CRISPR / Cas9 gene editing vector for preparing glutinous barley as well as construction method and application of CRISPR / Cas9 gene editing vector

Abstract

The invention relates to a CRISPR / Cas9 gene editing vector for preparing waxy barley as well as a construction method and application of the CRISPR / Cas9 gene editing vector. Through a CRISPR / Cas9 system constructed by a specific sgRNA, the waxy gene of barley is subjected to biallelic mutation, GBSSI protein is not expressed, A-type starch grains in barley endosperm are relatively not full, the periphery of the A-type starch grains is mainly wrapped by protein, B-type starch grains are extremely few, amylose in barley grains is zero, and the content of soluble sugar is remarkably increased; the obtained new glutinous barley strain provides a new germplasm resource for improving the quality of barley seeds and barley processed food, and has practical popularization and application values.

Description

Technical Field

[0001] The present invention belongs to the field of molecular technology, and in particular relates to a CRISPR / Cas9 gene editing vector for preparing waxy barley, and a construction method and use thereof. Background Art

[0002] Barley (Hordeum vulgare L.) is a grassy plant in the Poaceae family. It has a short growth period, matures quickly, and can withstand drought and high salinity environments. It thrives in low-lying and low-fertility soils and is widely cultivated. It is rich in dietary fiber, amino acids, and various vitamins, which are beneficial to human health. β-glucan, among other physiological benefits, has been shown to cleanse the intestines and boost immunity. Starch, the primary storage substance in barley grains, influences grain quality, accounting for 60% to 75% of the grain's dry weight. Two types of starch granules exist in the barley endosperm: type A granules (10-35 μm in diameter) and type B granules (2-7 μm in diameter). Type A granules are oval and plump, while type B granules can be spherical or irregularly polygonal, accounting for 6% to 30% of the total starch content. Starch granule size influences its viscosity; larger granules have lower gelatinization temperatures and higher peak viscosities than smaller granules. When the amylose content in the endosperm is between 0% and 10%, it is considered glutinous barley. Because its starch gelatinization requires a lower temperature, it reduces water and nutrient loss during cooking. This increased water-holding capacity helps slow starch retrogradation and aging, significantly enhancing the shelf life of barley products. Compared to standard barley, glutinous barley is more suitable for processing into crispy snacks. Furthermore, glutinous barley extracts can inhibit osteoclastogenesis, potentially helping treat bone diseases such as osteoporosis. Glutinous barley is not only used to produce products with superior taste and quality, but also for brewing. Its water absorption, saturated moisture content, steaming time, energy efficiency, liquor yield, and total acid and ester content all surpass those of rice, japonica sorghum, and glutinous sorghum. It is a novel brewing material for the production of fragrant Xiaoqu liquor and highland barley liquor. In nature, glutinous barley without amylose is very rare. Zhu Caimei screened out 252 barley varieties with relatively low amylose content from 7,713 domestic barley germplasm resources. These germplasm resources are all low-amylose glutinous barley.

[0003] Gene editing relies on the genetically engineered CRISPR / Cas9, also known as "molecular scissors." In recent years, CRISPR / Cas9 gene editing technology has played an important role in various genetic improvements. Studies have obtained glutinous rice, glutinous corn, and glutinous wheat through gene editing and hybridization. Barley is the fourth largest staple food crop, and there are currently no reports on obtaining new varieties of glutinous barley through gene editing, hybridization, and other methods. Summary of the Invention

[0004] To solve the above problems, the present invention provides a gene fragment, the nucleotide sequence of which is shown in SEQ ID NO.7.

[0005] The present invention also provides a CRISPR / Cas9 gene editing vector for preparing waxy barley, which is a recombinant vector connected to a nucleotide sequence such as SEQ ID NO.7.

[0006] Furthermore, the recombinant vector is a recombinant vector carrying the cas9 gene based on the PBuE411 plasmid.

[0007] The present invention also provides a method for constructing the aforementioned CRISPR / Cas9 gene editing vector, which comprises the following steps:

[0008] The gene fragment with the nucleotide sequence shown in SEQ ID NO.7 was taken and connected by Golden Gate enzyme ligation reaction to form a recombinant vector carrying the cas9 gene based on the PBuE411 plasmid.

