Application of protein FoUPE10 in regulation and control of pathogenicity of fusarium oxysporum
By knocking out or knocking down the FoUPE10 gene of the 4th species of banana blight bacteria, the ΔFoUPE10 mutant and ΔFoUPE10-com back-complement mutant were constructed, which solved the problem of strong pathogenicity of banana blight bacteria and achieved effective prevention and treatment of banana blight.
Patent Information
- Application Number
- CN202510426306.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-07
- Publication Date
- 2025-08-22
AI Technical Summary
At present, there is a lack of effective methods to prevent and treat banana blight, especially serious diseases caused by small species 4 of banana blight bacteria, and the prior art cannot effectively reduce its pathogenicity.
By knocking out or knocking down the FoUPE10 gene of banana blight 4, the knockout mutant ΔFoUPE10 was constructed using homologous recombination and PEG-mediated transformation methods, and the back-complement mutant ΔFoUPE10-com was obtained by random insertion, reducing its pathogenicity.
It significantly reduces the pathogenicity of banana blight bacteria, reduces the occurrence and harm of diseases, and provides new methods to prevent and treat banana blight.
Smart Images

Figure CN120519481A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and more specifically relates to the application of protein FoUPE10 in regulating the pathogenicity of banana Fusarium wilt pathogen. Background Art
[0002] Banana is an important tropical and subtropical crop and the fourth largest food crop after rice, wheat and corn. Its production is of great significance to food security.
[0003] Banana wilt is a soil-borne fungal disease caused by Fusarium oxysporum f.sp.cubense (Foc), which severely impacts banana growth and reduces yield. Foc is divided into three races based on their pathogenicity to bananas: races 1, 2, and 4. Race 4 (Foc4) infects almost all banana varieties, with the tropical form of race 4 (Foc TR4) being the most devastating.
[0004] Currently, there are no commercial banana varieties that are fully immune to banana wilt, and there is also a lack of ideal control drugs. Therefore, research on the pathogenicity of Foc can be conducted to identify proteins and other nucleic acid molecules related to its pathogenicity, which can be used as targets for banana wilt control. Summary of the Invention
[0005] In view of the deficiencies in the prior art, the present invention provides an application of the protein FoUPE10 in regulating the pathogenicity of banana Fusarium wilt.
[0006] The first objective of the present invention is to provide an application of the protein FoUPE10 in regulating the pathogenicity of banana Fusarium wilt pathogen.
[0007] The second object of the present invention is to provide a use of an agent for knocking down or knocking out a gene encoding protein FoUPE10 in reducing the pathogenicity of banana Fusarium wilt.
[0008] The third object of the present invention is to provide a use of an agent for knocking down or knocking out a gene encoding protein FoUPE10 in the preparation of a product for reducing the pathogenicity of banana Fusarium wilt.
[0009] A fourth object of the present invention is to provide use of an agent for knocking down or knocking out a gene encoding the protein FoUPE10 in preventing and / or treating banana wilt.
[0010] A fifth object of the present invention is to provide use of an agent for knocking down or knocking out a gene encoding the protein FoUPE10 in the preparation of a product for preventing and / or treating banana wilt.
[0011] The above-mentioned purpose of the present invention is achieved through the following technical solutions:
[0012] During the study of the secretory proteomics of banana Fusarium wilt race 4, the present invention discovered a non-classical secretory protein lacking an N-terminal signal peptide, designated FoUPE10, whose amino acid sequence is shown in SEQ ID NO. 1. To investigate the relationship between FoUPE10 and Foc pathogenicity, the present invention constructed a knockout vector encoding the gene (FoUPE10) through homologous recombination. The knockout mutant, ΔFoUPE10, was transformed into Foc TR4 protoplasts via PEG-mediated transformation. Based on the knockout mutant ΔFoUPE10, the complement mutant, ΔFoUPE10-com, was generated using a random insertion method.
[0013] The resulting knockout mutant, ΔFoUPE10, showed no significant differences in colony growth rate, conidia production, cell wall integrity, resistance to hyperosmotic stress, resistance to oxidative stress, or cellophane penetration compared to the wild-type Foc TR4. However, its pathogenicity was significantly reduced, while the pathogenicity of the corresponding complemented mutant was restored to wild-type levels. This indicates that the protein FoUPE10 is associated with the pathogenicity of banana Fusarium wilt. Therefore, the present invention seeks to protect the use of the protein FoUPE10 in regulating the pathogenicity of banana Fusarium wilt.
