Application of VdSET gene in verticillium dahliae pathogenicity

Abstract

The invention is applicable to the technical field of functional genes, and provides application of a VdSET gene in verticillium dahliae pathogenicity, and particularly, the VdSET gene can be used for inhibiting verticillium dahliae from infecting plants, regulating and controlling growth, development and pathogenicity of verticillium dahliae and preventing and treating cotton verticillium wilt. The VdSET gene plays an important role in growth and development, sporulation, pathogenicity and the like of verticillium dahliae, belongs to methyltransferase, and can influence the pathogenicity of verticillium dahliae through methylation.

Description

Technical Field

[0001] The invention belongs to the technical field of functional genes, and in particular relates to an application of a VdSET gene in the pathogenicity of Verticillium dahliae. Background Art

[0002] Cotton is an important economic crop in my country. The emergence of cotton Verticillium wilt has led to a significant decline in cotton yield. The primary pathogen causing cotton Verticillium wilt in my country is Verticillium dahliae. The base of the conidial stalk of V. dahliae is slightly swollen and produces whorls of branches; the conidia are oval. When exposed to unfavorable growing conditions, the hyphae swell and septate, then darken due to the secretion of melanin, forming microsclerotia. Microsclerotia play a crucial role in the disease cycle. V. dahliae exists in the soil as dormant microsclerotia. Induced by plant root secretions, they germinate and produce hyphae, which colonize the cotton vascular bundles, causing the plant to gradually wilt, turn brown, and eventually die. As plant debris decomposes, these microsclerotia are released into the soil, where they can survive for years, triggering a new round of infection. The microsclerotia produced by V. dahliae are highly resistant to stress and can survive in the soil for a long time, whereas the hyphae and spores quickly lose their viability in the soil. my country's monotonous cotton planting structure and year-round continuous cropping make Verticillium wilt difficult to eradicate. Cotton's high economic returns make crop rotation with other crops unrealistic. Furthermore, there is a lack of Verticillium wilt-resistant cotton varieties and effective control agents on the market. In recent years, an increasing number of studies have reported on the biological functions of pathogenicity-related genes in Verticillium dahliae, but the regulatory networks between these genes remain underdeveloped. Therefore, in-depth research on the molecular pathogenicity mechanisms is urgently needed to identify key target genes in Verticillium dahliae and provide target genes for molecular breeding.

[0003] Recent studies have consistently revealed that SET domain proteins in fungi play important roles in regulating growth, development, and pathogenicity. Knockout of the BcDIM5 gene in Botrytis cinerea severely impairs hyphal growth, conidia and sclerotia production, and pathogenicity, and significantly reduces H3K9me3 methylation. A ΔFvDIM5 knockout mutant in Fusarium verticillioides exhibits significantly reduced conidia formation and virulence, suggesting that FvDim5 regulates H3K9me3. In Aspergillus fumigatus, ClrD, a homolog of the fission yeast Clr4, decreases colony growth, conidia production, and conidiophore development. ΔClrD is involved in both H3K9me and H3K9me3. The ΔFgSet1 knockout mutant of Fusarium graminearum (F. graminearum) weakens both mycelial growth rate and virulence. FgSet1 is involved in H3K4me, H3K4me2 and H3K4me3 methylation, and FgSet1 interacts with multiple proteins, such as FgBre2, FgSpp1 and FgSwd2. In addition, FgBre2 interacts with FgSdc1. Western blot shows that FgBre2 and FgSdc1 are associated with H3K4me. A ΔMoSET1 knockout mutant in the rice blast fungus (Magnaporthe oryzae) severely impairs conidia and appressorium formation and loses pathogenicity on wheat. MoSET1 regulates H3K4me2 and H3K4me3 methylation levels. The methyltransferase AflSet1 from Aspergillus flavus (A. flavus) is involved in hyphal morphology, AFB1 biosynthesis, and virulence. Western blot analysis revealed that AflSet1 is involved in H3K4me2, H3K4me3, and H3K9me2 methylation. Zhao et al. identified a pathogenicity-associated gene, CgSET5, containing a SET domain from the anthrax fungus (Colletotrichum gloeosporioides). CgSET5 affects hyphal growth, appressorium formation, conidia formation, and reduced pathogenicity. CgSet5 is a histone H4 methyltransferase that regulates H4K5me and H4K8me.

