Universal engineering exosome construction method based on bidirectional loading module

Abstract

The present application relates to the technical field of exosome modification, and specifically provides a universal engineered exosome construction method based on a bidirectional loading module.The method comprises the following steps: constructing a plasmid expression vector comprising a coding gene of a fusion protein; the fusion protein comprises: a protein CD63 and a tag protein carried by the N terminal of the protein CD63, a Catcher inserted into the second extracellular loop of the protein CD63, a structural module located at the C terminal of the CD63 protein, and the structural module comprises: a polybasic membrane inner anchoring domain, a flexible connecting peptide, and an N-peptide domain from a lambda phage; the plasmid expression vector is packaged into a lentivirus and purified, and then introduced into mammalian cells to obtain a mammalian cell strain stably expressing the fusion protein by screening; and the bidirectional exosomes with membrane outer display Catcher and membrane inner RNA enrichment capability are extracted from the culture solution of the mammalian cell strain.The present application breaks through the limitations of traditional exosome modification and RNA loading, and provides a universal and efficient exosome engineering construction platform with bidirectional loading of the inside and outside of the membrane.

Description

Technical Field

[0001] This invention belongs to the field of exosome modification technology, and particularly relates to a general method for constructing engineering exosomes based on a bidirectional load module. Background Technology

[0002] Exosomes (EVs) are a type of membrane-bound vesicle actively secreted by cells. They are approximately 30-150 nm in diameter, possess a complete lipid bimembrane structure, and carry cell-specific proteins, nucleic acids, lipids, and other bioactive substances. In recent years, exosomes have attracted widespread attention and in-depth research in areas such as tumor therapy, regulation of autoimmune diseases, tissue damage repair, and drug delivery system development due to their inherent biocompatibility, low immunogenicity, natural targeting, and good in vivo stability. In particular, exosomes derived from allogeneic or even autologous cells are more suitable for constructing long-term, stable, safe, and effective drug delivery carriers due to their significant homology homing characteristics and immune escape capabilities, and thus have significant clinical translational value.

[0003] However, despite the natural advantages of eukaryotic cell-derived exosomes in therapeutic delivery, current technologies still struggle to achieve efficient surface modification and functionalization of exosomes. Traditional exosome surface modification strategies typically rely on non-specific interactions, such as electrostatic adsorption, van der Waals forces, or hydrogen bonds. These methods are susceptible to interference from plasma proteins and ions in the complex physiological environment of vivo, leading to low stability of functional molecules binding to exosomes, uncontrolled release, and unsatisfactory targeted delivery efficiency, thus affecting therapeutic efficacy. To overcome these shortcomings, researchers have attempted to covalently modify exosomes using chemical cross-linking agents (such as those targeting amino, carboxyl, or thiol groups). While this has enhanced linkage stability to some extent, such reactions often require stringent conditions and lack specificity, easily damaging the membrane structure and function of exosomes, reducing biocompatibility, and severely limiting their effective in vivo application.

[0004] In recent years, the "streptococcal-derived isopeptide bridging system" has been successfully applied in fields such as nanoparticle functionalization, protein immobilization, and vaccine development due to its high specificity, stable covalent linkage, and mild reaction conditions. This type of system is based on surface protein domains of Streptococcus species (such as Streptococcus pyogenes, Streptococcus pneumoniae, and Streptococcus dysgalactiae), achieving spontaneous and irreversible covalent binding between Tags and Catchers through isopeptide bond formation. Representative members include SpyCatcher / SpyTag, SnoopCatcher / SnoopTag, DogCatcher / DogTag, and SdyCatcher / SdyTag (hereinafter referred to as Catcher and Tag). However, due to the complex structure of eukaryotic cell membrane proteins, the finely regulated transmembrane transport pathways, and the spatial conformational limitations of prokaryotic protein fusion expression, the effective expression and anchoring of such Tag / Catcher modules on the surface of eukaryotic cell-derived exosomes still faces significant technical challenges. In particular, there is still no universally effective solution for how to precisely and efficiently anchor exogenous functional proteins on the surface of exosome membranes and achieve efficient and stable binding with functional payloads without affecting the exosome biogenesis process and the natural function of membrane proteins.

