Application of coding gene of corn MYB transcription factor ZmMYBIF35 in regulation and control of plant drought tolerance

Abstract

The invention relates to application of a coding gene of a corn MYB transcription factor ZmMYBIF35 in regulation and control of plant drought tolerance, and belongs to the technical field of gene engineering and crop genetic breeding, the CDS sequence of the coding gene of the transcription factor ZmMYBIF35 is as shown in SEQ ID NO.1, the genome sequence is as shown in SEQ ID NO.2, the gene is used for positively regulating and controlling the drought tolerance of crop plants, and the amino acid sequence of the transcription factor ZmMYBIF35 is as shown in SEQ ID NO.3. The invention also relates to application of the coding gene of the corn MYB transcription factor ZmMYBIF35 in regulation and control of plant drought tolerance. The ZmMYBIF35 gene overexpression corn plant is analyzed, it is found that the ZmMYBIF35 gene can regulate and control the drought tolerance of the plant, ZmMYBIF35 gene overexpression can enhance the drought tolerance of the plant, and important theoretical significance and application value are provided for creation of new corn germplasm and corn molecular breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and crop genetic breeding, and particularly relates to an application of a gene encoding a maize MYB transcription factor ZmMYBIF35 in regulating plant drought resistance. Background Art

[0002] Maize (Zea mays L.) is a globally important crop for food, feed, and industrial feedstock, but its production has long faced severe challenges from drought stress. According to statistics, global droughts have resulted in corn yield reductions of up to 20%-50%. Drought stress disrupts maize's physiological metabolism through multiple mechanisms: drought during the seedling stage inhibits root development, reducing water absorption efficiency; drought during the tasseling stage causes asynchronous development of male and female ears, directly impacting pollination success. Furthermore, drought-induced accumulation of reactive oxygen species (ROS) triggers peroxidation of cell membrane lipids, and elevated malondialdehyde (MDA) levels further exacerbate oxidative damage. With the intensification of global climate change and the frequent occurrence of extreme drought events, understanding the molecular mechanisms of maize drought resistance has become a pressing need to ensure food security.

[0003] MYB proteins are a class of transcription factors with conserved structural features. Their core functions rely on the MYB domain, which consists of one to four repeating units (R). Each repeating unit is composed of 51-53 amino acids folded into three α-helices. The second and third helices form a hydrophobic core in a helix-turn-helix (HTH) configuration. These helices contain three key tryptophan residues that are responsible for recognizing and binding to specific sequences in the major groove of DNA (e.g., the MYB recognition element). Based on the number of repeating units, MYB proteins are divided into four categories: 1R-MYB, R2R3-MYB, 3R-MYB, and 4R-MYB. R2R3-MYB is the most widespread subclass in plants. Its C-terminal variable regulatory domain (e.g., an acidic amino acid cluster) confers transcriptional activation or repression, and is widely involved in processes such as drought response and secondary metabolism.

[0004] In maize, 203 members of the MYB family have been identified, but only 16 have been definitively assigned drought resistance functions. Phylogenetic tree predictions suggest that 48 members may be associated with drought resistance, demonstrating the enormous potential and uncharted territory for functional research. For example, ZmMYB86 enhances drought tolerance by regulating ethylene signaling pathway genes (ZmERF-107 and ZmEIN3). However, the functions of most MYB proteins remain undetermined, and their synergistic mechanisms with other signaling pathways (such as ABA and ROS metabolism) remain unclear. Therefore, discovering and developing the functional applications of maize MYB transcription factor genes will be crucial for developing new stress-tolerant maize varieties and increasing maize yield. To this end, the present invention provides the application of the gene encoding the maize MYB transcription factor ZmMYBIF35 for regulating plant drought tolerance. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of a gene encoding a maize MYB transcription factor ZmMYBIF35 in regulating plant drought tolerance in order to solve the above problems.

[0006] The present invention achieves the above-mentioned purpose through the following technical solutions: The present invention provides an application of a gene encoding a maize MYB transcription factor ZmMYBIF35 in regulating plant drought resistance.

[0007] As a further optimized solution of the present invention, the CDS sequence of the gene encoding the transcription factor ZmMYBIF35 is shown as SEQ ID NO.1, and the genomic sequence is shown as SEQ ID NO.2.