[0004] In addition, some fungi are involved in regulating methylation sites such as H3K4, H3K9, H3K36, H4K5, H4K8, H4K12, and H4K20. In Aspergillus niger, cclA is homologous to the Bre2 protein. The ΔcclA mutant exhibits reduced H3K4me2 and H3K4me3 methylation levels, as well as significantly reduced H3K9me2 and H3K9me3 methylation. NcDIM-5 in Neurospora crassa is a key methyltransferase for histone H3K9 methylation. Furthermore, N. crassa possesses two H3K36s: Set2 catalyzes H3K36me3 methylation, mediating transcriptional activation, while Ash1 catalyzes H3K36me2 methylation, primarily mediating transcriptional repression.

[0005] Because the pathogenicity of Verticillium dahliae is complex and the interaction between the pathogen and the host plant is unclear, identifying and functionally analyzing genes associated with pathogenicity or virulence of this fungus will help reveal the molecular pathogenesis of Verticillium dahliae. Summary of the Invention

[0006] The purpose of the embodiments of the present invention is to provide an application of the VdSET gene in the pathogenicity of Verticillium dahliae, aiming to solve the problems raised in the background technology.

[0007] In response to the above problems, the present invention provides a use of a VdSET gene in inhibiting Verticillium dahliae infection in plants. The nucleotide sequence of the VdSET gene is shown in SEQ ID NO.1 in the sequence listing.

[0008] Preferably, the plant comprises cotton.

[0009] Another object of the present invention is to provide an application of a VdSET gene in regulating the growth and development of Verticillium dahliae.

[0010] Preferably, the growth and development include growth rate and propagule yield; the propagules include microsclerotia and conidia.

[0011] Another object of the present invention is to provide an application of a VdSET gene in regulating the pathogenicity of Verticillium dahliae.

[0012] Preferably, the pathogenicity includes at least one of disease index, hyphae penetration ability and host colonization ability.

[0013] Preferably, the VdSET gene affects the pathogenicity of Verticillium dahliae through the methylation of the protein encoded by the VdSET gene.

[0014] Another object of the present invention is to provide an application of a VdSET gene in preventing and controlling cotton Verticillium wilt.

[0015] This study clarifies the role of the VdSET gene in the pathogenicity of Verticillium dahliae, providing a basis for the control of the fungus and the development of new fungicides. Specifically, analysis of VdSET gene expression at different times and in different tissues revealed that wild-type strains of VdSET exhibited the highest expression of the gene in mycelia cultured on PDA solid medium. Based on the principle of homologous recombination, a knockout vector targeting VdSET was constructed. Conidia of the wild-type strain were transformed via Agrobacterium-mediated genetic transformation (ATMT) to screen for VdSET knockout mutants. Simultaneously, a complementation vector targeting VdSET was constructed to screen for VdSET complementation mutants. Compared to the wild-type strain and the complementation mutant, the VdSET knockout mutant exhibited slower growth, decreased conidia production, and significantly increased pathogenicity to cotton. Its domain analysis revealed that it has two domains, namely the TRP domain and the SET domain. VdSET belongs to the SET-TPR family and is different from the SET1 and SET5 families, but they all belong to the SET protein family and have the same gene functions in some areas. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Figure 1 is the result of cloning and sequence analysis of VdSET gene; Figure 2 Construct a phylogenetic tree for the amino acid sequences of VdSET and other SET domain homologous proteins; Figure 3 This is the result of transcriptional expression of VdSET gene in different tissues of Verticillium dahliae; Figure 4 This is the result of transcriptional expression of VdSET gene at different times after cotton root induction; Figure 5 The results of transcriptional expression of VdSET gene under induction and non-induction are shown; Figure 6 Diagram showing the strategy for constructing the VdSET knockout vector, and the screening and detection results of ΔVdSET knockout mutants and ECVdSET complementation mutants; Figure 7 Colony morphology diagram of the Verticillium dahliae ΔVdSET mutant, the complemented mutant and the wild-type strain V592 constructed in the present invention; Figure 8 The microscopic observation results of microsclerotia formation of the Verticillium dahliae ΔVdSET mutant, the complemented mutant and the wild-type strain V592 constructed in the present invention are shown; Figure 9This is a graph showing the results of measuring the spore production of the Verticillium dahliae ΔVdSET mutant, the complemented mutant, and the wild-type strain V592 constructed in the present invention; Figure 10 The results of the pathogenicity test of the Verticillium dahliae ΔVdSET mutant, the complemented mutant, and the wild-type strain V592 on cotton are shown in the figure; A shows the morphology of the pathogenic plant; B shows the disease index result; Figure 11 This is a graph showing the results of measuring the penetration ability of mycelia of the Verticillium dahliae ΔVdSET mutant, the complemented mutant, and the wild-type strain V592 constructed in the present invention into cotton. DETAILED DESCRIPTION

