Method for improving arsenic stress tolerance of rice plants

By knocking out or reducing the expression of OsSPL3 gene in rice, CRISPR-Cas9 technology is used to regulate the expression of related proteins and enzymes, the problem of arsenic absorption and transport in rice is solved, the tolerance and antioxidant ability of rice to arsenic is improved, the accumulation of arsenic is reduced, and the adaptability to arsenic stress is enhanced.

CN120519494APending Publication Date: 2025-08-22CHINA WEST NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510547850.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-28
Publication Date
2025-08-22

AI Technical Summary

Technical Problem

The absorption, transport and detoxification mechanisms of plants in the prior art are not comprehensive enough, which limits the development of low-arsenic rice and the progress of effective plant repair. More arsenic-sensitive genes need to be identified to expand the gene toolkit for arsenic relief.

Method used

By knocking out or reducing the expression of the OsSPL3 gene in rice, CRISPR-Cas9 gene editing technology is used to target exon 1 of the OsSPL3 gene, especially 237-256bp downstream of the initiation codon (ATG), to regulate the expression levels of transporters, stress response transcription regulatory proteins, lipid peroxidation products, catalase and superoxide dismutase, to improve the tolerance of rice to arsenic.

Benefits of technology

It reduces the accumulation and transport rate of arsenic in rice, enhances the tolerance of rice to arsenic stress, reduces growth inhibition, improves antioxidant ability, improves the physiological and biochemical process of plants, and enhances the tolerance to arsenic-induced oxidative stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519494A_ABST
    Figure CN120519494A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to a method for improving arsenic stress tolerance of rice. According to the method, the OsSPL3 in the rice is not expressed or the expression level of the OsSPL3 is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to a method for improving rice tolerance to arsenic stress. Background Art

[0002] Arsenic is a metalloid widely distributed in the environment, primarily from various industrial and mining activities. Due to its high toxicity to biological organisms, long-term exposure to arsenic through contaminated drinking water or the food chain can cause serious health problems in animals and humans.

[0003] There are currently two main strategies for mitigating arsenic toxicity in plants: one is to reduce arsenic accumulation in rice by utilizing the adsorption properties of soil modifiers or nanomaterials; the other is to regulate arsenic-related genes in plants through gene editing technology. Some relevant literature has been published in the prior art, for example, non-patent literature (Mosa, KA, K. Kumar, S. Chhikara, J. Mcdermott, Z. Liu, et al. 2012. Members of rice plasma membrane intrinsic proteins subfamily are involved in arsenite permeability and tolerance in plants. Transgenic Res 21(6):1265–1277. doi:10.1007 / s11248-012-9600-8.) discloses that overexpression of the rice gene PIP2;4 in transgenic Arabidopsis plants significantly improved arsenic tolerance compared to wild-type plants. For example, the non-patent literature (Ye, Y., P. Li, T. Xu, L. Zeng, D. Cheng, et al. 2017. OsPT4 Contributes to Arsenate Uptake and Transport in Rice. Front. Plant Sci. 8: 2197. doi: 10.3389 / fpls.2017.02197.) disclosed the use of gene editing technology to knock out the OsPT4 gene in rice. Compared with wild-type plants, the arsenic level in the roots of OsPT4 mutant plants was reduced by 17-30%.

[0004] Currently, our understanding of the mechanisms by which plants absorb, transport, and detoxify arsenic is incomplete, which has limited the development of low-arsenic rice and progress in effective plant remediation. It is important to identify more arsenic-sensitive genes to expand the genetic toolkit for arsenic mitigation. Therefore, the present invention is specifically proposed. Summary of the Invention

[0005] A first aspect of the present invention provides a method for improving the tolerance of rice to arsenic stress, wherein the method comprises not expressing OsSPL3 in rice or reducing the expression level thereof.

[0006] Preferably, the non-expression or reduced expression level of OsSPL3 includes knocking out or knocking down the OsSPL3 gene.

[0007] Preferably, the knockout method includes the Cre-loxP system, the FLP-FRT system or the CRISPR-Cas9 gene editing technology.

[0008] Preferably, the knockdown method comprises RNA interference, such as shRNA or siRNA.

[0009] Preferably, the knockout or knockdown targets exon 1 of the OsSPL3 gene, and further preferably targets 237-256 bp downstream of the start codon (ATG).