[0014] Specifically, the amino acid sequence of the protein FoUPE10 is shown in SEQ ID NO.1.
[0015] Specifically, the application is the application of protein FoUPE10 in reducing the pathogenicity of banana wilt pathogen; the application is achieved by knocking down or knocking out the gene encoding protein FoUPE10 in banana wilt pathogen.
[0016] In a specific embodiment of the present invention, the nucleotide sequence of the gene encoding the protein FoUPE10 is shown as SEQ ID NO.2.
[0017] Given that knocking out the gene FoUPE10, which is responsible for the banana wilt pathogen, can significantly reduce the pathogenicity of the pathogen, and that knocking down or knocking out a gene has similar effects, the present invention also seeks to protect the use of an agent for knocking down or knocking out the gene encoding the protein FoUPE10 to reduce the pathogenicity of banana wilt pathogen.
[0018] Similarly, the present invention also claims protection for the use of an agent for knocking down or knocking out the gene encoding the protein FoUPE10 in the preparation of a product for reducing the pathogenicity of banana Fusarium wilt.
[0019] Specifically, the banana wilt pathogen is banana wilt pathogen race 4.
[0020] More specifically, the banana wilt pathogen is banana wilt pathogen race 4 tropical type.
[0021] Since banana wilt is caused by the pathogen Fusarium wilt, reducing its pathogenicity can prevent its occurrence and mitigate its harmful effects. Therefore, the present invention also seeks to protect the use of the agent for knocking down or eliminating the gene encoding the protein FoUPE10 in preventing and / or treating banana wilt.
[0022] The present invention also claims protection for the use of an agent for knocking down or knocking out a gene encoding protein FoUPE10 in the preparation of a product for preventing and / or treating banana wilt.
[0023] Specifically, the prevention and / or treatment of banana wilt disease is achieved by reducing the pathogenicity of banana wilt pathogen.
[0024] Specifically, the banana wilt pathogen is banana wilt pathogen race 4.
[0025] More specifically, the banana wilt pathogen is banana wilt pathogen race 4 tropical type.
[0026] Optionally, the nucleotide sequence of the gene encoding the protein FoUPE10 is shown as SEQ ID NO.2.
[0027] Optionally, the reagent for knocking down the gene encoding protein FoUPE10 is siRNA, dsRNA, miRNA or antisense nucleic acid that targets the transcript of the gene encoding protein FoUPE10 and can inhibit its expression or transcription; the reagent for knocking out the gene encoding protein FoUPE10 is a gene knockout vector.
[0028] In a specific embodiment of the present invention, the knockout vector is constructed based on the filamentous fungus expression vector pCT74; the knockout vector contains upstream and downstream homologous fragments of the gene FoUPE10.
[0029] The present invention has the following beneficial effects:
[0030] This study, exploring the secretory proteome of race 4 of the banana wilt pathogen, identified a non-classical secretory protein lacking an N-terminal signal peptide, named FoUPE10. By knocking out the gene encoding FoUPE10 in Foc TR4, the researchers found that the resulting knockout mutant, ΔFoUPE10, showed no significant differences in colony growth rate, conidia production, cell wall integrity, resistance to hyperosmotic stress, or resistance to oxidative stress compared to wild-type Foc TR4. However, its pathogenicity was significantly reduced, while the pathogenicity of the corresponding complementing mutant was restored to wild-type levels.
[0031] The protein FoUPE10 of the present invention is related to the pathogenicity of banana wilt pathogen, and can be used as a target to develop products for preventing and / or treating banana wilt disease. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 Schematic diagram of the construction of the knockout vector for the banana Fusarium wilt pathogen gene FoUPE10.
[0033] Figure 2 Schematic diagram of the structure of the complementation vector for the banana wilt pathogen gene FoUPE10.
[0034] Figure 3 Figure 1 is the electrophoresis analysis result of the PCR products of the knockout mutant ΔFoUPE10 candidate transformants; Figure A is the electrophoresis analysis result of the PCR products of the gene FoUPE10; Figure B is the electrophoresis analysis result of the PCR products of the gene hph.