[0009] The present invention also provides a use of the aforementioned CRISPR / Cas9 gene editing vector in preparing waxy barley.

[0010] The present invention finally provides a method for preparing waxy barley, which comprises the following steps:

[0011] The aforementioned CRISPR / Cas9 gene editing vector was transferred into Agrobacterium, and then the CRISPR / Cas9 gene editing vector was transferred into barley immature embryos through the Agrobacterium-mediated method. The barley immature embryos were cultured and sequenced to obtain waxy barley plants.

[0012] Furthermore, the culture includes callus culture, regeneration tissue culture and differentiation culture.

[0013] Furthermore, the Agrobacterium is Agrobacterium EHA105.

[0014] The present invention is used to prepare a CRISPR / Cas9 gene editing vector for waxy barley, as well as its construction method and use. Using a CRISPR / Cas9 system constructed using specific sgRNA, the Waxy gene in barley undergoes a biallelic mutation, resulting in no GBSSI protein expression. The A-type starch granules in the barley endosperm are relatively puffy, surrounded primarily by protein, with very few B-type starch granules. The barley grains contain zero amylose, while the soluble sugar content is significantly increased. The resulting new waxy barley strain provides a new germplasm resource for improving the quality of barley seeds and processed barley foods, with specific practical application value.

[0015] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.

[0016] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the CRISPR / Cas9 gene editing vector and Waxy gene target site.

[0018] Figure 2 Mutated sequence of the Waxy gene

[0019] Figure 3 Amino acid sequence alignment of Waxy genes

[0020] Figure 4 SDS-PAGE detection of GBSSI protein

[0021] Figure 5 Identification of edited starch granules by I2-KI staining

[0022] Figure 6 Scanning electron microscope of endosperm (black arrows indicate type A starch granules; white arrows indicate type B starch granules)

[0023] Figure 7 Analysis of grain quality and agronomic traits

[0024] Figure 8 Structural genes for starch and sucrose metabolism in wild-type and Waxy mutant lines

[0025] Figure 9 Noodles made from wild-type and edited flour DETAILED DESCRIPTION

[0026] Example 1: Creating Non-Glutinous Barley Using the CRISPR / Cas9 System

[0027] 1. Construction of CRISPR / Cas9 expression vector

[0028] Using barley genomic DNA as a template, the Waxy gene fragment was amplified, TA cloned and sequenced. Based on the sequencing results, two suitable targets T1 and T2 with PAM sequences were designed in the conserved region of the first exon of the Waxy gene. According to the target sequence, the appropriate linker sequence was introduced and the primers were designed: MEDWAXYA-F / F0 and MEDWAXYA-R / R0. Using the intermediate vector (PMED) as a template, the T1-gRNA-TaU3-T2 fragment was amplified and the fragment was ligated by Golden Gate enzyme ligation to form a recombinant vector carrying the cas9 gene based on PBuE411, obtaining the dual-target CRISPR / Cas9 gene editing vector pLGYE001-wxcds( Figure 1 ).

[0029] Nucleotide sequence of target T1 (SEQ ID NO.1): ACCGACAGATTCCGGCGTCC

[0030] Nucleotide sequence of target T2 (SEQ ID NO.2): GGCATGAACCTCGTGTTCGT

[0031] The nucleotide sequence of primer MEDWAXYA-F (SEQ ID NO. 3):

[0032] aataatggtctcAGGCgGCATGAACCTCGTGTTCGT

[0033] The nucleotide sequence of primer MEDWAXYA-F0 (SEQ ID NO.4):

[0034] gGCATGAACCTCGTGTTCGTgttttagagctagaaatagc

[0035] The nucleotide sequence of primer MEDWAXYA-R (SEQ ID NO.5):

[0036] GGACGCCGGAATCTGTCGGTGCTTCTTGGTGCCGC

[0037] The nucleotide sequence of primer MEDWAXYA-R0 (SEQ ID NO.6):