[0010] Preferably, the method comprises introducing an agent for knocking out or knocking down OsSPL3 into seeds or callus tissue.

[0011] Preferably, the OsSPL3 knockout or knockdown agent targets exon 1 of the OsSPL3 gene, and more preferably targets 237-256 bp downstream of the start codon (ATG).

[0012] Preferably, the reagent can be sgRNA, shRNA, siRNA, Cas9, vector, etc.

[0013] Preferably, the method comprises using an sgRNA targeting exon 1 of the OsSPL3 gene, preferably an sgRNA targeting 237-256 bp downstream of the start codon (ATG), and further preferably, the target sequence of the sgRNA comprises SEQ ID NO: 2.

[0014] In a specific embodiment of the present invention, sgRNA and Cas9 targeting exon 1 of the OsSPL3 gene are introduced into seeds or callus tissues.

[0015] Preferably, the nucleotide at position 255 of the OsSPL3 gene is deleted, and / or adenine (A) is inserted between positions 255 and 256 of the OsSPL3 gene.

[0016] In a specific embodiment of the present invention, the method comprises: not expressing OsSPL3 or reducing the expression level in rice seeds, and then cultivating the seeds to obtain rice tolerant to arsenic stress.

[0017] Preferably, OsSPL3 is not expressed or its expression level is reduced in the roots, stems and / or leaves of the rice.

[0018] The method for cultivating the seeds includes seed germination and transplanting.

[0019] Preferably, the method for cultivating the seeds further includes supplementing water, fertilizer, etc.

[0020] Preferably, the arsenic stress includes arsenic-induced oxidative stress.

[0021] Preferably, the arsenic stress tolerance includes:

[0022] A) reducing arsenic-induced growth inhibition, preferably, the growth inhibition comprises inhibiting plant height, plant weight (such as fresh weight and / or dry weight), root length or stem length;

[0023] B) reducing the accumulation of arsenic in rice, preferably reducing the accumulation of arsenic in rice roots and / or stems; and / or,

[0024] C) increasing the transport rate of arsenic in rice, preferably increasing the transport rate of arsenic in rice roots and / or stems.

[0025] Preferably, the accumulation of arsenic in rice roots and / or stems is reduced by sequestering arsenic in vacuoles.

[0026] Preferably, the absence or reduced expression of OsSPL3 improves rice tolerance to arsenic stress by regulating one or more of a transporter (e.g., expression level, concentration, or content), a stress-responsive transcriptional regulatory protein (e.g., expression level, concentration, or content), a lipid peroxidation product (e.g., concentration, or content), a catalase (e.g., expression level, concentration, or content), a peroxidase (e.g., expression level, concentration, or content), or a superoxide dismutase (e.g., expression level, concentration, or content).

[0027] Preferably, the regulation is up-regulation or down-regulation.

[0028] Preferably, OsSPL3 is not expressed or its expression level is reduced, thereby improving rice tolerance to arsenic stress by upregulating one or more of transporters (such as expression levels, concentrations or contents), downregulating lipid peroxidation products (such as concentrations or contents), upregulating peroxidases (such as expression levels, concentrations or contents), upregulating stress-responsive transcriptional regulatory proteins (such as expression levels, concentrations or contents), upregulating catalases (such as expression levels, concentrations or contents), or upregulating superoxide dismutases (such as expression levels, concentrations or contents).

[0029] Preferably, the transporter comprises an ATP-binding cassette transporter, such as OsABCC1.

[0030] Preferably, the lipid peroxidation product includes malondialdehyde (MDA).

[0031] Preferably, the superoxide dismutase comprises copper-zinc superoxide dismutase, such as OsCuZnSOD.

[0032] Preferably, the stress-responsive transcriptional regulatory protein comprises a NAC transcription factor, such as OsNAC45.

[0033] Preferably, the catalase comprises OsCATA.

[0034] In a second aspect, the present invention provides an agent targeting the OsSPL3 gene in rice, wherein the agent targets exon 1 of the OsSPL3 gene.

[0035] Preferably, the reagent targets 237-256 bp downstream of the start codon (ATG).

[0036] Preferably, the reagent can be sgRNA, shRNA, siRNA, Cas9, vector, etc.

[0037] In a specific embodiment of the present invention, the reagent includes sgRNA and Cas9.

[0038] Preferably, the target sequence of the sgRNA includes SEQ ID NO: 2.

