Gene OsKY capable of simultaneously regulating and controlling daily blooming time and blooming duration of rice spikelet as well as encoded protein and application of gene OsKY

Abstract

The invention discloses a novel gene OsKY capable of simultaneously regulating and controlling daily blooming time and blooming duration of rice spikelet as well as an encoded protein and application of the novel gene OsKY. OsKY is cloned through a forward genetic technology, the nucleotide sequence of the OsKY is as shown in SEQ ID NO.1, after OsKY mutation, the daily blooming time of rice spikelet can be delayed by about 50 minutes, meanwhile, the long-time blooming state is maintained, and the nucleotide sequence of the OsKY after mutation is as shown in SEQ ID NO.2. The gene can be reasonably modified by using a gene editing technology to obtain a rice variety with delayed everyday blooming time of spikelet and long-time opening state, thereby being beneficial to prolonging the time of meeting of parents in the indica-japonica hybridization process, prolonging the hybridization utilization time, and finally improving the indica-japonica hybridization success rate and reducing the cost. The hybrid seed production yield is improved.

Description

Technical Field

[0001] The present invention belongs to the fields of genetic engineering and molecular breeding, and particularly relates to a gene OsKY for simultaneously regulating the daily opening time and flowering duration of rice spikelets, as well as its encoded protein and application. Background Art

[0002] Rice is one of the world's most important food crops and a model plant for studying monocots. Flowering is an integral part of a plant's life cycle and is closely linked to rice yield and quality. Unlike the heading period, the daily flowering time of rice refers to the time within a day after heading that the rice spikelets open. The opening and closing of rice spikelets are regulated by a pair of lodicules. The spikelets open as the lodicules gradually absorb water and expand, stretching the palea and inner lemma. After flowering, the lodicules gradually lose water and shrink, completing the closing process. In rice, the daily opening time of spikelets varies between varieties. Generally, indica rice spikelets open primarily before 10:00 AM, while japonica rice spikelets open later, primarily after 11:00 AM. This difference in the daily opening time of spikelets between indica and japonica subspecies can lead to a mismatch between the flowering times of the parents during indica-japonica hybridization, shortening the window for outcrossing, reducing the success rate of outcrossing, and ultimately impacting seed yield in indica-japonica hybrids. Hybrid rice seed production is not only influenced by the opening time of the parents' spikelets, but also by the duration of their daily opening. In most cases, spikelets close 40 to 90 minutes after opening, and this process is influenced by numerous environmental factors. This further shortens the time available for hybridization during indica-japonica hybridization, which also affects the success rate of indica-japonica hybridization. However, limited research has been conducted on the regulatory pathways governing both the daily opening time of spikelets and the duration of their open state. Summary of the Invention

[0003] The present invention aims to provide a novel gene, OsKY, that regulates the daily opening time of rice spikelets and participates in the spikelet closure process, to address the related issues mentioned in the background art. Knocking out this gene in rice can delay the daily opening time of rice spikelets by approximately 50 minutes and maintain their open state for a longer period of time. This not only addresses the issue of parental flowering during indica-japonica hybridization, but also extends the hybridization time, thereby increasing the outcrossing rate, increasing seed production yield, and reducing costs.

[0004] The technical solutions of the present invention are as follows:

[0005] The first object of the present invention is to provide a gene OsKY that controls the daily opening time and / or flowering duration of rice spikelets. The nucleotide sequence of the gene OsKY is shown in SEQ ID NO.1.

[0006] The second object of the present invention is to provide a protein encoded by the aforementioned gene OsKY, the amino acid sequence of which is shown in SEQ ID NO.3.

[0007] The third object of the present invention is to provide a mutant gene osky of the aforementioned gene OsKY. The nucleotide sequence of the mutant gene osky is shown in SEQ ID NO.2. Compared with SEQ ID NO.1, the 1106th base is mutated from G to A.

[0008] The fourth object of the present invention is to provide a knockout expression vector for the aforementioned gene OsKY.