[0035] Figure 4 Figure 2 is the Southern Blot analysis result of the knockout mutant ΔFoUPE10 candidate transformants; Figure A is the Southern Blot analysis result of the hph gene probe; Figure B is the Southern Blot analysis result of the FoUPE10 gene probe.
[0036] Figure 5 The electrophoresis analysis results of the PCR products of the complement mutant ΔFoUPE10-com candidate transformants.
[0037] Figure 6 Figure 3 shows the results of colony morphology and colony growth inhibition rate determination of the knockout mutant ΔFoUPE10 and the complement mutant ΔFoUPE10-com under different stress conditions; Figure A shows the colony morphology of the knockout mutant ΔFoUPE10 and the complement mutant ΔFoUPE10-com under different stress conditions; Figure B shows the results of colony growth inhibition rate determination of the knockout mutant ΔFoUPE10 and the complement mutant ΔFoUPE10-com under different stress conditions; the data are based on the mean (±SE) of three independent experiments, and different letters in the figure indicate significant differences analyzed by Duncan's new multiple range method (p < 0.05).
[0038] Figure 7 This is the disease status of Brazilian banana plants and bulbs 28 days after inoculation with the knockout mutant ΔFoUPE10 and the complement mutant ΔFoUPE10-com.
[0039] Figure 8Statistical analysis results of the disease index of the knockout mutant ΔFoUPE10 and the complement mutant ΔFoUPE10-com; the data are based on the mean (±SE) of three independent experiments, and different letters in the figure indicate significant differences analyzed by Duncan's new multiple range method (p < 0.05). DETAILED DESCRIPTION
[0040] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0041] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.
[0042] The banana wilt pathogen described in the present invention is Fusarium oxysporum f. fusarium wilt species (Foc). The banana wilt pathogen strain used in the examples is Fusarium wilt race 4 (Foc4), specifically Fco TR4. The test plant is a Brazilian banana (Cavendish, AAA) with 4 to 5 leaves.
[0043] The host bacteria used in the present invention is Escherichia coli DH5α; the cloning vector used is pMD18T vector; the gene knockout vector used is the filamentous fungus expression vector pCT74; and the gene complementation vector used is pCTZN, which is obtained by replacing the fluorescent protein gene (gfp) and hygromycin phosphotransferase gene (hph) on the vector pCT74 with the bleomycin gene.
[0044] Czapek medium: 3 g sodium nitrate, 1 g potassium hydrogen phosphate trihydrate, 0.5 g potassium chloride, 0.5 g magnesium sulfate heptahydrate, 0.018 g ferrous sulfate heptahydrate, 30 g sucrose, and dilute to 1 L with distilled water.
[0045] CM medium: 2 g tryptone, 1 g yeast extract, 1 g casein hydrolysate, 50 mL 20× nitrate, 10 g glucose, 1 mL 1000× vitamins, 1 mL 1000× trace elements, dilute to 1 L with ddH2O, pH 6.5.
[0046] Example 1 Construction of knockout mutants and complementing mutants of the gene FoUPE10
[0047] The present invention utilizes the principle of homologous recombination to knock out the gene FoUPE10 of banana wilt pathogen, thereby constructing the corresponding knockout mutant. Figure 1 As shown. Combined Figure 1It can be seen that the present invention replaces the gene FoUPE10 in banana wilt fungus with hph and gfp through homologous recombination, thereby achieving the knockout of the gene FoUPE10. U in the figure refers to the upstream homology arm, and D refers to the downstream homology arm.
[0048] 1. Amplification of upstream and downstream homologous fragments of the FoUPE10 gene
[0049] The nucleotide sequence of the gene FoUPE10 described in the present invention is shown in SEQ ID NO. 2, and the amino acid sequence of the protein FoUPE10 encoded by it is shown in SEQ ID NO. 1. Sequences approximately 1000 bp long were selected upstream and downstream of the FoUPE10 gene (respectively designated as homology arm A fragment and homology arm B fragment), and corresponding amplification primers were designed, incorporating appropriate restriction sites. The nucleotide sequences of the resulting primers are shown in Table 1.
[0050] Table 1 Primers for amplification of homology arm A and B fragments of gene FoUPE10
[0051] Primer name Primer sequence (5'-3') Restriction site FoUPE10-AF GGGGTACCCTGACAATAAATTGATAAGTCGGA Kpn I FoUPE10-AR GGGGGCCCTTTTTCATCTAATAAACTGCGATGG Apa I FoUPE10-BF TCCCCCCGGGGTATTCCCTTGATGTAAAAGACATT Xma I FoUPE10-BR GACTAGTTAGGAAGGATGAGCATATACAAAAC Spe I
[0052] Note: The underlined part is the enzyme recognition site.