[0039] A third aspect of the present invention provides a method for preparing rice seeds tolerant to arsenic stress, the method comprising: not expressing OsSPL3 or reducing the expression level of OsSPL3 in the rice seeds.

[0040] Preferably, the preparation method comprises introducing the reagent described in the second aspect into rice seeds.

[0041] A fourth aspect of the present invention provides rice seeds tolerant to arsenic stress obtained by the above preparation method.

[0042] A fifth aspect of the present invention provides a method for constructing rice tolerant to arsenic stress, wherein the method comprises not expressing OsSPL3 in rice or reducing the expression level thereof.

[0043] Preferably, the construction method comprises not expressing OsSPL3 or reducing the expression level in rice seeds, and then cultivating the seeds to obtain rice tolerant to arsenic stress.

[0044] Preferably, the construction method comprises not expressing OsSPL3 or reducing the expression level in rice callus, and then performing plant regeneration.

[0045] Preferably, the construction method comprises introducing the reagent described in the second aspect into rice seeds or callus tissue.

[0046] In a sixth aspect, the present invention provides an arsenic stress-tolerant rice obtained by the above-mentioned construction method.

[0047] A seventh aspect of the present invention provides a food, comprising the above-mentioned rice or the above-mentioned rice seeds.

[0048] In an eighth aspect, the present invention provides the use of rice seeds or calli in which OsSPL3 is not expressed or whose expression level is reduced in preparing rice tolerant to arsenic stress, preferably the use of rice seeds or calli in which OsSPL3 is not expressed or whose expression level is reduced in preparing rice tolerant to arsenic stress.

[0049] Preferably, the rice seeds are the rice seeds described in the fourth aspect.

[0050] A ninth aspect of the present invention provides a use of an OsSPL3 gene mutation for preparing arsenic-tolerant rice or improving arsenic-tolerant rice, wherein the OsSPL3 gene mutation results in the absence or reduced expression of OsSPL3 in the rice. Preferably, the OsSPL3 gene mutation results in the absence or reduced expression of OsSPL3 in rice seeds or callus.

[0051] Preferably, the mutation comprises a mutation in exon 1 of the OsSPL3 gene. Preferably, the mutation comprises a mutation 237-256 bp downstream of the start codon (ATG) of the OsSPL3 gene.

[0052] Preferably, the mutation includes a mutation caused by introducing the reagent described in the second aspect.

[0053] Preferably, the mutation includes insertion and / or deletion.

[0054] In a specific embodiment of the present invention, the OsSPL3 gene mutation includes a deletion of nucleotide 255 of the OsSPL3 gene, and / or an insertion of adenine (A) between positions 255 and 256 of the OsSPL3 gene.

[0055] A tenth aspect of the present invention provides a use of knocking out or knocking down the OsSPL3 gene in preparing rice tolerant to arsenic stress or improving rice tolerance to arsenic stress.

[0056] The eleventh aspect of the present invention provides a use of the reagent described in the second aspect in preparing rice tolerant to arsenic stress or improving rice tolerance to arsenic stress.

[0057] The "expression" described in the present invention includes the expression of mRNA and / or the expression of protein, that is, the expression at the transcriptional level and / or the expression at the translational level. The "reduced expression level" includes that the reduction in expression level compared to the expression level before transformation or the wild-type expression level is statistically significant, such as p<0.05, p<0.01, p<0.01, p<0.001, p<0.0001, etc. Preferably, it is reduced to 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 6, 1 / 7, 1 / 8, 1 / 9 or 1 / 10 of the expression level before transformation or the wild-type expression level. The "non-expression" includes not expressing complete mRNA and / or protein, or not having the complete function of mRNA and / or protein after expression, preferably not having the function of mRNA and / or protein.

[0058] The "arsenic stress" mentioned in the present invention refers to the situation where, when plants or their seeds or seedlings grow in an arsenic-contaminated environment, arsenic toxicity will disrupt the normal functions and metabolism of the plants, leading to decreased yield and morphological abnormalities (e.g., inhibition of plant height, root and stem growth, etc.). It will also cause disorders in the physiological and biochemical processes of the plants, such as enhanced lipid peroxidation in plant cells, increased content of lipid peroxidation products (e.g., MDA), and affected cell membrane integrity and stability.

[0059] The terms "comprising" or "including" as used herein are open-ended and encompass the specified components or steps described, as well as other specified components or steps that do not substantially affect them. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may consist of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, while still having the same or similar activity as the original sequence.