[0009] Furthermore, the knockout target sequence of the knockout expression vector is shown in SEQ ID NO.4 and SEQ ID NO.5:

[0010] 5'-TGGACTACCAGAGTGTGACTC-3' (SEQ ID NO.4);

[0011] 5'-TACAAGCCTTGGCAGACGCT-3' (SEQ ID NO. 5).

[0012] A fifth object of the present invention is to provide a use of the aforementioned gene OsKY or the aforementioned protein or the aforementioned mutant gene osky or the aforementioned knockout expression vector in regulating the daily opening time of rice spikelets and / or the flowering duration of rice spikelets.

[0013] Furthermore, knocking out or mutating the aforementioned gene OsKY or reducing the aforementioned protein expression level or mutating the gene OsKY in rice into the aforementioned mutant gene osky or introducing the aforementioned knockout expression vector into rice can delay the daily opening time of rice spikelets and / or maintain the spikelets in an open state for a long time.

[0014] A sixth object of the present invention is to provide a reagent for detecting the aforementioned gene OsKY or the aforementioned mutant gene osky for use in identifying the time of rice spikelet opening and / or spikelet flowering duration.

[0015] Furthermore, when the rice contains the aforementioned gene OsKY, the rice to be tested is a variety in which the spikelets open earlier each day and / or the spikelets can close normally; when the rice contains the aforementioned mutant gene osky, the rice to be tested is a variety in which the spikelets open later each day and / or can maintain the spikelets open for a long time.

[0016] Beneficial effects:

[0017] The present invention develops a new gene that regulates the daily opening time and flowering duration of rice spikelets. By knocking out the gene OsKY shown in SEQ ID NO.1 through gene editing technology, a rice variety with delayed daily spikelet opening time and spikelets remaining open for a long time is obtained. This is beneficial for increasing the time when the two parents' flowers meet during indica-japonica hybridization and extending the hybridization utilization time, ultimately improving the success rate of indica-japonica hybridization, increasing seed production yield, and reducing costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The phenotypes of wild type 'Wuyunjing 7' (WYJ7) and mutant osky, among which,

[0019] Figure 1 A is a picture of wild type (WT) and mutant osky plants;

[0020] Figure 1 B is the wild type spikelet phenotype after flowering;

[0021] Figure 1 C is the phenotype of osky spikelet status after flowering;

[0022] Figure 1 D is a statistical graph showing the number of open spikelets in the wild type and osky after one week of flowering;

[0023] Figure 1 E is the spikelet opening phenotype of the wild type and osky at 11 a.m.;

[0024] Figure 1 F is the statistical graph of daily opening time of spikelets of wild type and osky in 5 consecutive days;

[0025] Figure 1 G is a cross-section of a paraffin section of a spikelet during the booting period of the wild type;

[0026] Figure 1 H is Figure 1 Enlarged image of the red box area in G;

[0027] Figure 1 I is Figure 1 Enlarged image of the green box area in G;

[0028] Figure 1 J is a cross-section of a paraffin section of a spikelet during osky's booting period;

[0029] Figure 1 K is Figure 1 Enlarged image of the red box area in J;

[0030] Figure 1 L is Figure 1 Magnified image of the green box area in J.

[0031] Figure 2 The lodicule morphology of wild type WYJ7 and mutant osky before and after flowering is observed.

[0032] Figure 2 A is the diagram of lodicule morphology changes in wild type and osky at different time points;

[0033] Figure 2 B is a schematic diagram of the parameters specified for calculating the volume of the blade;

[0034] Figure 2 C is a statistical graph of the lodicule volume in wild type and osky at different time points.

[0035] Figure 3 The map-based cloning of OsKY on rice chromosome 2 and the phenotypic verification of transgenic plants were conducted.