[0053] Genomic DNA of Foc TR4 was extracted using an OMEGA Fungal DNA Kit and used as a template for PCR amplification using primers FoUPE10-AF and FoUPE10-AR shown in Table 1 to obtain the homology arm A fragment (FoUPE10-A) of the FoUPE10 gene; and PCR amplification using primers FoUPE10-BF and FoUPE10-BR shown in Table 1 to obtain the homology arm B fragment (FoUPE10-B) of the FoUPE10 gene.
[0054] The PCR reaction system used to amplify the homology arm fragments is shown in Table 2.
[0055] Table 2 PCR reaction system used to amplify homology arm fragments
[0056]
[0057]
[0058] The PCR reaction conditions were as follows: 94°C for 5 min; 98°C for 10 s, 55°C for 30 s, and 72°C for 1 min, for a total of 30 cycles; and 72°C for 10 min.
[0059] After the PCR reaction, the PCR amplification products (homologous arm fragments) were cleaned and recovered using the OMEGA Cycle Pure Kit. FoUPE10-A and FoUPE10-B were ligated to the pMD18T vector, respectively. The ligation products were transformed into Escherichia coli DH5α, spread on LB solid medium (containing 50 μg / mL Amp), and cultured at 37°C for 8-12 h.
[0060] 2. Construction of knockout vector for gene FoUPE10
[0061] Positive transformants with Amp resistance were selected, and recombinant vector DNA was extracted for restriction digestion and sequencing to obtain recombinant plasmids pMD18T-FoUPE10-A and pMD18T-FoUPE10-B. pMD18T-FoUPE10-A and the pCT74 vector were double-digested with restriction endonucleases Kpn I and Apa I, respectively, to recover fragment A and the linearized pCT74 vector. Fragment A was ligated with the digested pCT74 vector using T4 DNA ligase and transformed into Escherichia coli DH5α, resulting in recombinant plasmid pCT74-FoUPE10-A. Following the same procedure, pMD18T-FoUPE10-B and recombinant plasmid pCT74-FoUPE10-A were double-digested with restriction endonucleases Xma I and Spe I, respectively, to recover fragment B and the linearized recombinant plasmid. Fragment B was ligated with the digested pCT74-FoUPE10-A using T4 DNA ligase and transformed into Escherichia coli DH5α. The gene knockout vector pCT74-FoUPE10-KO was obtained after restriction digestion and sequencing.
[0062] 3. Amplification of the FoUPE10 gene complementation fragment
[0063] Construction of the complementation vector for the FoUPE10 gene of banana wilt pathogen Figure 2 A promoter sequence of approximately 1500 bp in length was selected upstream of the FoUPE10 gene, and a terminator sequence of approximately 500 bp in length was selected downstream. The corresponding amplification primers were designed and suitable restriction sites were introduced. The nucleotide sequences of the designed primers are shown in Table 3.
[0064] Table 3 Primers for amplification of the complementation fragment of gene FoUPE10
[0065] Primer name Primer sequence (5'-3') Restriction site FoUPE10-comF GACTAGTTTACACGTCGAGCAAGACCAA Spe I FoUPE10-comR ATAAGAATGCGGCCGCCGCCGAACTCGAAGCTCTCA Not I
[0066] The extracted Foc TR4 genomic DNA was used as a template and PCR amplification was performed using the primers FoUPE10-comF and FoUPE10-comR shown in Table 3 to obtain the complementing fragment (FoUPE10-com). The PCR reaction system used to amplify the complementing fragment of the FoUPE10 gene is shown in Table 4.
[0067] Table 4 PCR reaction system used to amplify the complementation fragment of gene FoUPE10
[0068] Template DNA 1.0 μL FoUPE10-com-F (10 μmol / L) 1.0 μL FoUPE10-com-R (10 μmol / L) 1.0 μL <![CDATA[10×Ex Taq Buffer(Mg 2+ plus)]]> 5.0μL dNTP Mixture (2.5mM) 4.0μL Ex Taq (5U / μL) 0.25 μL <![CDATA[Add ddH2O to]]> 50.0μL
[0069] The PCR reaction conditions were as follows: 94°C for 5 min; 94°C for 1 min, 65°C for 1 min, and 72°C for 4 min, for a total of 30 cycles; and 72°C for 10 min.