[0005] Meanwhile, the delivery of specific RNA molecules to exosomes for clinical treatment is currently a hot topic in exosome applications. However, how to efficiently enrich specific RNA molecules within the exosome cavity remains a key challenge in the engineering of exosomes. Traditional RNA loading methods are mostly passive encapsulation, resulting in low loading efficiency and a lack of specificity. Therefore, there is an urgent need to develop an engineered bidirectional exosome loading platform that combines the advantages mentioned above, enabling efficient covalent modification on the exosome membrane surface and efficient enrichment of specific RNA within the exosome cavity. This would significantly improve the application efficacy of exosomes in areas such as tumor immunotherapy, targeted drug delivery, RNA therapy, vaccine vectors, and nanomaterial display. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a general engineering exosome construction method based on a bidirectional load module, which aims to solve the problems mentioned in the background art.

[0007] In a first aspect, the present invention provides a general method for constructing engineered exosomes based on a bidirectional load module, comprising the following steps:

[0008] Step S1: Construct a plasmid expression vector containing the gene encoding the fusion protein;

[0009] The fusion protein comprises: a: a four-transmembrane protein CD63 with a tag protein at its N-terminus; b: a catcher inserted into the second extracellular loop of the opened four-transmembrane protein CD63, the catcher being connected at both ends by flexible linker peptides and carrying a tag protein at its C-terminus; c: a structural module located at the C-terminus of the four-transmembrane protein CD63, comprising: (i) a polybasic intramembrane anchoring domain; (ii) a flexible linker peptide of 10-20 amino acids in length; and (iii) an N-peptide domain derived from λ phage.

[0010] Step S2: The plasmid expression vector is packaged with lentivirus and purified before being introduced into mammalian cells. Mammalian cell lines that stably express the fusion protein are then screened for.

[0011] Step S3: In the culture medium of the mammalian cell line, bifunctional exosomes with the ability to display a catcher outside the membrane and enrich RNA inside the membrane are extracted by centrifugation. Outside the exosome membrane, the catcher forms a heteropeptide bond with the corresponding tag-labeled functional molecule to achieve covalent linkage. Inside the exosome membrane, the N-peptide domain enriches the target mRNA molecule carrying the BoxB sequence.

[0012] Further, in step S1, the Catcher includes at least one of SnoopCatcher, SpyCatcher, DogCatcher, or SdyCatcher; the N-peptide domain derived from λ phage can be replaced with MS2 phage capsid protein.

[0013] In step S3, the BoxB sequence can be replaced with the MS2 stem-loop sequence.

[0014] Further, in step S1, the gene sequence encoding the four-transmembrane protein CD63 is shown in SEQ ID NO.1, the gene sequence encoding SnoopCatcher is shown in SEQ ID NO.2, and the gene encoding the N-peptide domain derived from λ phage is shown in SEQ ID NO.3.

[0015] Further, in step S1, the polybasic membrane anchoring domain is composed of arginine, proline and lysine residues, and the amino acid sequence is shown in SEQ ID NO.4.

[0016] Further, in step S1, the N-terminus of the four-transmembrane protein CD63 carries a Flag tag protein, the C-terminus of the Catcher carries a Myc tag protein, and the flexible linker peptide is (Gly4Ser)n, where n=2-4.

[0017] Furthermore, in step S2, the mammalian cells include HEK293T cells.

[0018] Further, in step S3, the corresponding tag-labeled functional molecules include fluorescently labeled peptides, gold nanoclusters, targeting peptides, nanomaterials, or signal probes; the corresponding tag-labeled functional molecules are linked to the drug, protein, or material they are attached to via valine-citrulline acid-sensitive cleavable linker peptides, which spontaneously hydrolyze in a lysosomal environment to achieve controlled release of the delivered substance.

