion, and filter the cell suspension through a 37um filter. Collect the filtrate and centrifuge at 1200rpm for 5 minutes. Remove the supernatant. The single cells in the lower layer are the CD34+ hematopoietic progenitor cells we need to sort. CD34+ cells can be sorted by magnetic beads or flow cytometry and resuspended in StemSpan TM Add StemSpan to Lymphoid Progenitor Expansion Medium TM 500 μL of cell suspension was added to each well of a 24-well plate coated with Lymphoid Differentiation Coating Materia 24 hours in advance without tissue adhesion treatment, and the cells were cultured at 37°C and 5% CO2.

[0059] Days 14-26: Change the medium every 3-4 days, aspirate 400uL each time and add 500uL StemSpan TM Lymphoid Progenitor Expansion Medium was used and the culture was maintained at 37°C and 5% CO2.

[0060] (v) CXCL13+ T progenitor cells differentiate into double-positive cells CXCL13+ DP-T cells

[0061] Day 27: At this time, CD34+ hematopoietic progenitor cells have differentiated into T progenitor cells. Collect cells from all wells, centrifuge at 1200 rpm for 5 minutes, remove the supernatant, and use StemSpan TM Resuspend in T Cell Progenitor Maturation Medium. TM 24-well plates coated with Lymphoid Differentiation Coating Materia 24 hours in advance without tissue adhesion treatment were cultured at 37°C and 5% CO2.

[0062] Days 28-40: Change the medium every 3-4 days, aspirate 400uL each time and add 500uL StemSpan TM TCell Progenitor Maturation Medium. Use a pipette to gently remove the old medium along the well wall, taking care not to disturb the suspended cells at the bottom. Maintain the culture at 37°C and 5% CO2.

[0063] (vi) Double-positive CXCL13+DP-T cells differentiate into CD8+CXCL13+Texp T cell subsets

[0064] Day 41: At this time, the T progenitor cells have been converted into double-positive DP-T cells. The culture volume of each well is adjusted to 500uL fresh StemSpan TM T Cell Progenitor Maturation Medium was added with 10 ng / mL human recombinant IL-15 (Stemcell, 78031) and 6.25 μL ImmunoCult TM Human CD3 / CD28 / CD2 T Cell Activator (Stemcell, 10970) was used to maintain the culture at 37°C and 5% CO2.

[0065] Days 42-47: Add 500uL StemSpan 3-4 days after stimulation TMT Cell Progenitor Maturation Medium. Cells can be harvested on day 47, at which point they are CD8+CXCL13+ T cells.

[0066] Characterization performance test of CD8+CXCL13+T cells:

[0067] The morphology and conversion rate test results of the cell culture process are as follows Figure 3 As shown, the cells were in good condition, and flow cytometry results showed that the conversion rates at the key steps of day 12, day 40, and day 47 were 84.7%, 77.0%, and 85.3%, respectively. The culture method was effective and highly reliable.

[0068] Flow cytometry analysis of CD8+CXCL13+T cells revealed that both CD107a and PD-1, T cell killing indicators, were highly expressed, indicating that newly differentiated CD8+CXCL13+T cells had a strong killing ability. At this time, PD-1 expression was positively correlated with the killing function ( Figure 4 To clarify the effect of tumor cells on the exhaustion time of CD8+CXCL13+T cells, the inventors used the human esophageal squamous cell carcinoma cell line KYSE180 to co-culture with T cells for 12 hours and 24 hours. The flow cytometry results showed that compared with the newly differentiated CD8+CXCL13+T cells, after 24 hours of co-culture with tumor cells, the expression of CD107a in CD8+CXCL13+T cells was reversed, and the expression of PD-1 was further increased, indicating that T cells gradually lost their killing ability and were basically in an exhausted state ( Figure 4 , D54).

[0069] From the above, it can be concluded that the CD8+CXCL13+T cells successfully differentiated by the present invention have strong killing ability and can be used to supplement T cells lacking in the tumor microenvironment; and the CD8+CXCL13+T cells are most suitable for treatment or downstream experiments immediately after differentiation is completed around day 47. As time goes by, the differentiated T cells will gradually become exhausted.

[0070] This specific embodiment is only an explanation of the present invention, not a limitation of the present invention. Any changes made by those skilled in the art after reading the description of the present invention are within the scope of the claims of the present invention.

[0071] References:

[0072] [1]Liu B,Zhang Y,Wang D,Hu X,Zhang Z.Single-cell meta-analyses revealresponses of tumor-reactive CXCL13(+)T cells to immune-checkpointblockade.Nat Cancer 2022;3(9):1123-36.

[0073] [2]Chen J,Liu K,Luo Y,et al.Single-Cell Profiling of Tumor ImmuneMicroenvironment Reveals Immune Irresponsiveness in Gastric Signet-Ring CellCarcinoma.Gastroenterology.2023;165(1):88-103.