[0070] After the PCR reaction, the PCR amplification product was cleaned and recovered using the OMEGACycle Pure Kit.
[0071] 4. Construction of the complementation vector for gene FoUPE10
[0072] The complementing fragment FoUPE10-com and the pCTZN vector were double-digested with restriction endonucleases Spe I and Not I, respectively, to recover the FoUPE10-com fragment and linearized pCTZN vector. The FoUPE10-com fragment was ligated with the digested pCTZN vector using T4 DNA ligase and transformed into Escherichia coli DH5α to obtain the recombinant plasmid pCTZN-FoUPE10-com. After enzyme digestion and identification, the gene complementing vector pCTZN-FoUPE10-com was obtained.
[0073] 5. Preparation of Foc TR4 Protoplasts
[0074] Foc TR4 was inoculated into Czapek medium and cultured with shaking at 28°C and 150 rpm for 3 days. The culture medium was filtered through a 200-mesh cell sieve and centrifuged at 4°C and 10,000 × g for 10 min, and the supernatant was discarded. The pellet was resuspended in CM medium and diluted to prepare a Foc TR4 conidia suspension. The prepared conidia suspension was inoculated into CM medium to a final conidia concentration of 1 × 10 610 cells / mL; shake culture at 28°C and 150rpm, filter with a 200-mesh cell sieve, rinse with 0.8mol / L NaCl solution 3 to 5 times to obtain fresh mycelium; add an appropriate amount of enzymatic solution according to the volume-to-mass ratio of enzyme solution to mycelium of 10:1, and enzymolysis at 30°C and 120rpm for 3h to obtain a protoplast enzymatic solution; filter the enzymatic solution in the previous step with filter paper, rinse with 0.8mol / L NaCl solution 2 to 3 times, centrifuge at 4°C and 2000rpm, and discard the supernatant; add pre-cooled STC solution (containing 10mmol / L Tris-HCl, 1.2mol / L sorbitol, 50mmol / L CaCl2, pH 7.5) to resuspend the precipitate, centrifuge, and discard the supernatant; then add pre-cooled STC to resuspend the precipitate to obtain a FocTR4 protoplast suspension, so that the final protoplast concentration is about 1×10 7 pieces / mL.
[0075] The protoplasts of the banana Fusarium wilt knockout mutant were prepared by referring to the above-mentioned steps for preparing Foc TR4 protoplasts.
[0076] 6. Protoplast transformation
[0077] The following description takes the protoplast transformation of the knockout vector of the gene FoUPE10 as an example.
[0078] The knockout vector pCT74-FoUPE10-KO was digested with Kpn I to obtain a linear fragment of pCT74-FoUPE10-KO; the linearized fragment was mixed with 200 μL of Foc TR4 protoplasts; 200 μL of PTC conversion buffer (STC containing 40% PEG4000) was added, mixed, and placed on ice for 5 minutes; 800 μL of PTC conversion buffer was added, mixed, and placed on ice; 25 mL of pre-cooled STC was added, mixed; centrifuged at 4°C, 4000 rpm for 15 minutes; and 3 mL of Resuspend the pellet in PDA liquid regeneration medium (200.0 g potato, 274 g sucrose, distilled water to 1 L), shake culture at 28°C and 100 rpm for 16 h; centrifuge at 4°C and 4000 rpm for 15 min, add PDA solid regeneration medium, mix well, pour into plates, and culture in the dark at 28°C for 2-3 days; pick hygromycin-resistant transformants, transfer them to PDA medium containing hygromycin, culture in the dark at 28°C for 3-4 days, and pick single colonies for identification.
[0079] The transformation of the complementing vector of gene FoUPE10 was the same as above. The protoplasts used for transformation were protoplasts of the banana wilt pathogen knockout mutant. The antibiotic used for screening positive transformants was bleomycin at a concentration of 200 μg / mL.
[0080] 7. PCR verification analysis of knockout mutants of the FoUPE10 gene
[0081] The genomic DNA of a single colony of the hygromycin-resistant transformant was extracted and amplified by PCR using primers A-hph-F / A-hph-R and then primers FoUPE10-F / R.