[0017] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0018] In the early stage of the present invention, cotton roots were used to induce the expression of Verticillium dahliae related genes. Analysis revealed that the VdSET (VDAG_03603) gene was expressed in large quantities in the early stage of induction.

[0019] The embodiment of the present invention provides a T-DNA insertion method for screening pathogenic genes, and screened out a gene involved in the pathogenicity of Verticillium dahliae. Its sequence was analyzed and named as the VdSET gene, which is a Verticillium dahliae nucleosome binding protein gene.

[0020] Specifically, in an embodiment of the present invention, the nucleotide sequence of the VdSET gene is shown in SEQ ID NO: 1. In order to clarify whether the knockout of the VdSET gene affects the formation of conidia of Verticillium dahliae, the present invention constructed a VdSET gene-knockout mutant of Verticillium dahliae ΔVdSET based on the wild-type strain V592 as the base strain, and carried out gene complementation on the basis of ΔVdSET to obtain a complementary mutant ECVdVdSET. The method for constructing the VdSET gene-knockout mutant of Verticillium dahliae ΔVdSET is completed by the principle of homologous recombination. For details, please refer to the prior art for obtaining knockout, complementation and overexpression mutants (WANG S, XING H, HUA C, GUO HS, ZHANG J. An improved single-step cloning strategy simplifies the Agrobacterium tumefaciens- mediated transformation (ATMT)-based gene-disruption method for Verticillium dahliae. Phytopathology, 2016, 106(6): 645-652.).

[0021] A series of experiments using ΔVdSET, the complementary mutant ECVdSET, and the wild-type strain V592 revealed that knockout of the VdSET gene reduced colony growth and conidia production in Verticillium dahliae, without affecting microsclerotia formation or hyphal penetration. Pathogenicity analysis also revealed a significant increase in the disease index and aggravated symptoms in the ΔVdSET knockout, indicating that the ΔVdSET gene is involved in the growth and pathogenicity of Verticillium dahliae.

[0022] The methylation produced by the mutant and the methylation occurring in the wild-type V592 were detected by mass spectrometry, and a comparative analysis was conducted. When the VdSET gene was knocked out, the methylation level in Verticillium dahliae changed to determine whether VdSET had a methylation effect. It was found that the methylation produced by the VdSET knockout mutant strain was significantly different from that produced by the wild-type strain V592, indicating that the VdSET protein can undergo methylation.

[0023] The present invention knocks out the VdSET gene and complements its function, and studies the function of this gene in the growth and development of Verticillium dahliae and its interaction with plants. The VdSET gene plays an important role in the growth and development, spore production and pathogenicity of Verticillium dahliae, and is itself a methyltransferase, which affects the pathogenicity of Verticillium dahliae through methylation.

[0024] The following describes in detail the application of the VdSET gene provided by the present invention in the growth and development, pathogenicity and interaction with plants of Verticillium dahliae in conjunction with specific examples, but they should not be construed as limiting the scope of protection of the present invention.

[0025] Example 1: Cloning and sequence analysis of the Verticillium dahliae VdSET gene: like Figure 1 The VdSET gene DNA sequence (SEQ ID NO:1) was downloaded from NCBI (https: / / www.ncbi.nlm.nih.gov / ). Snapgene was used to design full-length VdSET gene-specific primers (VdSETfull-F and VdSETfull-R). A 20 µL reaction system was prepared on ice using Dongsheng Bio's PCR Mix: 10 µL 2× PCR Mix, 0.5 µL each of VdSETfull-F and VdSETfull-R, 1 µL DNA, and 8 µL ddH2O. The PCR reaction protocol was set up according to the manufacturer's instructions for sequencing analysis.

[0026] (1) Purification of PCR products and gel recovery products: Use the gel recovery kit (OMEGA) and perform purification according to the instructions.