[0074] [3]Yang Z,Tian H,Chen X,et al.Single-cell sequencing reveals immunefeatures of treatment response to neoadjuvant immunochemotherapy inesophageal squamous cell carcinoma.Nat Commun.2024;15(1):9097.Published 2024Oct 22.

[0075] [4]Qiu MZ,Wang C,Wu Z,et al.Dynamic single-cell mapping unveilsEpstein-Barr virus-imprinted T-cell exhaustion and on-treatmentresponse.Signal Transduct Target Ther.2023;8(1):370.Published 2023 Sep 21.

[0076] [5]Okita K,Ichisaka T,Yamanaka S.Generation of germline-competentinduced pluripotent stem cells.Nature.2007;448(7151):313-317.

Claims

1. A method using CXCL13 OE A method for differentiating stem cells into T cells, characterized in that The following steps are involved: (i) iPSC culture; (ii) Construction of CXCL13-overexpressing iPSCs by lentiviral transfection, i.e., CXCL13 OE -iPSCs; (iii)CXCL13 OE -iPSC differentiation into CXCL13+CD34+ hematopoietic progenitor cells; (iv) CXCL13 + CD34 + hematopoietic progenitor cells differentiate into T progenitor cells, i.e., CXCL13 + T progenitor cells; (v) CXCL13+ T progenitor cells differentiate into double-positive cells CXCL13+ DP-T cells; (vi) Double-positive CXCL13+DP- T cells differentiate into CD8+CXCL13+Texp T cell subsets.

2. The method of claim 1 wherein CXCL13 is used OE A method for differentiating stem cells into T cells, characterized in that In step (i), the iPSC is an induced pluripotent stem cell hiPSC derived from human peripheral blood cells, and the culture method is as follows: using serum-free DMEM / F12 medium to dilute the stem cell culture matrix gel, the dilution is added to a six-well plate for matrix gel pretreatment; after the pretreatment, the dilution is discarded, and the iPSC is resuspended in mTeSR plus serum-free complete medium and added to the well plate for culture, and the medium is changed every other day.

3. The method of claim 2 using CXCL13 OE A method for differentiating stem cells into T cells, characterized in that The operation method of step (ii) is as follows: when the density of iPSCs in the six-well plate in step (i) reaches 70-80%, a lentivirus carrying an overexpression CXCL13 plasmid and a transfection agent are added to the culture medium, and then a stable transfected CXCL13 cell line is screened. OE -iPSCs.

4. The method of claim 3 using CXCL13 OE A method for differentiating stem cells into T cells, characterized in that The operation method of step (iii) is as follows: Day 0: CXCL13 OE - After iPSCs were cultured according to the iPSC culture method, differentiated cells were removed and digested; after digestion, they were resuspended in STEMdiff Hematopoietic EB A medium containing Y-27632; and added to AggreWell treated with anti-adhesion solution. TM Incubate at 37°C and 5% CO2 at 400 Formation of EB balls; Days 5-12: On day 5, collect the EB sphere suspension and use STEMdiff Hematopoietic EB B medium to blow the EB spheres into a new well plate and culture at 37°C and 5% CO2; thereafter, use STEMdiff Hematopoietic EB B medium for rehydration and half-medium replacement every two days.

5. The method of claim 4 using CXCL13 OE A method for differentiating stem cells into T cells, characterized in that The operation method of step (iv) is as follows: Day 13: Collect CD34+ hematopoietic progenitor cells differentiated in step (iii); separate CD34+ cells using magnetic beads or flow cytometry, and culture in 24-well plates at 37°C and 5% CO2; Day 14-26: Change the medium every 3-4 days and maintain the culture at 37°C and 5% CO2.

6. The method of claim 5 using CXCL13 OE A method for differentiating stem cells into T cells, characterized in that The operation method of step (v) is as follows: Day 27: At this time, CD34+ hematopoietic progenitor cells have differentiated into T progenitor cells, and cells in all wells are collected; use StemSpan TM Resuspend in T Cell Progenitor Maturation Medium and add to a 24-well plate and culture at 37°C and 5% CO2; Day 28-40: Change the medium every 3-4 days and maintain the culture at 37°C and 5% CO2.

7. The method of claim 6 using CXCL13 OE A method for differentiating stem cells into T cells, characterized in that The operation method of step (vi) is as follows: Day 41: At this time, the T progenitor cells have been transformed into double-positive DP-T cells. After changing the medium, StemSpan is added. TM T Cell Progenitor Maturation Medium, human recombinant IL-15, and CD3 / CD28 / CD2 activators were used and the cultures were maintained at 37°C and 5% CO2. Days 42-47: Add StemSpan 3-4 days after stimulation TM T Cell Progenitor Maturation Medium, no additional IL-15 and CD3 / CD28 / CD2 activators are needed. Cells can be harvested on day 47, at which time they are CD8+CXCL13+ T cells.

8. The method of claim 1 utilising CXCL13 OE CD8+CXCL13+Texp T cell subsets were obtained by differentiating stem cells into T cells.

9. Use of the CD8+CXCL13+Texp T cell subset according to claim 8 in the preparation of anti-tumor drugs.