[0019] Secondly, the present invention provides a fusion protein comprising: a: a four-transmembrane protein CD63, with a tag protein at its N-terminus; b: a catcher inserted into the second extracellular loop of the opened four-transmembrane protein CD63, the catcher being connected at both ends by flexible linker peptides, and carrying a tag protein at its C-terminus; c: a structural module located at the C-terminus of the four-transmembrane protein CD63, comprising: (i) a polybasic intracellular anchoring domain composed of arginine, proline and lysine residues, the amino acid sequence of which is shown in SEQ ID NO.4; (ii) a flexible linker peptide of 10-20 amino acids in length; and (iii) an N-peptide domain derived from λ phage.

[0020] Thirdly, the present invention provides plasmid expression vectors, lentiviruses or universal engineered exosomes constructed using a universal engineered exosome construction method based on a bidirectional load module.

[0021] Furthermore, the applications of plasmid expression vectors, lentiviruses, or universally engineered exosomes constructed based on bidirectional loading modules in tumor immunotherapy, targeted drug delivery, RNA therapy, vaccine vectors, or nanomaterial display.

[0022] The present invention has the following beneficial effects:

[0023] (1) By constructing a universal engineered exosome based on a bidirectional loading module, the technical pain points of current exosome modification, such as poor stability, harsh covalent modification conditions, and uncertain reaction sites, are solved. It has high selectivity: outside the membrane, the Cater and Tag pairing is specific; strong covalent stability: the isopeptide bond connection is irreversible; bioorthogonal reaction: it does not interfere with the host system and can occur spontaneously in complex biological environments; mild assembly conditions: it does not depend on exogenous catalysts; strong modular scalability: it can be adapted to a variety of therapeutic or diagnostic molecules. Inside the membrane, the N-peptide / BoxB system is introduced, which can specifically recognize and efficiently enrich RNA molecules with BoxB sequences in the exosome membrane, thereby breaking through the technical bottleneck of low nucleic acid loading efficiency and lack of targeted enrichment mechanism in traditional exosomes, further improving the accuracy and effectiveness of exosome nucleic acid drug delivery, and realizing the bidirectional loading modular transformation of exosomes.

[0024] (2) Simple and efficient modular exosome engineering modification can be achieved through engineered plasmids, which can be extended to various exosome application scenarios, including tumor immunotherapy, targeted drug delivery, RNA therapy, vaccine vectors or nanomaterial display. In addition, the construction method is simple and versatile, and can be applied to the engineering of common mammalian cell lines to produce corresponding engineered exosomes. Users do not need to master any molecular cloning and genetic engineering technology, nor do they need any related background knowledge. They only need to directly use the lentivirus expressing the fusion protein gene constructed in this invention to infect the target cell line, and then screen with puromycin to obtain a stable expression cell line. The engineering of the target cell line can be easily completed. Then, the engineered exosomes expressing Catcher and N-peptide can be directly obtained by conventional exosome extraction methods. They can be conveniently and specifically assembled with any material labeled with the corresponding tag under mild conditions, while achieving efficient enrichment and carrying of the target RNA. The four-transmembrane protein CD63, a classic surface marker of exosomes, is widely expressed in various mammalian cell lines such as HEK293T and mesenchymal stem cells. Using CD63 as an exosome membrane anchoring framework can be directly extended to the engineering modification of exosomes from different cell sources without the need for cell-specific optimization design, and the construction method is highly versatile.