[0038] ATTATTGGTCTCTAAACGGACGCCGGAATCTGTCGGT

[0039] Nucleotide sequence of T1-gRNA-TaU3-T2 fragment (SEQ ID NO.7): ACCGACAGATTCCGGCGTCC GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT TTTTTTTTCGTTTTGCATTGAGTTTTCTCCGTCGCATGTTTGCAGTTTTATTTTCCGTTTTGCATTGAAATTTCTCC GTCTCATGTTTGCAGCGTGTTCAAAAAGTACGCAGCTGTATTTCACTTATTTACGGCGCCACATTTTCATGCCGTTT GTGCCAACTATCCCGAGCTAGTGAATACAGCTTGGCTTCACACAACACTGGTGACCCGCTGACCTGCTCGTACCTCG TACCGTCGTACGGCACAGCATTTGGAATTAAAGGGTGTGATCGATACTGCTTGCTGCTCATGAATCCAAACCACACG GAGTTCAAATTCCCACAGATTAAGGCTCGTCCGTCGCACAAGGTAATGTGTGAATATTATATCTGTCGTGCAAAATT GCCTGGCCTGCACAATTGCTGTTATAGTTGGCGGCAGGGAGAGTTTTAACATTGACTAGCGTGCTGATAATTTGTGA GAAATAATAATTGACAAGTAGATACTGACATTTGAGAAGAGCTTCTGAACTGTTATTAGTAACAAAAATGGAAAGCT GATGCACGGAAAAAGGAAAGAAAAAGCCATACTTTTTTTTAGGTAGGAAAAGAAAAAGCCATACGAGACTGATGTCT CTCAGATGGGCCGGGATCTGTCTATCTAGCAGGCAGCAGCCCACCAACCTCACGGGCCAGCAATTACGAGTCCTTCT AAAAGCTCCCGCCGAGGGGCGCTGGCGCTGCTGTGCAGCAGCACGTCTAACATTAGTCCCACCTCGCCAGTTTACAG GGAGCAGAACCAGCTTATAAGCGGAGGCGCGGCACCAAGAAGCG GGCATGAACCTCGTGTTCGT

[0040] 2. Identification of barley mutants

[0041] Obtaining transgenic barley: The CRISPR / Cas9 gene-editing vector pLGYE001-wxcds was introduced into Agrobacterium tumefaciens EHA105 via heat shock. Then, through Agrobacterium-mediated genetic transformation, the pLGYE001-wxcds vector was transferred into immature barley embryos. After callus screening, regeneration screening culture, and differentiation culture, six regenerated seedlings were obtained. After pestling the leaves, testing with PAT / bar rapid test strips revealed that two regenerated seedlings contained the transgenic PAT / bar gene. Genomic DNA was extracted from leaves of PPT-resistant plants and used as a template for PCR analysis using Ubi3 primers. The results showed that both PPT-resistant regenerated plants were transgenic.

[0042] 3. TA cloning and sequencing of the Waxy gene

[0043] The genomic DNA of the transgenic plants was amplified using specific primers of the Waxy gene, and the sequencing results were as follows: Figure 2 The results showed that both edited plants had biallelic mutations, namely, the deletion of single bases G and T, and the deletion of single base G and the insertion of single base A.

[0044] The nucleotide sequence of the mutated Waxy gene was translated into an amino acid sequence and compared with the wild type. Figure 3 The results showed that both the wx13-1 and wx14-1 alleles contained a stop codon at 124 bp, encoding 41 amino acids with 15 variants. wx13-2 contained a stop codon at 124 bp, encoding 41 amino acids with 14 variants. wx14-2 contained a stop codon at 412 bp, encoding 137 amino acids with 106 variants. This suggests that single-base deletions and insertions at the second target site resulted in a frameshift mutation, leading to premature termination of protein coding.

[0045] 4. SDS-PAGE detection of GBSSI protein in the edited line

[0046] GBSSI protein (60 kDa) was extracted from seeds of wild-type and T0-generation edited lines and analyzed by SDS-PAGE (Figure 4 ), the wild-type barley GBSSI protein was expressed normally, while the two edited barley GBSSI proteins were not expressed, which was consistent with the previous amino acid sequence analysis results.