[0008] As a further optimized solution of the present invention, the amino acid sequence of the transcription factor ZmMYBIF35 is shown in SEQ ID NO.3.

[0009] As a further optimization scheme of the present invention, the ZmMYBIF35 gene positively regulates the drought tolerance of crop plants.

[0010] As a further optimization scheme of the present invention, during the plant breeding process, genetic engineering technology is used to create crop varieties with overexpression of the ZmMYBIF35 gene, thereby obtaining crop varieties with enhanced drought tolerance.

[0011] As a further optimization scheme of the present invention, during the plant breeding process, crop varieties in which the ZmMYBIF35 gene is normally expressed are screened from natural ecotypes.

[0012] As a further optimized solution of the present invention, the crop is corn.

[0013] The beneficial effects of the present invention are: By analyzing corn plants overexpressing the ZmMYBIF35 gene, the present invention found that the ZmMYBIF35 gene can regulate the drought tolerance of the plant, and overexpression of the ZmMYBIF35 gene can enhance the drought tolerance of the plant, which provides important theoretical significance and application value for the creation of new corn germplasm and corn molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the phylogenetic tree analysis of ZmMYBIF35; Figure 2 This is a schematic diagram of the subcellular localization of the ZmMYBIF35 protein in maize protoplasts (the nuclear localization signal mCherry is a nuclear marker); Figure 3Phenotypic verification of ZmMYBIF35 overexpression in yeast INVSC1 cells under drought stress; Figure 4 is the analysis of the inducible expression pattern of ZmMYBIF35 under drought stress; Figure 5 It is the phenotypic analysis and physiological and biochemical index determination before and after drought treatment under soil culture conditions. DETAILED DESCRIPTION

[0015] The present application is described in further detail below. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0016] It should be noted that the maize inbred line KN5585 used in the following examples was purchased from Weimi Biotechnology (Jiangsu) Co., Ltd.; the INVSC1 yeast strain was from Weidi Biotechnology; all primers used were synthesized by Shanghai Sangon Biotechnology Co., Ltd.; sequencing was performed by General Biotechnology Co., Ltd.; various restriction endonucleases, ligases, pEASY-Blunt Simple, DNA Marker, Taq DNA polymerase, dNTPs, etc. used in the experiment were purchased from Takara; the reverse transcription kit was purchased from Promega; the plasmid extraction kit, gel recovery kit and genome extraction kit were purchased from Quanshijin Biotechnology Co., Ltd., and the methods were carried out according to the instructions.

[0017] Unless otherwise specified, the methods used in the following examples are conventional methods known to those skilled in the art, and the reagents not otherwise specified are commercially available products.

[0018] Example 1 Construction of the phylogenetic tree of the maize ZmMYBIF35 gene The CDS sequence, genomic sequence, and protein sequence of the ZmMYBIF35 gene were retrieved from the NCBI database and are shown as SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively. A phylogenetic tree was then constructed using MEGA11 software (see Figure 1). Figure 1 ), and analyze the evolutionary relationship.

[0019] Example 2 Subcellular localization of ZmMYBIF35 1. Construction of subcellular localization vector of ZmMYBIF35 To investigate the expression of the ZmMYBIF35 protein, a subcellular localization fusion expression vector was constructed. Using pCAMBIA1305 (p1305) as the backbone and GFP as the reporter gene, the p1305-35S-ZmMYBIF35-GFP fusion expression vector was constructed. When designing primers, the gene stop codon was removed, and XbaI and BamHI were used as restriction sites for upstream and downstream primers. Primers were synthesized by Sangon Biotechnology Co., Ltd. The primer sequences are as follows: SEQ ID NO.4: 1305-F:GTCCGGAGCTAGCTCTAGAATGGGGAGGGCGCCGT; SEQ ID NO.5: 1305-R:CCTTGCTCACCATGGATCCGAGATTGTCCAGGAAGAAGAGGTC.