[0060] The term "and / or" as used herein includes all combinations of the items connected by the term, and each combination should be deemed to have been listed separately in this application. For example, "A and / or B" includes "A", "B", and "A and / or B". For another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C", and "A and B and C".

[0061] The abbreviations and full names in this application are compared in Table 1.

[0062] Table 1

[0063]

[0064] BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which:

[0066] Figure 1 :(a) Expression level of OsSPL3 gene transcript in leaves under arsenic treatment, schematic diagram of partial gene sequence (b) and schematic diagram of amino acid sequence (c) of WT, KO-1 mutant and KO-2 mutant;

[0067] Figure 2 : Schematic diagram of gene sequencing results of KO-1 mutant and KO-2 mutant;

[0068] Figure 3 : The ratio of plant height of WT, KO-1 and KO-2 rice seedlings in the As-treated group to the untreated group (mock group);

[0069] Figure 4 : (a) Arsenic content (mg / kg) in roots and stems of WT, KO-1 mutant, and KO-2 mutant; (b) Arsenic transport efficiency (%) of WT, KO-1 mutant, and KO-2 mutant; (c) Relative expression levels of OsABCC1 in WT, KO-1 mutant, and KO-2 mutant in the mock and As-treated groups;

[0070] Figure 5 : Predicted binding site of SPL protein to OsABCC1 promoter;

[0071] Figure 6 :(a) CAT activities of WT, KO-1 mutant, and KO-2 mutant in the mock group and As-treated group;(b) SOD activities of WT, KO-1 mutant, and KO-2 mutant in the mock group and As-treated group;(c) POD activities of WT, KO-1 mutant, and KO-2 mutant in the mock group and As-treated group;(d) Relative expression levels of OsCATA of WT, KO-1 mutant, and KO-2 mutant in the mock group and As-treated group;(e) Relative expression levels of OsCuZnSOD of WT, KO-1 mutant, and KO-2 mutant in the mock group and As-treated group;(f) Relative expression levels of OsNAC45 of WT, KO-1 mutant, and KO-2 mutant in the mock group and As-treated group;

[0072] Figure 7 : MDA contents of WT, KO-1 mutant and KO-2 mutant under As stress.

[0073] In the accompanying drawings, data are expressed as mean ± standard deviation. Analyses were performed by one-way ANOVA and Tukey's post hoc test. Different letters (a, b, c, d, e) indicate significant differences between groups (P < 0.05). Asterisks (*) indicate significant differences between treated and untreated groups within the same genotype (P < 0.05, Student's t-test). Asterisks (**) indicate significant differences between treated and untreated groups within the same genotype (P < 0.01, Student's t-test). DETAILED DESCRIPTION

[0074] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0075] The seed cultivation method, arsenic treatment and detection method used in the examples are as follows:

[0076] 1. Cultivation conditions and arsenic treatment

[0077] Rice seeds were surface-sterilized with a 2% sodium hypochlorite solution for 20 minutes and then washed three times with sterile distilled water. The sterilized seeds were transferred to 1 / 2 MS medium containing MS medium (Yoshida Rice Nutrient Solution, NSP 1040) and gellan gum (CAS: 71010-52-1) and cultured for three days. After germination, the seeds were transferred to 96-well hydroponic culture chambers and cultured for three weeks, with the nutrient solution replaced every seven days. All rice plants were grown in a greenhouse at 26°C, a 14:10 h light / dark cycle, and 70% relative humidity. To assess the effects of arsenic stress, 21-day-old rice plants were supplemented with nutrient solution and exposed to 0 and 250 μM sodium arsenate (Na2HAsO4, Sigma, CAS: 10048-95-0). Three days after inoculation, the plants were harvested, frozen in liquid nitrogen, and stored at -80°C for various physiological and biochemical parameters and molecular analyses.

[0078] 2. Evaluation of plant phenotype, root length, fresh root weight, and plant weight

[0079] The effects of arsenate stress (As stress) on root growth were assessed by measuring root length and plant weight. Complete images of the rice plant roots were captured using a digital camera (Canon Inc., Tokyo, Japan) to observe phenotypic characteristics. The length of the taproot of the rice seedlings was manually recorded using a ruler in centimeters (cm). Freshly collected plant samples were cleaned of excess water from the roots using gauze, representing the weight of each treated rice plant after water absorption under natural conditions. The plant samples were carefully removed and weighed using an electronic balance. Five plants were measured in each group, and the data were accurately recorded.