[0027] (2) TA cloning: pMD19-T 0.5 μL, PCR production 4.5 μL, Solution I 5.0 μL, and finally place the prepared 10 μL system in a 16°C low-temperature water bath for 4 hours.

[0028] (3) Heat shock transformation: ① Add the ligation product to the thawed DH5α competent cells, stir well, and place on ice for 30 minutes. ② Place in a 42℃ water bath for 60 seconds, then place on ice for 5 minutes. ③ Add 500μL of antibody-free LB on a clean bench and shake at 200 rpm at 37℃ for 1 hour. ④ Then use a pipette to transfer the bacterial solution onto MacConkey solid medium (containing Amp), spread the bacterial solution evenly with a spreader, let it dry, seal the plate, and culture in a 37℃ incubator overnight.

[0029] (4) Screening of positive clones: Pick a single plaque for colony PCR verification and use universal primers M13-F / R for detection.

[0030] (5) Extraction of recombinant plasmid: Place the single plaque selected from the positive clone in 2 mL LB liquid culture medium (containing Amp), shake at 200 rpm at 37°C for 12-16 h, and finally extract the plasmid according to the instructions of the plasmid extraction kit.

[0031] The phylogenetic tree of amino acid sequences of VdSET and other SET domain homologous proteins was constructed. Figure 2 shown.

[0032] Example 2: Determination of VdSET gene expression in different tissues of V592 Wild-type V592 bacterial plugs were cultured in 100 mL of Czapek-Dox liquid medium for 3 days and then filtered through four layers of gauze to collect spores. Meanwhile, wild-type V592 tissue cultured on PDA and BMM solid media for 2 and 20 days, respectively, was gently scraped using a sterilized glass slide to obtain hyphae and microsclerotia. The spores, hyphae, and microsclerotia were snap-frozen in liquid nitrogen, followed by RNA extraction and cDNA synthesis. qPCR reactions were prepared using SYBR® Select Master Mix, using the internal reference gene β-tubulin (DQ266153). Each reaction was repeated in triplicate. Data were processed and analyzed using the 2-ΔΔCt method using SPSS 26.0 software.

[0033] The results are as follows Figure 3 The results showed that the expression level of the VdSET gene was highest in hyphae and lower in spores and microsclerotia, indicating that VdSET may play a certain role in the spores, hyphae and microsclerotia of Verticillium dahliae.

[0034] Example: VdSET gene expression at different times induced by cotton roots Select several full-grained Junmian No. 1 seeds, remove the seed coat, treat them with 0.1% HgCl2 for 3 min on a clean bench, wash them three times with sterile water, and place them on sterilized filter paper to dry the surface moisture; use an alcohol lamp to burn tweezers and wait for the temperature to drop before picking up the seeds and placing them in a tissue culture bottle containing 50 mL MS solid culture medium, about 4-5 seeds per bottle, and place them in a 28°C incubator in the dark for 7 days, during which time the seedlings are supported once.

[0035] On a clean bench, the wild-type V592 bacterial suspension that had been shaken at 26°C for 3 days was filtered through four layers of gauze into a 50 mL centrifuge tube and centrifuged at 8000 r / min at 4°C for 10 min. The bacteria were resuspended in Czapek-Dox liquid medium and evenly distributed into conical flasks containing 100 mL Czapek-Dox liquid medium. Cotton roots cultured in MS solid medium were inoculated into each conical flask and cultured at 26°C and 200 r / min for 8 h, 12 h, 24 h, 36 h, 48 h, and 60 h, respectively. V592 bacterial suspension without cotton root induction at different times was used as a control. The induced bacterial suspension was collected and quickly frozen in liquid nitrogen for RNA extraction and cDNA synthesis. The SYBR Select Master The qPCR reaction system was prepared with PCR amplification with PCR product mix. The internal reference gene was β-tubulin (DQ266153). Each reaction was repeated three times. The data were processed and analyzed for significance using the 2-ΔΔCt method and SPSS 26.0 software.

[0036] The results are as follows Figure 4 As shown in the results, the VdSET gene was up-regulated with the increase of induction time, with the highest expression level at 12 h of induction. This indicates that the VdSET gene plays an important role in the early stage of Verticillium dahliae infection of the host.