[0020] 2. Corn protoplast extraction (1) B73 corn seeds were grown in the dark for about 2 weeks. 1.5 g of leaves from yellowing seedlings with good growth conditions were collected, the veins removed, and the leaves were cut into 0.2 mm thin strips using a scalpel in a dark environment. (2) Place the cut leaflets into the pre-prepared enzymatic hydrolysis solution (15 mL) and use tweezers to completely soak them; (3) Extraction was performed in the dark using a vacuum pump for 30 min to accelerate the contact between the enzymatic solution and the cell wall; (4) Incubate at room temperature using a horizontal shaker at 40 rpm and perform enzymatic hydrolysis in the dark for 6 h; (5) Pre-cool a certain amount of W5 solution and an empty sterile 50 mL round-bottom centrifuge tube (on ice); (6) Rinse a 100-mesh metal sieve with W5 and filter the diluted enzymatic hydrolysate containing protoplasts; (7) Reduce the acceleration and deceleration of the refrigerated centrifuge and centrifuge at 100 g and 4°C for 2 minutes. Aspirate the supernatant and add 5 mL of ice-cold W5 solution. Slowly tilt and rotate the centrifuge tube to mix. (8) Place on ice for 30 minutes, then centrifuge again at 100g and 4°C for 2 minutes; (9) Remove as much W5 solution as possible in the dark. Add an appropriate amount of MMG solution according to the amount of precipitate and resuspend the protoplasts in the same manner. Check the state and number of protoplasts in the solution under a microscope on a hemocytometer to ensure that the final concentration is not less than 1 × 106 cells / mL. (10) Add 5 µg of recombinant plasmid DNA and 5 µg of localization signal (preferably at a concentration of 500 ng / µL or more) to a 2 mL round-bottom EP tube; (11) Add 100 µL of protoplasts (approximately 2 × 104 cells) and mix gently; (12) Add 120 µL (the volume is the sum of the volumes in steps 10 and 11) of PEG 4000 solution and mix gently; (13) Carry out induction on ice in the dark. Select the transformation time according to the expression level, usually 1 hour is sufficient. (14) Dilute the transformation mixture with 480 µL (four times the volume added in step 12) of W5 solution at room temperature and mix gently to terminate the transformation reaction; (15) Centrifuge at room temperature for 2 minutes, remove as much supernatant as possible, then rinse once with W5 solution and centrifuge in the same manner to remove the supernatant; (16) Gently resuspend the cells in W1 / W5 solution, then transfer to a multi-well tissue culture dish and wrap with tin foil; (17) The protoplasts were cultured at room temperature for 24–36 h and then observed using a laser confocal microscope.

[0021] The results are as follows Figure 2 As shown, the ZmMYBIF35-GFP fusion protein was specifically localized in the cell nucleus, and its fluorescence signal completely coincided with the nuclear localization signal, confirming that ZmMYBIF35 is a nuclear-localized protein.

[0022] Example 3 Verification of ZmMYBIF35 yeast overproduction phenotype 1. Construction of overexpression vector Using the pYES2-NTB empty vector as a control, the ZmMYBIF35 gene was constructed into the pYES2-NTB expression vector. The primer sequences used are as follows: SEQ ID NO.6: NTB-F:ATAAGGTACCTAAGGATCCATGGGGAGGGCGCCG; SEQ ID NO.7: NTB-R:CTGGATATCTGCAGAATTCCTAGAGATTGTCCAGGAAGAAGA.

[0023] 2. Yeast transformation and overproduction phenotype verification (1) Prepare a series of SG-Ura (galactose substituted glucose) liquid media containing 0 mM, 30 mM, 60 mM, 90 mM, 120 mM, and 135 mM PEG 3350; (2) The recombinant vector pYES2-NTB-ZmMYBIF35 and the empty vector pYES2-NTB were transformed into the INVSC1 yeast strain respectively; (3) For each transformation, 200 µL of sterile water was used to suspend the cells, mixed gently, and plated onto SG-Ura-deficient screening plates. The plates were then incubated at 30°C for 3 days. (4) Pick a single colony and inoculate it into SG-Ura liquid medium for expansion; (5) When the OD600 value of the bacterial solution reached 0.8-1.0, 200 mL of the bacterial solution was transferred to SG-Ura liquid medium containing different concentrations of PEG 3350 for stress treatment for 24 hours, and then the plate was inverted in a constant temperature incubator at 30°C. After culturing for 2-3 days, the experimental results were observed and experimental photos were taken.