[0080] 3. Quantitative determination of arsenic content in plant tissues

[0081] Fresh root and stem samples were harvested, and the roots were carefully washed three times with distilled water to remove any material adhering to the roots. Root and shoot samples were immediately freeze-dried for three days, and then dry weight (DW) was measured using a digital balance. The dried samples were pre-digested with concentrated nitric acid (5 mL / sample) for 1 hour at room temperature. A microwave-based sample preparation system (Perkin Elmer Multi-Wave-3000, Waltham, MA, USA) was used to completely decompose the organic compounds in the digested samples by wet ashing. The total volume of each digested sample was then increased to 50 mL with ultrapure water and filtered using filter paper (5B, Advantec, Tokyo, Japan). As concentrations were measured using inductively coupled plasma mass spectrometry (ICP-MS, NexION 300, PerkinElmer, Waltham, MA, USA) according to a previous protocol (Liu et al., 2015). As content in plants is expressed as mg / kg dry weight.

[0082] 4. Estimation of hydrogen peroxide (H2O2) and malondialdehyde (MDA) content and antioxidant capacity analysis

[0083] Fresh plant tissue (0.2 g) was homogenized in a pre-cooled mortar with 2 mL of extraction buffer (phosphate buffer, pH 7.0). The homogenate was centrifuged at 10,000 rpm for 10 minutes at 4°C to obtain a crude enzyme extract. The supernatant was stored at 4°C for short-term use. The supernatant was used to evaluate the activity of antioxidant enzymes, including superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). The procedures and methods for enzyme activity analysis were as described previously (Mishra et al, 2017, 2022). The extraction and content of H2O2 in rice roots were determined using a hydrogen peroxide detection kit (Beyotime, S0038). MDA content was determined by a lipid peroxidation MDA detection kit (Beyotime, S0131S).

[0084] 5. RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis

[0085] Total RNA was extracted from plant tissues using Trizol reagent (Invitrogen) to analyze gene expression, and RNA was qualitatively and quantitatively analyzed using a UV spectrophotometer (Nanodrop 2000). The RT product was then used as a template, and qPCR was performed with primers to verify gene expression. To analyze gene expression, first-strand cDNA was synthesized using qPCR-RT Master Mix and gDNA Remover (Toyobo), including a DNase I treatment step to remove potential genomic DNA contamination. Primers were used to detect gene expression. The rice ubiquitin (Ubi) gene was used as an internal reference gene.

[0086] 6. Agronomic trait determination

[0087] Rice was grown in paddy fields in Chengdu, Sichuan Province (3°N, 103°E) during the typical rice growing season, which lasts from April to August. Plant height, number of panicles per plant, panicle length, seed set rate, number of grains per panicle, 1000-grain weight, and yield per plant were measured when 10 plants reached maturity. Full grains were oven-dried at 42°C for one week. 1000-grain weight was measured using the SC-A Grain Analysis System (Hangzhou Wanshen Co., Ltd., China).

[0088] 7. Data Analysis

[0089] Two-way analysis of variance (ANOVA) and Student's t test were performed using Microsoft Excel 2019. Post-hoc test (least significant difference test) was used, and P < 0.05 was considered statistically significant. The values ​​are expressed as mean ± standard error (SE).

[0090] OsSPL3 gene (LOC_Os02g04680, SEQ ID NO: 1)

[0091]

[0092] Example 1: CRISPR / Cas9 knockout of OsSPL3

[0093] 1. Expression pattern of OsSPL3 gene under arsenic stress

[0094] 21-day-old rice seedlings were hydroponically cultured with 250 μM Na2HAsO4 solution for 3 days. Real-time quantitative PCR (qRT-PCR) results showed that under arsenic (As) stress, the expression level of OsSPL3 gene transcription was significantly downregulated ( Figure 1 a), indicating that the OsSPL3 gene plays a key regulatory role in the response of rice to arsenic toxicity.