[0047] 5. Phenotypic Analysis of Edited Barley Lines

[0048] Cross-sections of wild-type and Wx14 edited barley grains (barley grains cultivated from the two transgenic plants identified in "2. Identification of Barley Mutants") were stained with I2-KI solution. The results showed that the wild-type endosperm was blue-black, with a large number of irregular B-type starch granules in addition to A-type starch granules. Both A-type and B-type starch granules were blue-black. The endosperm of the edited Wx14 line was brick red, with mainly A-type starch granules and very few B-type starch granules. Both were brick red ( Figure 5 ).

[0049] The wild-type and edited barley endosperms were observed under a scanning electron microscope. In the wild-type endosperm, the surface of the A-type starch granules was basically smooth and oval, surrounded by a large number of irregular B-type starch granules ( Figure 6 ac); while in the edited line Wx14, the A-type starch granules were relatively unfull, mainly surrounded by protein, and the B-type starch granules were very few ( Figure 6 df).

[0050] The contents of amylose, amylopectin, total soluble sugar, sucrose, β-glucan and protein in the grains were determined. The results showed that the contents of amylopectin (39.00% in the wild type and 31.73% in Wx14) and protein (10.88% in the wild type and 11.94% in Wx14) in the wild type and Wx14 were relatively stable, while the contents of amylose, soluble sugar, sucrose and β-glucan changed significantly in the wild type and Wx14. The amylose content of the wild type was 33.50%, while that of Wx14 was zero, and the content of total starch (amylose + amylopectin) decreased. The soluble sugar contents of the wild type and Wx14 were 10.2% and 37.3%, respectively, and the contents of sucrose and β-glucan in Wx14 increased by 39.16% and 35.40%, respectively, compared with the wild type. Figure 7 B) In addition, agronomic traits of wild-type and Wx14-edited lines grown in a light-controlled culture chamber were measured. Compared with the wild-type, plant height, tiller number, ear length, and number of grains per ear were not significantly different in the edited lines, but 1000-grain weight was significantly different, decreasing by 10.42% ( Figure 7 B).

[0051] 6. Transcriptome Analysis

[0052] Grains from wild-type and Waxy mutant lines (i.e., progeny of the Wx14 edited line) were collected 16 days after flowering for transcriptome analysis. Based on FPKM values, a total of 1204 differentially expressed genes (DEGs) were identified between the wild-type and Waxy mutant lines. Compared with the wild-type, 386 DEGs were downregulated and 818 were upregulated in the Waxy mutant line. Of these, 526 DEGs could be categorized as "cellular processes," "environmental information processing," "genetic information processing," "metabolism," and "organismal system functions." The majority of these differentially expressed genes were associated with the "metabolism" pathway, with 95 DEGs and 80 DEGs enriched in "biosynthesis of other secondary metabolites" and "carbohydrate metabolism," respectively. Within the "starch and sucrose" metabolic pathway, 36 structural genes showed altered expression levels. Similar to the qRT-PCR results, expression levels of Waxy genes were decreased in the Waxy mutant line, likely due to the loss of GBSS protein. The blockage in amylose biosynthesis promotes the biosynthesis of amylopectin and other polysaccharides with the same substrate, D-glucose. The expression levels of two ADP-glucose pyrophosphorylases, two starch synthases, and two 1,4-α-glucan branching enzymes related to amylopectin biosynthesis were higher in the waxy mutant than in the wild type, with log2FoldChange values ​​ranging from 2.05 to 3.08. The expression levels of the genes encoding four glucan endo-1,3-β-glucosidases differed between the wild type and the waxy mutant, with three genes being upregulated in the waxy mutant ( Figure 8 and Table 1). The expression of genes encoding α-amylase and β-amylase was lower, which may be due to the lower starch content in the Waxy mutant line.