[0037] Example 4: Induced and non-induced transcriptional expression of the Verticillium dahliae VdSET gene 0.5 g of cotton roots were added to 100 mL of Czapek-Dox liquid medium and inoculated with the wild-type V592 bacterial suspension. As a control treatment, no cotton roots were added. The culture was shaken at 200 rpm at 26°C for 12 h, and the bacterial suspension was collected and quick-frozen in liquid nitrogen. RNA was extracted and cDNA was synthesized. The qPCR reaction system was prepared using SYBR Select Master Mix. The internal reference gene was β-tubulin (DQ266153). Each reaction was replicated three times. Data were processed and analyzed using the 2-ΔΔCt method and SPSS 26.0 software.

[0038] The results are as follows Figure 5 The results showed that the expression level of VdSET gene increased significantly under cotton root induction, indicating that VdSET participates in the interaction between Verticillium dahliae and its host.

[0039] Example 5: Figure 6 As shown, this embodiment provides a method for constructing a Verticillium dahliae mutant ΔVdSET with a knockout VdSET gene, as follows: Primers were designed based on the upstream and downstream homology arms of the VdSET gene (nucleotide sequence shown in SEQ ID NO: 1) to construct a knockout vector. Using the wild-type strain V592 as the initial strain, mutants were constructed. VdSET gene-knockout mutants (ΔVdSET-1 and ΔVdSET-2) were obtained.

[0040] The specific construction process is as follows: S1. Amplification of the homology arms of the target gene: Two pairs of primers were designed with the upstream and downstream homology arms of the VdSET gene. The genomic DNA of the deciduous strain V592 was used as a template, and the upstream and downstream homology arms of the VdSET gene were amplified using I-5 2× High-Fidelity Master Mix high-fidelity DNA polymerase. Primers VdSET-sf and VdSET-sr amplified the upstream homology arm of the VdSET gene, and primers VdSET-xf and VdSET-xr amplified the downstream homology arm of the VdSET gene.

[0041] PCR reaction system: Add 25 μL of I-5 2× High-Fidelity Master Mix, 1 μL each of VdSET-s(x)-f / VdSET-s(x)-r, and 1 μL of DNA to a 0.2 mL PCR tube and make up to 50 μL with ddH2O. The PCR program was as follows: preheat at 98°C for 1 minute, melt at 98°C for 15 seconds, anneal at 60°C for 15 seconds, extend at 72°C for 15 seconds, hold at 72°C for 5 minutes, and terminate at 20°C for 2 minutes. Repeat 30 cycles from the melt to the extension phase. 3-5 μL of PCR product was analyzed by gel electrophoresis on a 1% agarose gel supplemented with Goldenview, visualized under UV light, and photographed. The remaining PCR product with the correct band was purified using the OMEGA Biotech Gel Extraction Kit and the concentration was determined.

[0042] Among them, the upstream and downstream homology arm primers are as follows: The nucleotide sequence of VdSET-sf is shown in SEQ ID NO: 2, specifically: CTTGCTGAGGTCTTAATTAA GTGGGGTATGAGGTAACCCATCAG; The nucleotide sequence of VdSET-sr is shown in SEQ ID NO: 3, specifically: AGTGCTGAGGCATTAATTAAGTTGCTGGCGTAGGCACGTG; The nucleotide sequence of VdSET-xf is shown in SEQ ID NO: 4, specifically: CCCGCTGAGGACTTAATTAA GACTTCGGAGCATAACGTGGG; The nucleotide sequence of VdSET-xr is shown in SEQ ID NO: 5, specifically: CTCGCTGAGGGTTAATTAA ATCTGCGGACCATGAACATCAAC.

[0043] (2) The knockout vector used in the present invention is pGKO-HPT. The vector plasmid was linearized with PacⅠ. The system was as follows: 5 μL of PacⅠ, 35 μL of vector plasmid, 5 μL of 1×Cutsmart, ddH2O was added to 50 μL, and the enzyme digestion was carried out in a 37°C water bath for 10-12 hours. The next day, 3-5 μL of PCR product was taken for gel electrophoresis detection on a 1% agarose gel electrophoresis added with Goldenview. The enzyme digestion band was observed under a UV gel imager. The target fragment was carefully cut out and the linearized vector fragment was purified using the GelExtraction Kit of OMEGA Biotechnology Company. After gel electrophoresis verification, the purified vector fragment was aliquoted and its concentration was determined. It was stored in a -20°C refrigerator for use to avoid repeated freezing and thawing.