[0095] 2. Knockout of the OsSPL3 gene (LOC_Os02g04680, SEQ ID NO: 1)

[0096] A CRISPR / Cas9-mediated knockout line targeting the first exon of the OsSPL3 gene (237-256 bp downstream of the ATG) was constructed to knock out the OsSPL3 gene. The steps are as follows:

[0097] The gRNA was first screened and identified as CGATCGATTCTCCGTCCAAA (SEQ ID NO: 2). For related clone construction, refer to Jiang, M., He, Y., Chen, X., Zhang, X., Guo, Y., Yang, S. et al. (2020) CRISPR-based assessment of genomic structure in the conserved SQUAMOSA promoter-binding-like gene clusters in rice. The Plant Journal, 104, 1301–1314.

[0098] The designed targeting sequence was synthesized and annealed to form an oligolinker. The vector pBGK032 was digested with BsaI and purified using a DNA purification kit (TransGen Biotech, Beijing, China). A 10 μl ligation reaction containing 10 ng of digested plasmid pBGK03 and 0.05 mM oligolinker was performed and directly transformed into competent Escherichia coli cells (Kangwei, China) to generate the CRISPR / Cas9 plasmid vector. The resulting plasmid vector was then transformed into Agrobacterium tumefaciens strain GV3101. Transgenic plants were generated using Agrobacterium-mediated transformation.

[0099] 1) The genetic material used in this experiment was based on the background of Zhonghua No. 11, a rice variety bred by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, and commonly used as genetic material. Zhonghua No. 11 in this experiment was provided by Weimi Biotechnology (Jiangsu) Co., Ltd.

[0100] 2) OsSPL3 mutants, named KO-1 and KO-2, were screened for CRISPR / Cas9-mediated rice mutants using a solution containing 0.1% 6-benzylaminopurine (6-BA) and 50 mg / L hygromycin.

[0101] 3) Genomic DNA was extracted from the transgenic lines and primers (300-500 bp) designed for the target sites flanking SPL 3-Detect-F / R were used for PCR amplification.

[0102] The products were directly sequenced by Sangon Biotech (Shanghai, China), and the WT genome sequence was searched by BLAST to determine the mutation site ( Figure 2 ).

[0103] The results showed that sequencing of the mutants identified two homozygous mutant alleles: KO-1 had a single nucleotide deletion, while KO-2 exhibited an adenine (A) insertion at the target site ( Figure 1 b and Figure 2 Subsequent protein sequence analysis confirmed that both mutations introduced premature stop codons ( Figure 1 c), resulting in complete loss of OsSPL3 function in roots, stems, and leaves of KO-1 and KO-2.

[0104] Example 2: OsSPL3 knockout attenuates arsenic accumulation by regulating metal transporters

[0105] To evaluate the function of OsSPL3 under arsenic stress, this example quantified As accumulation and phenotypic responses in wild type (WT) and OsSPL3 mutants (KO-1 and KO-2 prepared in Example 1) after 3 days of exposure to 250 μM Na 2 HAsO 4 .

[0106] 1. Phenotypic results

[0107] After As treatment, the root length in all groups decreased. Compared with the untreated group (mock), the roots of the WT group showed a 22.4% reduction in root length, and the KO-1 and KO-2 groups showed a 24.4% and 17.9% reduction in root length, respectively. As for stem length, after As treatment, the stem length of the WT, KO-1 and KO-2 groups all decreased. Compared with the untreated group (mock), the stem length of the WT group decreased by 19.8%, while the stem length of the KO-1 and KO-2 groups decreased by 9.7% and 15.7%, respectively. After As treatment, the fresh weight of all plants decreased. Compared with the untreated group (mock), the fresh weight of the KO-1 and KO-2 groups decreased less. More importantly, the ratio of plant height of the As-treated to untreated groups showed that under As treatment, KO-1 and KO-2 were significantly taller than WT ( Figure 3 ), indicating that OsSPL3 knockout confers partial tolerance to As-induced growth inhibition. Collectively, these findings indicate that OsSPL3 regulates rice growth adaptation to arsenic stress, and OsSPL3 mutants (KO-1 and KO-2) exhibit remarkable phenotypic plasticity, namely, enhanced As tolerance.