[0053] Table 1 Differential genes in starch and sucrose metabolic pathways between wild type and Waxy mutant lines

[0054]

[0055] 7. Editor's Note on the Quality of Barley Flour and Noodles

[0056] The gelatinization properties of barley flour are primarily determined by the content and ratio of amylose and amylopectin, which have a significant impact on processing quality. The gelatinization properties of wild-type and waxy mutant flours were measured using a rapid viscoanalyzer (RVA, Model 4D, Newport Scientific, Australia). Compared with the wild-type, the gelatinization temperature of the waxy mutant decreased from 84.50°C in the wild-type to 69.38°C. The peak viscosity, trough viscosity, final viscosity, and retrogradation value of the waxy mutant were 16.40%, 85.25%, 85.38%, and 86.76% lower than those of the wild-type, respectively, while the breakage value was 53.93% higher than that of the wild-type. There was no significant difference in gelatinization time between the wild-type and the waxy mutant.

[0057] Table 2 Flour gelatinization properties of wild type and Waxy mutant lines

[0058]

[0059] To evaluate the effect of glutinous flour on processed products, we conducted a comprehensive evaluation of sensory evaluation, cooking performance, and texture characteristics of noodles made from wild-type and waxy mutant flours. 51% barley flour (wild-type and waxy mutant) and 49% mixed flour (wheat flour, gluten, starch, soy protein isolate) were mixed evenly, and then 40% water was added to make noodles ( Figure 9 Sensory evaluation and cooking performance testing of the noodles were conducted according to LS / T 3202-1993 and LS / T 3212-2021 (Industry Standards of the People's Republic of China). Noodles made from wild-type and waxy mutant flours had similar sensory characteristics, with no significant differences in color, appearance, palatability, toughness, stickiness, smoothness, and taste (Table 3).

[0060] Table 3 Sensory evaluation of wild type and Waxy mutant noodles

[0061]

[0062] After cooking, the noodles were removed from the dish, rinsed with tap water for 30 seconds, and then drained. Texture analysis of the noodles was performed using a TMS-PRO high-precision food physical property analyzer (FTC, USA). Compared with wild-type noodles, the water absorption rate and cooking time of the Waxy mutant noodles were reduced by 40.98% and 38.64%, respectively. However, the weight loss rate of the Waxy mutant noodles after cooking was significantly higher. Texture analysis revealed that the hardness, elasticity, cohesiveness, chewiness, gumminess, tensile strength, and tensile size of the noodles were reduced by 49.28%, 28.75%, 16.67%, 70.58%, 58.69%, 17.39%, and 45.99%, respectively, compared with the wild-type noodles (Table 4).

[0063] Table 4 Analysis of cooking quality and texture of noodles of wild type and Waxy mutant lines

[0064]

[0065] In summary, the present invention designed two targets for the coding region sequence of the Golden Promise Waxy gene in spring barley. The dual-target CRISPR / Cas9 expression vector constructed based on this design can create a new waxy barley variety with zero amylose and significantly increased soluble sugar content, providing a new germplasm resource for improving the quality of barley seeds and barley processed foods.

Claims

1. A gene fragment, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

7.

2. A CRISPR / Cas9 gene editing vector for preparing waxy barley, characterized by: It is a recombinant vector connected with a nucleotide sequence such as SEQ ID NO.

7.

3. The CRISPR / Cas9 gene editing vector according to claim 2, characterized in that: The recombinant vector is a recombinant vector carrying the cas9 gene based on the PBuE411 plasmid.

4. A method for constructing the CRISPR / Cas9 gene editing vector according to claim 2 or 3, characterized in that: It includes the following steps: The gene fragment with the nucleotide sequence shown in SEQ ID NO.7 was taken and connected by Golden Gate enzyme ligation reaction to form a recombinant vector carrying the cas9 gene based on the PBuE411 plasmid.

5. Use of the CRISPR / Cas9 gene editing vector according to claim 2 or 3 in preparing waxy barley.

6. A method for preparing waxy barley, characterized in that: It includes the following steps: The CRISPR / Cas9 gene editing vector according to claim 2 is transferred into Agrobacterium, and then the CRISPR / Cas9 gene editing vector is transferred into barley immature embryos through the Agrobacterium-mediated method. The barley immature embryos are cultured and sequenced to obtain waxy barley plants.

7. The method according to claim 6, characterized in that: The culture includes callus culture, regeneration tissue culture and differentiation culture.

8. The method according to claim 6, characterized in that: The Agrobacterium is Agrobacterium EHA105.

Images