[0036] Figure 3 A is the fine mapping map of the OsKY gene locus;

[0037] Figure 3 B is a schematic diagram of the gene structure and mutation sites of OsKY;

[0038] Figure 3 C is the phenotype of wild type, osky and OsKY knockout families after the spikelets have finished opening;

[0039] Figure 3 D is the phenotype of mature grains of wild type, osky and OsKY knockout families;

[0040] Figure 3 E is a statistical graph showing the number of spikelets that remained open in the wild type, osky, and OsKY knockout families one week after flowering;

[0041] Figure 3 F is the phenotype of spikelet opening of wild type, osky and OsKY knockout families at 10:30 am;

[0042] Figure 3 G is a statistical graph of the daily opening time of spikelets of the wild type, osky and OsKY knockout families over 5 consecutive days;

[0043] Figure 3 H is a statistical graph of the number of spikelets opened at different time points in a day for the wild type, osky and OsKY knockout families. DETAILED DESCRIPTION

[0044] The present invention is further explained below with reference to the following examples, but the examples do not limit the present invention in any form.

[0045] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0046] Example 1 Discovery of the mutant osky with delayed flowering and spikelets remaining open for a long time

[0047] 1. Phenotypic and genetic analysis of the osky mutant

[0048] In the EMS mutagenesis pool, a mutant whose spikelets opened later and remained open for a long time was screened out and named osky.

[0049] Before flowering, the spikelet morphology of osky was consistent with that of the wild type WYJ7, and both remained tightly closed. However, the spikelets of the wild type began to open gradually around 10 am, while the spikelets of osky were delayed by about 50 minutes and began to open at around 11 am. Figure 1 A. Figure 1 E and 1F). After one week of flowering, the number of spikelets that remained open was counted. The wild-type spikelets were almost completely closed, with the proportion of spikelets that remained open being 1.22%, while that of osky was 43.4%, indicating that osky can significantly prolong the flowering time of spikelets ( Figure 1 B to 1D).

[0050] Paraffin sections were taken of spikelets of wild-type WYJ7 and osky mutants during the booting period. The results showed that both the wild-type and osky mutants had normal lemma structures. Magnified observation of the hooked area revealed that both the lemma and the palea had obvious hook-like protrusions and were tightly hooked. These results indicate that the lemma development of osky is normal ( Figure 1 G to 1L). The lodicules of the wild type and osky mutants before and after flowering were observed under a stereomicroscope, and it was found that there was no obvious difference in the lodicule volume between the wild type and osky around 8 o'clock in the morning. As the lodicules gradually absorbed water and swelled, the wild type reached its maximum lodicule volume at 10 o'clock, while the lodicule volume of osky reached its maximum at around 11 o'clock. In addition, as the lemma ended its opening, the lodicules in the wild type gradually lost water and shrank, but the lodicules of osky remained in a swollen state even on the second day after flowering. This shows that the delay in the daily opening time of the osky lemma and the long-term maintenance of the open state are not caused by the lemma itself, but are caused by the delay in the dynamic process of lodicule expansion and shrinkage ( Figure 2 A to 2C).

[0051] 2. Map-based cloning of mutant gene sites

[0052] 1. Localization of mutant genes

[0053] The mutant osky was used as the female parent and hybridized with the indica rice variety 'Nanjing 11' to obtain the F1. The F1 was then self-pollinated to obtain the F2 population. The extreme F2 population with the open spikelet phenotype was selected for gene mapping. Public Indel and SSR markers were used to screen for Indel and SSR markers that showed polymorphism on 12 chromosomes between 'Nanjing 11' and the mutant osky. These markers were used for preliminary mapping. Polymorphic molecular markers were added to further narrow the mapping interval to between KY-11 and KY-35. The physical distance between the two molecular markers was approximately 420kb ( Figure 3 A).

[0054] The method for the above-mentioned SSR marker analysis is as follows:

[0055] There are two methods for DNA extraction involved, namely the CTAB method and the TPS method. The extraction steps of the CTAB method are as follows:

[0056] (1) Take an appropriate amount of plant sample and place it in a 2 mL EP tube. Add a small steel ball to the EP tube, freeze the sample in liquid nitrogen for about 5 minutes, and grind the sample into powder using a grinder.

[0057] (2) Preheat CTAB solution at 65°C;

[0058] (3) Add 600 μL of preheated CTAB solution and incubate in a 65°C water bath for 30 min, shaking and mixing every 5-10 min.

[0059] (4) Add a mixture of chloroform and isoamyl alcohol (24:1) equal in volume to CTAB, mix by inversion, and spin at 12,000 rpm for 5 min.