[0044] (3) In-fusion cloning: The upstream and downstream homology arms of the target gene obtained after amplification and purification and the vector fragment obtained after linearization and purification were ligated with In-fusion enzyme. The system is as follows: 3 μL of the purified products of the upstream and downstream homology arms of the target gene, 1 μL of 5×CE Multis Buffer and Exnase Multis, and 2 μL of the linearized vector. The above solution was placed in a 37°C water bath for 30 minutes, placed on ice for subsequent experiments or temporarily stored in a -20°C refrigerator, and heat-shocked to transform E. coli and extract the recombinant plasmid.

[0045] (4) Agrobacterium-mediated genetic transformation Electroporation of Agrobacterium: Take out the recombinant plasmid and Agrobacterium from -20℃ refrigerator and -80℃ refrigerator respectively. Thaw the competent cells of Agrobacterium quickly on ice; take out 1 μL of recombinant plasmid and add it to the competent cells of Agrobacterium, and place it on ice for 10 minutes; wipe off the water on the wall of the sterilized and pre-cooled electroporation cup, add the mixed solution and place it in the electroporation instrument for instantaneous electroporation; add 500 μL of LB liquid culture medium without any antibiotics, pipette to mix and absorb the mixed solution in the electroporation cup, place it in a 1.5mL centrifuge tube, and shake it at 200rpm in a 28℃ shaker for 45 minutes; centrifuge briefly, discard 500 μL of supernatant, mix the remaining bacterial solution thoroughly with a pipette, and evenly spread the bacterial solution on the LB solid culture medium containing Kan and Rif antibiotics in the clean bench, and place it in a 28℃ constant temperature incubator for dark culture for 2~3 days. Screen the positive transformants by PCR, and shake the correct PCR colonies to obtain Agrobacterium bacterial solution. Take 100 μL of Agrobacterium bacterial solution to 10mL In IMAS (containing Kan) liquid medium, shake at 200 rpm in a 28°C shaker until the OD600 value is about 0.5. Thaw the collected conidia of Verticillium dahliae on ice in advance, and mix the conidia of Verticillium dahliae and Agrobacterium in a 1:1 ratio. Spread 200 μL of the mixture evenly on the sterilized IMAS solid medium, repeat 3 times, and use the plate coated with only conidia of Verticillium dahliae as the positive control, and the plate coated with only the bacterial solution of the recombinant plasmid of Agrobacterium as the negative control. After 48 hours, the filter paper was removed from the IMAS solid medium and placed on a PDA plate (containing HygB, Cef, Car, and F2dU). The plate was incubated in the dark at 26°C for 5-7 days. Once transformants emerged, a single fungal colony was picked on a clean bench and streaked onto PDA (containing Cef and HygB). The plate was incubated in the dark at 26°C for approximately 10 days. During this time, the fungal growth on the plate was continuously monitored. Only homologous recombination knockout transformants would grow on this resistant plate, while false-positive transformants would not. Once positive transformants emerged, single spores were isolated and further assayed. Ultimately, two knockout transformants were obtained.

[0046] Example 6: This example provides a method for constructing a VdSET gene complementation mutant ECVdSET of Verticillium dahliae, as follows: Using the constructed Verticillium dahliae mutant ΔVdSET as the starting strain, the VdVdSET gene complementation mutant (ECVdSET) was obtained. The vector p1300-Neo-oLiC-Cas9-TtrpC was linearized with Xba I and Bam HI. A 50 µL Xba I and Bam HI double digestion system was prepared: 20 µL of p1300-Neo-oLiC-Cas9-TtrpC, 1 µL of Xba I, 1 µL of Bam HI, 2.5 µL of 1×M buffer, and 25.5 µL of ddH2O. Digestion was performed overnight at 37°C, and the desired band was recovered from the gel the next day. The complementary recombinant plasmid was constructed using the ClonExpress®II One Step Cloning Kit. p1300-Neo-oLiC-Cas9-TtrpC and the VdSET gene were ligated using Exnase II. The single-fragment ligation system for p1300-NeO-LiC-Cas9-TtrpC was as follows: 2 μL of 5×CE II buffer, 200 ng of p1300-Neo-oLiC-Cas9-TtrpC, 80 ng of the target gene fragment, 1 μL of Exnase II, and up to 10 μL of ddH2O. The ligation was carried out at 37°C for 30 min.