[0025] (3) Using the four-transmembrane protein CD63 as an exosome membrane anchoring framework, a catcher is inserted into the second extracellular loop of CD63 and a flexible linker peptide is introduced, preserving the overall conformation of CD63. This allows for the simultaneous display of the extracellular catcher and the intracellular N-peptide without significantly disturbing the overall folding. To further stabilize the dual-module structure, this invention adds a polybasic intracellular anchoring domain, mainly composed of arginine and lysine with 1-2 proline folds, to the C-terminus of the fusion protein, forming a tunable-length "topological lock." This domain, with arginine as its core, is rich in guanidine-type positive charges, which can form multi-site, high-strength electrostatic interactions with the negatively charged heads of phospholipids on the inner side of the exosome membrane. Simultaneously, the inserted proline breaks the long straight chain to reduce the tendency for secondary structure formation, forming a flexible and high-charge-density tail, thus improving the affinity on the inner side of the membrane. The above structure can effectively reduce the risk of membrane localization disorder or transmembrane segment flipping that may occur after extensive end-structure modification, thereby maintaining the correct transmembrane topology of the fusion protein. Simultaneously, this domain forms a synergistic mechanism with the N-peptide domain (RNA-binding module): its strong positive charge actively drags negatively charged mRNA to the N-peptide neighborhood through charge gradient effects. Combined with the specific binding of the N-peptide to the BoxB sequence, this creates an "adsorption-hook" dual fixation mechanism. This achieves secondary mRNA aggregation through the efficient electrostatic interaction between the arginine guanidine group and the RNA phosphate backbone, while the flexible structure avoids spatial interference with the specific recognition of the N-peptide, significantly improving the mRNA loading capacity and stability within exosomes. This synergistic design is expected to enhance RNA loading capacity and stability within exosomes, ensuring precise spatial positioning and functional independence between the extracellular catcher and the intracellular N-peptide, thereby comprehensively improving the structural stability and delivery efficiency of engineered exosomes. Attached Figure Description

[0026] Exemplary embodiments of the present invention can be more fully understood by referring to the following figures:

[0027] Figure 1 This is a map of the plasmid (pLV2-CMV-FLAG-CD63(mouse)-mCherry-Puro) of Example 1 of the present invention.

[0028] Figure 2 The spectrum of the plasmid (pLV2-CMV-FLAG-CD63(mouse)-SnoopCatcher-Myc-N-peptide-Puro) of Example 1 of this invention.

[0029] Figure 3This is a schematic diagram of the expression of the CD63-SnoopCatcher-N-peptide fusion protein on the cell membrane surface in Example 1 of the present invention.

[0030] Figure 4 The results are immunofluorescence of the control and stable HEK293T cell lines expressing the fusion protein in Example 2 of this invention.

[0031] Figure 5 This is a graph showing the results of Western blotting detection of Myc tags in ordinary exosomes and exosomes expressing fusion proteins in Example 3 of the present invention.

[0032] Figure 6 This is a laser confocal microscope result of step (1) of Embodiment 4 of the present invention.

[0033] Figure 7 This is a laser confocal microscope result image of step (2) of Embodiment 4 of the present invention, wherein:

[0034] Figure 7 A. SnoopTag-labeled gold nanoclusters; Overview of ordinary HEK293T cells with SnoopTag-labeled gold nanoclusters and HEK293T cells expressing fusion proteins with SnoopTag-labeled gold nanoclusters.

[0035] Figure 7 B in the text represents gold nanoclusters labeled with SnoopTag;

[0036] Figure 7 In this context, C represents ordinary HEK293T cells and gold nanoclusters labeled with SnoopTag;

[0037] Figure 7 In the diagram, D represents HEK293T cells expressing the fusion protein and gold nanoclusters labeled with SnoopTag.

[0038] Figure 8 The transmission electron microscopy (TEM) results of Example 4 of this invention are shown. Scale bar: 100 nm.

[0039] Figure 8 In this context, A represents the direct assembly of ordinary exosomes with gold nanoclusters;

[0040] Figure 8 In the figure, B represents the assembly of exosomes expressing the fusion protein with SnoopTag-labeled gold nanoclusters.

[0041] Figure 9 This is a graph showing the detection results of the protein blotting method in Example 5 of the present invention. Detailed Implementation

[0042] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present invention and are not intended to limit the present invention.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains; the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0044] This invention provides a general method for constructing engineered exosomes based on a bidirectional load module, comprising the following steps:

[0045] Step S1: Construct a plasmid expression vector containing the gene encoding the fusion protein;

[0046] The fusion protein includes: a: the four-transmembrane protein CD63, with a tag protein at its N-terminus; b: a catcher inserted into the second extracellular loop of the opened four-transmembrane protein CD63, the catcher being connected by flexible linker peptides before and after it, with a tag protein at its C-terminus; c: a structural module located at the C-terminus of the four-transmembrane protein CD63, including: (i) a polybasic intracellular anchoring domain; (ii) a flexible linker peptide of 10-20 amino acids in length; and (iii) an N-peptide domain derived from λ phage.