[0060] (5) Pipette 400 μL of supernatant into a new 1.5 mL EP tube, add 0.7 times the volume of supernatant to isopropanol, and incubate at -20°C for 2 h;

[0061] (6) Centrifuge at 12000 rpm, discard the supernatant, and wash 1-2 times with 70% alcohol;

[0062] (7) Place on a clean bench to dry any residual alcohol, then add ddH2O to dissolve it;

[0063] (8) DNA concentration was detected using NanoDrop2000 nucleic acid protein analyzer, and DNA was stored at 4°C for a short period of time.

[0064] The TPS extraction steps are as follows:

[0065] (1) Place an appropriate amount of plant sample into a 96-well plate, leaving the last well empty. Add small steel balls and freeze the sample in liquid nitrogen for approximately 5 minutes. Grind the sample into powder using a grinder.

[0066] (2) Centrifugation, 12000 rpm, 10 min;

[0067] (3) Preheat the shaker (200 rpm, 45-50 min, 50°C);

[0068] (4) Add 400 μL of TPS extract using a pipette and place on a preheated shaker;

[0069] (5) Centrifuge at 12000 rpm for 15 min, aspirate 100 μL of the supernatant, add 0.7 times the volume of isopropanol, and shake to mix;

[0070] (6) Freeze at -20°C for 4 h, centrifuge at 12,000 rpm for 20 min, and discard the supernatant;

[0071] (7) Add 70% alcohol to clean 1-2 times, place on a clean bench to dry the residual alcohol, and add ddH2O to dissolve;

[0072] (8) DNA concentration was detected using NanoDrop2000 nucleic acid protein analyzer, and DNA was stored at 4°C for a short period of time.

[0073] (9) Dilute the extracted DNA to about 20 ng / μL and use it as a template for PCR amplification:

[0074] The PCR reaction system is:

[0075]

[0076]

[0077] The PCR reaction program is:

[0078]

[0079] Molecular markers were developed using an online website (http: / / ricevarmap.ncpgr.cn / ), and the reference genomes were Nipponbare and 9311.

[0080] Table 1 Molecular markers used for fine mapping

[0081]

[0082] 2. Acquisition of target genes

[0083] By resequencing the wild type and osky, we screened for genes with SNP differences within the 420 kb range of chromosome 2. We found that the first base G in the splice donor site of the third intron of gene LOC_Os02g17390 mutated to A, that is, the 1106th base of the nucleotide sequence shown in SEQ ID NO.1 mutated from G to A, and the nucleotide sequence shown in SEQ ID NO.2 was obtained. In this case, the splice donor site of the third intron in mRNA splicing was shifted 7 bp ( Figure 3 B), which eventually causes a frameshift mutation and premature translation termination, so it was selected as our candidate gene and named OsKY.

[0084] Example 2 Acquisition and identification of transgenic plants

[0085] 1. Construction of knockout expression vector

[0086] The knockout primers for the candidate gene OsKY were designed using the CRISPR-P online website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). The primer sequences are:

[0087] Primer1: 5'-AGATGATCCGTGGCATGGACTACCAGAGTTGACTCGTTTTAGAGCTATGC-3' (SEQ ID NO. 6);

[0088] Primer2: 5'-TTCTAGCTCTAAAACTACAAGCCTTGGCAGACGCTCTGAGCCTCAGCGCAGCAGCTTA-3' (SEQ ID NO. 7).

[0089] The knockout target sequences are: 5'-TGGACTACCAGAGTTGACTC-3' (SEQ ID NO. 4) and 5'-TACAAGCCTTGGCAGACGCT-3' (SEQ ID NO. 5).

[0090] The PCR products amplified with the above primers were purified and recovered, and then recombined with the corresponding linearized vectors. Recombination system (10 μL): DNA 3 μL, linearized vector 2 μL, recombinant mix 5 μL (Takara).

[0091] Vector construction steps:

[0092] a) Place 10 μL of the mixture in a 50°C water bath for 20 min to reconstitute.

[0093] b) Transfer the recombinant product into 100 μL of competent E. coli (DH5α) and mix thoroughly. Incubate on ice for 25 minutes. Then, heat shock the culture in a 42°C water bath for 60 seconds and place on ice for 5 minutes.