[0082] The nucleotide sequences of the primers are shown in Table 5.
[0083] Table 5 PCR validation analysis primers for knockout mutants
[0084] Primer name Primer sequence (5'-3') A-hph-F GCCTGAAGAAGTTCTGCTACCGCCG A-hph-R TGGCAAACTGTGATGGACGACACCG FoUPE10-F AACAAGGCTCTCTCCTCCCA FoUPE10-R CTTGGTGGGTTTCGCGAGTA
[0085] The PCR reaction system used for PCR verification analysis of the knockout mutant of the gene FoUPE10 is shown in Table 6.
[0086] Table 6 PCR reaction system used for PCR verification analysis of knockout mutants
[0087] 2×T5 Super PCR Mix (Basic) 12.5 μl 10μmol / L Primer F 0.5 μl 10μmol / L Primer R 0.5 μl Template DNA 0.5 μl <![CDATA[Add ddH2O to]]> 25.0μl
[0088] The PCR reaction conditions were as follows: 98°C for 3 min; 98°C for 10 s, 62°C for 10 s, and 72°C for 7 s, for a total of 30 cycles; and 72°C for 5 min to obtain the amplified product.
[0089] The present invention uses homologous recombination to transform pCT74-FoUPE10-KO into Foc TR4 protoplasts to obtain three hygromycin-resistant transformants. Genomic DNA of the hygromycin-resistant transformants was extracted and PCR analysis was performed using FoUPE10 gene-specific primers. The results are as follows: Figure 3 As shown in A. Figure 3 As shown in A, three transformants were obtained in which the FoUPE10 gene was not amplified. PCR verification analysis was performed on the three transformants using A-hph gene specific primers. The results were as follows: Figure 3 As shown in B. Figure 3 As shown in B, gene A-hph can be amplified in the above three transformants, further indicating that these three transformants are candidate transformants of ΔFoUPE10.
[0090] 8. Southern blot analysis of FoUPE10 knockout mutants
[0091] Southern blot analysis of ΔFoUPE10 candidate transformants that amplified the A-hph gene but not the FoUPE10 gene was performed using the target gene probe amplified using FoUPE10-F / FoUPE10-R and the hph gene probe amplified using hph-F / hph-R, according to the instructions of the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche). The sequences of the primers used to amplify the target gene probe and the hph gene probe are shown in Table 7; the reaction system used for gene probe amplification is shown in Table 8.
[0092] Table 7 Sequences of primers used to amplify target gene probes and hph gene probes
[0093] Primer name Primer sequence (5'-3') FoUPE10-F AACAAGGCTCTCTCCTCCCA FoUPE10-R GCCACTCCGTATTCCCTGTT hph-F TGCTGCTCCATACAAGCCAA hph-R CTTGGTGGGTTTCGCGAGTA
[0094] Table 8 Reaction system used for gene probe amplification
[0095]
[0096]
[0097] The PCR reaction conditions were as follows: 94°C for 5 min; 98°C for 10 s, 60°C for 30 s, and 72°C for 1 min, for a total of 30 cycles; and 72°C for 10 min to obtain the amplified product, which was purified and recovered and then used as a template for re-amplification using DIG Labeling Mix. The probe was obtained after verification by gel electrophoresis.
[0098] Southern blot analysis was performed on three ΔFoUPE10 candidate transformants that amplified the A-hph gene but did not amplify the FoUPE10 gene. The results were as follows: Figure 4 As shown. Figure 4 It can be seen that when hybridization was performed using hph as a probe, single copy bands appeared in all three transformants ( Figure 4 A in the figure). When hybridization was performed using the target gene as a probe, no hybridization bands were found in the three transformants ( Figure 4 B) in the figure demonstrated that these three transformants were the knockout mutant ΔFoUPE10.
[0099] 9. PCR verification analysis of complement mutants of the FoUPE10 gene
[0100] The present invention uses a random insertion method to transform the gene complementation vector pCTZN-FoUPE10-com into the protoplasts of the banana wilt pathogen gene knockout mutant ΔFoUPE10-45, and obtains five bleomycin-resistant transformants. The genomic DNA of a single colony of the bleomycin-resistant transformant (ΔFoUPE10-com candidate complementation transformant) is extracted and used as a template for PCR amplification. The complementation mutant of the gene FoUPE10 is verified by PCR analysis. The results of agarose gel electrophoresis analysis of the PCR products of the ΔFoUPE10-com candidate complementation transformant are shown in FIG. Figure 5 As shown. Figure 5 It can be seen that the target gene fragment can be amplified in 5 transformants, indicating that these 5 transformants contain the FoUPE10 gene, confirming that these 5 transformants are the complemented mutant ΔFoUPE10-com.