[0108] 2. Arsenic accumulation results

[0109] This example quantitatively determined the arsenic accumulation in root and stem tissues. Compared with the WT, the arsenic content in the roots and stems of the OsSPL3 mutant was significantly reduced ( Figure 4 a). As content in roots of OsSPL3 mutants (KO-1 and KO-2) decreased by 66.4% and 67%, respectively, and As content in stems of OsSPL3 mutants (KO-1 and KO-2) decreased by 30.9% and 20%, respectively. Figure 4 a), namely, knockout of the OsSPL3 gene reduced arsenic accumulation in rice plants. The arsenic transport efficiency of the OsSPL3 mutants was higher than that of the wild type. The arsenic transport efficiency of the OsSPL3 mutants (KO-1 and KO-2) was 19.1% and 20.1%, respectively, while that of the wild type was only 9.3% ( Figure 4 b) This result indicates that knockout of the OsSPL3 gene leads to reduced arsenic accumulation in rice roots and stems.

[0110] 3. Role of OsSPL3 in arsenic accumulation and detoxification

[0111] This example analyzed arsenic levels and the expression of the arsenic-responsive transporter gene OsABCC1 in WT and OsSPL3 mutants. OsABCC1 is a C-type ATP-binding cassette (ABC) transporter known to sequester arsenic into the vacuole and reduce arsenic levels in cereals. Compared to the non-stressed control, the expression of OsABCC1 in roots increased by 2.3-fold in WT, 17.5-fold in KO-1, and 29.8-fold in KO-2 under As treatment. Figure 4 c). Interestingly, under non-As stress conditions, the transcription level of OsABCC1 in the mutant was significantly lower than that in the WT ( Figure 4 c) However, under As treatment, both knockout lines showed significant induction of OsABCC1 expression, exceeding the expression level of the wild-type line.

[0112] 4. Mechanism analysis results

[0113] SPL transcription factors regulate the expression of downstream genes by binding to conserved motifs. Analysis of the OsABCC1 promoter region identified two predicted binding sites for SPL protein, "GTAC," at positions 744-747 and 778-781 bp, which are located near the start codon of the OsABCC1 promoter ( Figure 5 Therefore, the OsSPL3 transcription factor may directly regulate the expression of OsABCC1 through these motifs, thereby mediating the adaptive response of plants to arsenic stress.

[0114] In summary, under normal growth conditions, OsSPL3 protein may inhibit OsABCC1, while As stress alleviates this inhibition, making it possible to strongly activate the arsenic detoxification pathway in the mutant. The increased expression of OsABCC1 in KO-1 and KO-2 may enhance the vacuolar sequestration of As, which explains the reduced As accumulation in KO-1 and KO-2 compared with WT ( Figure 4 These findings suggest that OsSPL3 regulates arsenic tolerance through a dual regulatory mechanism: limiting OsABCC1 expression to maintain metabolic homeostasis in the absence of arsenic stress and inducing OsABCC1 upregulation to alleviate arsenic toxicity in the presence of arsenic stress.

[0115] Example 3: Dynamic changes in antioxidant enzymes in osspl3 knockout mutants under arsenic stress

[0116] To reveal the potential reasons for the differences in oxidative damage levels between WT and OsSPL3 mutant plants (KO-1 and KO-2 prepared in Example 1), this example examined the activities of several key antioxidant enzymes and the expression of corresponding genes under As stress.

[0117] In the mock group, catalase (CAT) activity in WT roots was significantly lower than that in the OsSPL3 mutant, indicating that OsSPL3 plays a baseline role in maintaining antioxidant homeostasis ( Figure 6 a). Under arsenic stress, the CAT activity of both the wild type and the OsSPL3 mutant increased, but the CAT activity of the OsSPL3 mutant was higher. Similarly, under arsenic stress, the superoxide dismutase (SOD) activity of the OsSPL3 mutant was decreased. Figure 6 b) and peroxidase (POD, Figure 6 c) activity was also significantly increased. Gene expression analysis revealed that the OsCATA gene, encoding a catalase isoform, was significantly upregulated by 14.3-fold in the roots of the WT group, 62.6-fold in the roots of the KO-1 group, and 27.1-fold in the roots of the KO-2 group ( Figure 6 d), consistent with the observed enzyme activity trend.

[0118] The results of the study on the expression of genes related to antioxidant enzyme biosynthesis showed that under As stress, the transcription level of SOD encoding gene OsCuZnSOD increased by 10.7 times, 19.9 times and 18.9 times in the roots of WT, KO-1 and KO-2 groups respectively compared with that under non-As stress conditions ( Figure 6 e). OsNAC45 is a gene associated with stress-responsive transcriptional regulation, highlighting the molecular reprogramming in the OsSPL3 mutant to combat oxidative damage. On the other hand, under As stress conditions, the transcript levels of OsNAC45 increased by 3.6-fold and 3.98-fold in the roots of the KO-1 and KO-2 groups, respectively, compared with those under non-As stress conditions ( Figure 6 f).