[0024] The results are as follows Figure 3 As shown in the results, yeast overexpression experiments confirmed that overexpression of ZmMYBIF35 could significantly improve the tolerance of yeast cells under drought stress conditions.

[0025] The drought induction analysis of ZmMYBIF35 was performed using 20% ​​PEG 6000. Figure 4 As shown in the figure, after drought stress, the expression level of ZmMYBIF35 gradually increased, reached the maximum after 6 hours, and then gradually decreased.

[0026] Example 4 Acquisition and identification of ZmMYBIF35 transgenic lines 1. pCAMBIA3301-GUS vector information The pCAMBIA3301-GUS vector is 11.32 kb in size and contains the Ka antibiotic resistance gene, a replication element, the Bar gene selection gene driven by the CaMV 35S promoter, the GUS sequence driven by the CaMV 35S promoter, and the target gene DNA sequence driven by the Ubi promoter. The presence of the Bar gene enables subsequent detection using specific Bar gene rapid detection strips.

[0027] 2. Construction of vector The pCAMBIA3301-GUS vector was first digested and linearized using the T4 ligase method, and then the ZmMYBIF35 gene DNA fragment was ligated into the pCAMBIA3301-GUS vector. After verification, the vector was sent to Weimi Biotechnology (Jiangsu) Co., Ltd. for genetic transformation using the KN5585 strain as the genetic background.

[0028] 3. Screening positive seedlings Cut about 0.5 cm of young corn leaves, place them in a 1.5 mL centrifuge tube, add an appropriate amount of pure water, and grind them thoroughly with a grinding rod until the liquid is turbid and in a homogenous state. Then insert the test strip upright into the centrifuge tube. Be careful not to let the liquid level exceed the detection area. After a clear band appears, read and record the test results within 8 to 10 minutes to screen out two ZmMYBIF35 overexpression strains OE3 and OE4.

[0029] 4. Phenotypic verification and physiological and biochemical index determination of ZmMYBIF35 overexpression lines The KN5585 strain, with uniform kernel size, served as a control group, while two ZmMYBIF35-overexpressing strains, OE3 and OE4, served as experimental groups. The strains were subjected to 14 days of natural drought treatment and then rehydrated. After 14 days of natural drought treatment, physiological parameters of drought-stressed leaves from each strain were measured and photographed.

[0030] like Figure 5 As shown in the figure, after 14 days of natural drought treatment, the KN5585 strain showed typical drought stress symptoms, including leaf dehydration, curling and yellowing, while the OE3 and OE4 strains maintained a good growth state; after 7 days of rehydration, the OE3 and OE4 strains showed strong recovery ability, while the KN5585 strain showed a wilting and drying state ( Figure 5 A), the survival rates of OE3 and OE4 strains were also higher than those of KN5585 ( Figure 5 B), showing significant drought tolerance advantages; At the same time, the relative conductivity of all plants showed an upward trend, but the relative conductivity of the KN5585 strain was significantly higher than that of the OE3 and OE4 strains ( Figure 5 C); The relative water content of all plants decreased, but the water content of OE3 and OE4 lines was significantly higher than that of KN5585 line ( Figure 5 D); The above results fully demonstrate that the drought-tolerant phenotype of the transgenic line is caused by overexpression of the ZmMYBIF35 gene.

[0031] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. Application of a gene encoding a maize MYB-type transcription factor ZmMYBIF35 in regulating plant drought tolerance.

2. The use according to claim 1, characterized in that The CDS sequence of the gene encoding the transcription factor ZmMYBIF35 is shown in SEQ ID NO.1, and the genome sequence is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The amino acid sequence of the transcription factor ZmMYBIF35 is shown in SEQ ID NO.

3.

4. The use according to claim 1, characterized in that The ZmMYBIF35 gene positively regulates drought tolerance in crop plants.

5. The use according to claim 1, characterized in that In the process of plant breeding, genetic engineering technology is used to create crop varieties with overexpression of the ZmMYBIF35 gene, thereby obtaining crop varieties with enhanced drought tolerance.

6. The use according to claim 1, characterized in that During plant breeding, crop varieties with normal expression of the ZmMYBIF35 gene are screened from natural ecotypes.

7. The use according to claim 4, characterized in that The crop is corn.

Images