[0047] The remaining methods are the same as those for knockout. The difference from obtaining positive transformants of knockout mutants is that the knockout mutants are obtained by mixing 1.0×106 conidia / mL of wild-type Verticillium dahliae V592 conidia and Agrobacterium containing the knockout vector in equal proportions, while the complementation mutant positive transformants are obtained by mixing 1.0×106 conidia / mL of VdSET knockout mutant conidia. 6 conidia / mL is mixed with Agrobacterium containing the complementary vector in equal proportions; secondly, the first screening culture medium of the positive transformants of different complementary mutants of the resistance screening culture medium is PDA+HygB+Cef+Tim+G418, and the second screening culture medium is PDA+Cef+G418.

[0048] Example 7: Determination of Colony Growth Rate: The VdSET gene-knockout mutant of Verticillium dahliae prepared in Example 5, the VdSET gene-complemented mutant prepared in Example 6, and wild-type strain V592 were cultured. Mycelium was inoculated in the center of a PDA culture medium and incubated in the dark at 22°C. Colony diameters of all strains were measured on days 5 and 9 after inoculation, and the average colony growth rate was calculated according to the following formula.

[0049] The average growth rate of the colony = (colony growth speed = (average colony growth diameter on the 9th day - average colony growth diameter on the 5th day) / 4).

[0050] Three replicates were set for each strain, and the colony morphology was recorded by taking photos on the 15th day.

[0051] Morphological observation of hyphae: Different strains of Verticillium dahliae were cultured by streaking on PDA plates, and then a sterilized cover slip was inserted obliquely into the streaked area. The plates were cultured in the dark at 22°C for 3 days, and the cover slip was removed to observe the hyphae growth under a microscope.

[0052] The results are as follows Figure 7 As shown in the data, the growth rates of the VdSET gene knockout mutants △VdSET-1 and △VdSET-2 were significantly slower than that of the wild-type strain V592, both of which were 0.63 times the average growth rate of the wild-type strain V592. There was no significant difference in the growth rates of the complementary mutants ECVdSET-1 and ECVdSET-2 and the wild-type strain V592, indicating that VdSET affects the growth rate of Verticillium dahliae.

[0053] Example 8: Determination of microsclerotia quantity A VdSET gene-knockout mutant of Verticillium dahliae, a VdSET gene-complemented mutant, and wild-type strain V592 were cultured to obtain bacterial cakes. Approximately 10 bacterial cakes of each strain were punched out using a microporator and inoculated into Czapek liquid medium (containing kan). The culture was shaken at 200 rpm at 26°C for 3–5 days. Conidia were collected by filtration and the conidia concentration was adjusted to 1.0 × 10 6 100 μL was evenly spread on a MM plate covered with cellophane (NaNO3 2 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, KCl 0.5 g, citric acid 10 mg, ZnSO4·7H2O 10 mg, FeSO4·7H2O 10 mg, NH4Fe(SO4)2·12H2O 2.6 mg, CuSO4·7H2O 0.5 mg, NnSO4·H2O 0.1 mg, H3BO3 0.1 mg, Na2MoO4·2H2O 0.1 mg, glucose 2 g, agar 1.5 g, distilled water to 1 L, autoclaved at 113°C for 20 min), cultured in the dark at 22°C for 15 d, photographed, scraped from the cellophane, weighed, and recorded in wet weight. The microsclerotia were then placed at room temperature for 48 h to dry, weigh on a balance, and record its dry weight data.

[0054] The results are as follows Figure 8As shown, the results showed that the knockout mutant VdSET could produce microsclerotia, indicating that VdSET is not a key gene for microsclerotia formation in Verticillium dahliae.

[0055] Example 9: In order to clarify whether VdSET gene knockout affects the conidia formation of Verticillium dahliae, the specific determination method is as follows: The concentration was 1.0×10 6 CFU / mL of knockout mutant (strain constructed in Example 5), complementation mutant (strain constructed in Example 6), and V592 were inoculated into Czapek-Dox liquid medium, shaken at 26°C and 200 rpm for 5 days, and spores were isolated. 6 Inoculate 100 μL of a spore suspension containing 100 CFU / mL of spores in Czapek medium (containing Kan). Three biological replicates were set up for each strain. Cultures were shaken at 200 rpm at 26°C in a shaker. Every 24 hours, 1 mL of the suspension was aspirated. Spore concentrations were measured and recorded using a hemocytometer for 7 consecutive days.