[0094] c) Add 500 μL of E. coli culture medium and resuspend in a shaker at 37°C for 1 h.

[0095] d) Add the corresponding antibiotics to the plate and incubate upside down in a 37°C incubator for 15 h.

[0096] e) Pick a single clone of the strain and place it in a sterile PE tube containing 1 ml of culture medium. Incubate at 37°C for 6 hours. Extract the expression vector plasmid and sequence it.

[0097] f) The knockout vector, functional complementation vector and fusion complementation vector were transformed into Agrobacterium EHA105 strain respectively by freeze-thaw method to obtain recombinant strains.

[0098] 2. Obtaining Transgenic Plants

[0099] 1. Infection of callus tissue

[0100] a) The transgenic knockout strain was cultured at 28°C for 16 hours, the cells were collected, and diluted into N6 liquid medium (Sigma, C1416) to a concentration of OD600≈0.5 to obtain a bacterial solution.

[0101] b) Callus tissue prepared from wild-type WYJ7 was infected with the knockout strain and cultured for 3 days.

[0102] c) The infected callus tissue was transferred to N6 solid medium containing the corresponding resistance screening compound and screened for 15 days.

[0103] d) Select healthy calli and perform a second screening using the corresponding screening medium.

[0104] e) Pick out resistant calli and place them on screening differentiation medium for differentiation.

[0105] 2. Identification of transgenic plants.

[0106] Identification of transgenic knockout plants: Amplification primers were designed around 200 bp upstream and downstream of the knockout target site, DNA was extracted from the transgenic plants for amplification, and sequencing analysis was performed. Homozygous knockout plants all showed daily delayed flowering, and after one week of flowering, the proportion of spikelets that remained open was around 40%, much higher than that of the wild type. This indicates that knockout of OSKY can significantly prolong the flowering time of spikelets ( Figure 3 C to 3H). The primer sequences are:

[0107] Primer3:

[0108] 5'TTAGTACCACCTCGGCTATCCAC 3' (SEQ ID NO. 8);

[0109] Primer4:

[0110] 5'ATACAAATGGACGAACGG 3' (SEQ ID NO. 9).

[0111] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. The gene OsKY that controls the daily opening time and / or flowering duration of rice spikelets is characterized by: The nucleotide sequence of the gene OsKY is shown in SEQ ID NO.

1.

2. The protein encoded by the gene OsKY according to claim 1, characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

3.

3. The mutant gene osky of the gene OsKY according to claim 1, characterized in that The nucleotide sequence of the mutant gene osky is shown in SEQ ID NO.

2.

4. A knockout expression vector for the gene OsKY according to claim 1.

5. The knockout expression vector according to claim 4, characterized in that The knockout target sequences of the knockout expression vector are shown in SEQ ID NO.4 and SEQ ID NO.

5.

6. Use of the gene OsKY according to claim 1, or the protein according to claim 2, or the mutant gene osky according to claim 3, or the knockout expression vector according to claim 4 in regulating the daily opening time of rice spikelets and / or the flowering duration of rice spikelets.

7. The use according to claim 6, characterized in that By knocking out or mutating the gene OsKY according to claim 1, or reducing the expression level of the protein according to claim 2, or mutating the gene OsKY in rice into the mutant gene osky according to claim 3, or introducing the knockout expression vector according to claim 4 into rice, mutant line plants in which the daily opening time of rice spikelets is delayed and / or the spikelets are maintained in an open state for a long time can be obtained.

8. Use of a reagent for detecting the gene OsKY according to claim 1 or the mutant gene osky according to claim 3 in identifying the daily opening time of rice spikelets and / or the duration of spikelet flowering.

9. The use according to claim 8, characterized in that When the rice contains the gene OsKY described in claim 1, the rice to be tested is a variety in which the spikelets open earlier each day and / or the spikelets can close normally. When the rice contains the mutant gene osky described in claim 3, the rice to be tested is a variety in which the spikelets open later each day and / or can maintain the spikelets open for a long time.

Images