[0101] Example 2 Phenotypic observation and stress resistance analysis of knockout mutants and complement mutants of the FoUPE10 gene
[0102] The present invention uses verified knockout mutants ΔFoUPE10-38, ΔFoUPE10-40, ΔFoUPE10-41 and complementing mutants ΔFoUPE10-com-25, ΔFoUPE10-com-28 as experimental bacteria, observes the phenotypes of the knockout mutants and complementing mutants of the gene FoUPE10, and conducts stress resistance analysis.
[0103] 1. Phenotypic observation of knockout mutants and complement mutants of the FoUPE10 gene
[0104] (1) Colony morphology observation and growth rate determination
[0105] Conidia of the wild type Foc TR4, the knockout mutant ΔFoUPE10, and the complemented mutant ΔFoUPE10-com were inoculated in the center of PDA, CM, and MM culture medium plates, respectively. After inverted culture at 28°C in the dark for 5 days, the colony morphology was observed and the colony diameter was measured using the cross method.
[0106] The results showed that the colony morphology and growth rate of ΔFoUPE10 were not significantly different from those of the wild type Foc TR4.
[0107] (2) Determination of spore production
[0108] Conidia of the wild type Foc TR4, the knockout mutant ΔFoUPE10, and the complemented mutant ΔFoUPE10-com were inoculated into Czapek medium and cultured in a shaker at 28° C. and 120 rpm for 3 days. The conidia production was counted using a hemocytometer.
[0109] The results of conidia production assay showed that there was no significant difference in conidia production between ΔFoUPE10 and the wild type Foc TR4.
[0110] 2. Stress resistance analysis of knockout and complement mutants of FoUPE10
[0111] (1) Hyperosmotic stress analysis
[0112] The wild type Foc TR4, the knockout mutant ΔFoUPE10, and the complemented mutant ΔFoUPE10-com were inoculated on PDA medium containing 1 mol / L NaCl and 1 mol / L sorbitol, respectively, and cultured upside down in a 28° C. incubator for 5 days, and then the colony growth was observed.
[0113] (2) Oxidative stress analysis
[0114] The wild type Foc TR4, the knockout mutant ΔFoUPE10, and the complemented mutant ΔFoUPE10-com were inoculated on PDA medium containing 30 mmol / L H2O2, respectively, and cultured upside down in a 28°C incubator for 5 days, and then the growth of the colonies was observed.
[0115] (3) Cell wall integrity analysis
[0116] The wild type Foc TR4, the knockout mutant ΔFoUPE10, and the complemented mutant ΔFoUPE10-com were inoculated on PDA medium containing 0.05% SDS, 200 μg / mL CR, and 100 μg / mL CFW, respectively. After inverted culture in a 28° C. incubator for 5 days, the growth of the colonies was observed.
[0117] The results of colony morphology and colony growth inhibition rate determination of knockout mutant ΔFoUPE10 and complement mutant ΔFoUPE10-com under different stress conditions are shown in Figure 2. Figure 6 As shown; Figure 6 A in the figure shows the colony morphology of the knockout mutant ΔFoUPE10 and the complement mutant ΔFoUPE10-com under different stress conditions; Figure 6 Figure B shows the results of colony growth inhibition rate determination of knockout mutant ΔFoUPE10 and complement mutant ΔFoUPE10-com under different stress conditions. Figure 6The results show that: (1) In PDA medium containing NaCl and sorbitol, there was no significant difference between the ΔFoUPE10 mutant and the wild type, indicating that FoUPE10 has no effect on the ability of FocTR4 to resist high osmotic pressure. (2) In PDA medium containing SDS, CR, and CFW, there was no significant difference in the growth of the mutant ΔFoUPE10 compared with the wild type, indicating that knocking out FoUPE10 has no effect on the cell wall integrity of Foc4. (3) Under oxidative stress conditions, there was no significant difference in the growth of the mutant ΔFoUPE10 compared with the wild type.