[0056] The results are as follows Figure 9 As shown in the data, starting from the 5th day, the spore production of the VdSET knockout mutant strain was significantly lower than that of the wild-type strain V592. On the 7th day, the spore production of the VdSET gene knockout mutant was 0.68 and 0.71 times that of the wild-type strain V592, and the spore production of the complemented mutant had no significant difference from that of the wild-type strain, indicating that the VdSET gene is involved in regulating the spore production ability of Verticillium dahliae.

[0057] Example 10: To clarify the effect of VdSET gene knockout on the pathogenicity of Verticillium dahliae, the pathogenicity of the VdSET gene knockout mutant to cotton was determined using the wild-type strain V592 and the complemented mutant as controls. The pathogenicity determination method is as follows: The knockout mutants, complemented mutants, and V592 constructed above were inoculated into Czapek-Dox liquid medium at 26°C and shaken at 200 rpm for 5 days. After the fifth true leaf of the cotton seedlings grew, 200 mL of 1.0 × 10 7 CFU / mL of bacterial solution, with three replicates of each strain in hydroponic culture boxes (a total of 36 cotton seedlings). Observe daily after inoculation, counting disease indices every three days from the onset of disease, and generally recording until one month after disease onset. Disease grading is as follows: Grade 0: No disease; Grade 1: Disease on 1-2 cotyledons; Grade 2: Disease on 1 true leaf; Grade 3: Disease on 2 true leaves; Grade 4: Disease on 3 or more true leaves. The disease index is calculated using the following formula.

[0058] Disease index = [Σnumber of diseased plants at each level × level / (total number of plants × highest disease level)] × 100; The disease index is the average of three repeated biological experiments.

[0059] The results are as follows Figure 10 As shown, the VdSET knockout mutant exhibited enhanced pathogenicity compared to the wild-type strain V592. On day 26 of inoculation, the disease index of the wild-type strain V592 was 63.51, while the VdSET knockout mutant had a higher disease index, reaching 97.82, indicating that the VdSET gene is involved in the pathogenicity of Verticillium dahliae.

[0060] Example 11: To analyze whether the reduction in pathogenicity of Verticillium dahliae caused by VdSET gene knockout is related to its ability to penetrate the host, a cellophane penetration test was performed on each knockout mutant strain using V592 as a control. The specific method is as follows: Place sterilized cellophane paper roughly the same size as the culture dish on top of the prepared MM minimal medium. Use a toothpick to pick up hyphae and inoculate them into the center of the cellophane paper. Culture the strains for 3 days, then remove the cellophane paper and allow them to grow for an additional 7 days. Observe for colonies on the culture dish. Set up three replicates for each strain.

[0061] The results are as follows Figure 11 As shown, the mutant strain of the VdSET gene was able to penetrate the cellophane and grow normally on the culture medium, indicating that knocking out the VdSET gene had no effect on the penetration ability of Verticillium dahliae.

[0062] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. The use of the VdSET gene in inhibiting Verticillium dahliae infection in plants, characterized in that: The nucleotide sequence of the VdSET gene is shown in the sequence listing SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The plants include cotton.

3. The application of the VdSET gene in regulating the growth and development of Verticillium dahliae is characterized in that: The nucleotide sequence of the VdSET gene is shown in the sequence listing SEQ ID NO.

1.

4. The use according to claim 3, characterized in that The growth and development include growth rate and propagule yield; the propagule includes microsclerotia and conidia.

5. Application of the VdSET gene in regulating the pathogenicity of Verticillium dahliae, characterized in that: The nucleotide sequence of the VdSET gene is shown in the sequence listing SEQ ID NO.

1.

6. The use according to claim 5, characterized in that The pathogenicity includes at least one of disease index, hyphae penetration ability and host colonization ability.

7. The use according to claim 5, characterized in that The VdSET gene affects the pathogenicity of Verticillium dahliae through the methylation of the protein it encodes.

8. Application of VdSET gene in preventing and treating cotton Verticillium wilt, characterized in that: The nucleotide sequence of the VdSET gene is shown in the sequence listing SEQ ID NO.1.

Images