[0119] Under arsenic (As) stress, the malondialdehyde (MDA) content (a proxy for lipid peroxidation) in the WT group increased 2.6-fold compared to that in the non-As stress group, while it decreased by 83.9% and 66.4% in the KO-1 and KO-2 groups, respectively. In addition, under As stress, the MDA levels in the OsSPL3 mutants (KO-1 and KO-2) were significantly reduced by 91.1% (KO-1) and 83.5% (KO-2) compared to the WT group ( Figure 7 These results indicate that OsSPL3 knockout can inhibit As-induced lipid peroxidation.

[0120] Together, these findings demonstrate that OsSPL3 knockout remodels the oxidative stress response network. Increased CAT, SOD, and POD activities, coupled with upregulated expression of OsCATA, OsCuZnSOD, and OsNAC45, suggest that OsSPL3 normally suppresses antioxidant mechanisms under non-stress conditions. OsSPL3 knockout unleashes a robust detoxification response, reducing MDA accumulation and membrane damage. This application positions OsSPL3 as a key regulator of arsenic-induced oxidative stress and provides new insights into the genetic basis of plant adaptation to heavy metal toxicity.

[0121] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0122] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

Claims

1. A method for improving rice tolerance to arsenic stress, characterized in that: The method includes not expressing OsSPL3 or reducing the expression level in rice.

2. The method according to claim 1, characterized in that The non-expression or reduced expression level of OsSPL3 includes knocking out or knocking down the OsSPL3 gene; The knockout method includes the Cre-loxP system, the FLP-FRT system or the CRISPR-Cas9 gene editing technology; The knockdown method includes RNA interference, such as shRNA or siRNA.

3. The method according to any one of claims 1-2, characterized in that The method comprises using an sgRNA targeting exon 1 of the OsSPL3 gene, preferably an sgRNA targeting 237-256 bp downstream of the start codon (ATG). Further preferably, the target sequence of the sgRNA comprises SEQ ID NO:

2.

4. The method according to any one of claims 1 to 3, characterized in that: The nucleotide 255 of the OsSPL3 gene is deleted, and / or an adenine (A) is inserted between positions 255 and 256 of the OsSPL3 gene.

5. The method according to any one of claims 1 to 4, characterized in that: The arsenic stress includes arsenic-induced oxidative stress.

6. The method according to any one of claims 1 to 5, characterized in that: The arsenic stress tolerance includes: A) reducing arsenic-induced growth inhibition, preferably, the growth inhibition comprises inhibiting plant height, plant weight, root length or stem length; B) reducing the accumulation of arsenic in rice, preferably reducing the accumulation of arsenic in rice roots and / or stems; and / or, C) increasing the transport rate of arsenic in rice, preferably increasing the transport rate of arsenic in rice roots and / or stems.

7. The method according to claim 1, characterized in that The absence or reduced expression of OsSPL3 improves rice tolerance to arsenic stress by regulating one or more of the following: transporters, stress-responsive transcriptional regulatory proteins, lipid peroxidation products, catalases, peroxidases, or superoxide dismutases. Preferably, the regulation is up-regulation or down-regulation; Preferably, the transporter comprises an ATP-binding cassette transporter, such as OsABCC1; Preferably, the lipid peroxidation product comprises malondialdehyde (MDA); Preferably, the superoxide dismutase comprises copper-zinc superoxide dismutase, such as OsCuZnSOD; Preferably, the stress-responsive transcriptional regulatory protein comprises a NAC transcription factor, such as OsNAC45; Preferably, the catalase comprises OsCATA.

8. The method according to claim 7, characterized in that The absence or reduced expression level of OsSPL3 improves rice tolerance to arsenic stress by upregulating one or more of transporters, downregulating lipid peroxidation products, upregulating peroxidases, upregulating stress-responsive transcriptional regulatory proteins, upregulating catalases, or upregulating superoxide dismutases.

9. Application of OsSPL3 not expressed or with reduced expression level in preparing rice tolerant to arsenic stress.

10. Use of an OsSPL3 gene mutation in preparing rice tolerant to arsenic stress, wherein the OsSPL3 gene mutation results in no expression or reduced expression level of OsSPL3 in rice.