[0118] In summary, the deletion of the FoUPE10 gene does not affect the colony growth rate of banana wilt pathogen under different stress conditions.
[0119] Example 3 Pathogenicity Analysis of Knockout and Complementary Mutants of FoUPE10
[0120] Brazilian bananas at the 4-leaf stage with consistent growth were seeded with conidia (1×10 5 The roots of banana seedlings were inoculated with a suspension of 1000 ng / mL (1000 ng / mL) of the same substance. A water-treated group served as a control. After 40 minutes of treatment, the seedlings were transplanted into sterile nutrient soil and cultured in a plant incubator at 25 ± 1°C under a 12-hour light / dark cycle. After 28 days, the disease on the leaves and bulbs of the banana seedlings was observed, and the disease index was calculated and statistically analyzed. Disease grading standards were based on the method of Huang Yonghui (2016) (Table 9).
[0121] Table 9 Banana wilt disease classification standard (Huang Yonghui, 2016)
[0122]
[0123] The disease index is calculated as follows: disease index = ∑ (disease level × number of plants with disease level) / (highest level × total number of plants surveyed) × 100
[0124] The knockout mutant ΔFoUPE10 and the complement mutant ΔFoUPE10-com were inoculated into Brazilian banana seedlings for 28 days. The disease conditions of the plants and bulbs were as follows: Figure 7 As shown. Figure 7It can be seen that the Brazilian banana seedlings in the clear water control group did not show leaf yellowing, and the bulbs did not change color; after inoculation with the wild type Foc TR4, obvious yellowing appeared on the leaves of the entire upper and lower parts of the Brazilian banana plant, and more than 50% of the bulb area showed browning; after inoculation with the knockout mutant ΔFoUPE10, only the lower leaves of the Brazilian banana plants showed yellowing, and the discolored area of the bulb did not exceed 20%; after inoculation with the complement mutant ΔFoUPE10-com, large areas of yellowing also appeared on the upper and lower leaves of the Brazilian banana plants, and more than 50% of the bulb area showed browning.
[0125] Further statistical analysis of the disease index was performed, and the results were as follows Figure 8 As shown. Figure 8 It can be seen that the disease index of the knockout mutant ΔFoUPE10-com is similar to that of the Foc TR4 wild type, indicating that the pathogenicity of ΔFoUPE10-com has returned to the wild type level; at the same time, the disease index of ΔFoUPE10 is significantly lower than that of the wild type and the complemented mutant, indicating that after knocking out the gene FoUPE10, the pathogenicity of banana wilt fungus is significantly reduced (p < 0.05).
[0126] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. Application of protein FoUPE10 in regulating the pathogenicity of banana wilt pathogen, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.
1.
2. Use of an agent for knocking down or knocking out a gene encoding protein FoUPE10 in reducing the pathogenicity of banana wilt pathogen, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.
1.
3. Use of an agent for knocking down or knocking out a gene encoding protein FoUPE10 in the preparation of a product that reduces the pathogenicity of banana wilt pathogen, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.
1.
4. The use according to claim 2 or 3, characterized in that: The banana wilt pathogen is banana wilt pathogen race 4.
5. Use of an agent for knocking down or knocking out a gene encoding protein FoUPE10 in preventing and / or treating banana wilt, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.
1.
6. Use of an agent for knocking down or knocking out a gene encoding protein FoUPE10 in the preparation of a product for preventing and / or treating banana wilt, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.
1.
7. The use according to claim 5 or 6, characterized in that: The prevention and / or treatment of banana wilt disease is achieved by reducing the pathogenicity of banana wilt pathogen.
8. The application according to claim 7, characterized in that: The banana wilt pathogen is banana wilt pathogen race 4.
9. The use according to any one of claims 2, 3, 5, and 6, characterized in that: The nucleotide sequence of the gene encoding the protein FoUPE10 is shown in SEQ ID NO.
2.
10. The use according to any one of claims 2, 3, 5, and 6, characterized in that: The reagent for knocking down the gene encoding protein FoUPE10 is siRNA, dsRNA, miRNA or antisense nucleic acid that uses the transcript of the gene encoding protein FoUPE10 as the target sequence and can inhibit its expression or transcription; the reagent for knocking out the gene encoding protein FoUPE10 is a gene knockout vector.