[0047] Step S2: After packaging and purifying the lentivirus into the plasmid expression vector, the lentivirus is introduced into mammalian cells, and mammalian cell lines that stably express the fusion protein are screened to obtain the results.

[0048] Step S3: Bifunctional exosomes capable of displaying a catcher on the outside of the membrane and enriching RNA on the inside of the membrane are extracted from the culture medium of mammalian cell lines by centrifugation. On the outside of the exosome membrane, the catcher forms a heteropeptide bond with the corresponding tag-labeled functional molecule to achieve covalent linkage; on the inside of the exosome membrane, the N-peptide domain enriches the target mRNA molecule carrying the BoxB sequence.

[0049] In some embodiments, in step S1, the Catcher includes at least one of SnoopCatcher, SpyCatcher, DogCatcher, or SdyCatcher for multi-module bioorthogonal coupling on the surface of exosomes; the N-peptide domain derived from λ phage can be replaced with MS2 phage capsid protein.

[0050] In step S3, the BoxB sequence can be replaced with the MS2 stem-loop sequence.

[0051] In some embodiments, in step S1, the gene sequence encoding the four-transmembrane protein CD63 is shown in SEQ ID NO.1, the gene sequence encoding SnoopCatcher is shown in SEQ ID NO.2, and the gene encoding the N-peptide domain derived from λ phage is shown in SEQ ID NO.3.

[0052] In some embodiments, in step S1, the polybasic membrane anchoring domain is composed of arginine, proline and lysine residues, and the amino acid sequence is shown in SEQ ID NO.4.

[0053] In some embodiments, in step S1, the N-terminus of the four-transmembrane protein CD63 carries a Flag tag protein, the C-terminus of Catcher carries a Myc tag protein, and the flexible linker peptide is (Gly4Ser)n, where n=2-4.

[0054] In some embodiments, in step S2, the mammalian cells include HEK293T cells.

[0055] In some embodiments, in step S3, the functional molecules labeled with the corresponding tag include fluorescently labeled peptides, gold nanoclusters, targeting peptides, nanomaterials, or signal probes; the functional molecules labeled with the corresponding tag are linked to the drug, protein, or material through a valine-citrulline acid-sensitive cleavable linker peptide, which spontaneously hydrolyzes in a lysosomal environment to achieve controlled release of the delivered substance.

[0056] In some embodiments, the present invention provides a fusion protein comprising: a: a four-transmembrane protein CD63, with a tag protein at its N-terminus; b: a catcher inserted into the second extracellular loop of the opened four-transmembrane protein CD63, the catcher being connected before and after by flexible linker peptides, and carrying a tag protein at its C-terminus; c: a structural module located at the C-terminus of the four-transmembrane protein CD63, comprising: (i) a polybasic intracellular anchoring domain composed of arginine, proline, and lysine residues, the amino acid sequence of which is shown in SEQ ID NO.4; (ii) a flexible linker peptide of 10-20 amino acids in length; and (iii) an N-peptide domain derived from λ phage.

[0057] In some embodiments, the present invention provides plasmid expression vectors, lentiviruses, or universally engineered exosomes constructed using a universal engineered exosome construction method based on a bidirectional load module.

[0058] In some embodiments, plasmid expression vectors, lentiviruses, or universally engineered exosomes constructed based on bidirectional load modules are used in the fields of tumor immunotherapy, targeted drug delivery, RNA therapy, vaccine vectors, or nanomaterial display.

[0059] Example 1: Construction of a plasmid expression vector containing the coding gene of the fusion protein

[0060] (1) The four-transmembrane protein CD63 is a classic surface marker of exosomes. The four-transmembrane protein CD63 was selected as the exosome membrane anchoring framework. The coding gene sequence of the four-transmembrane protein CD63 in mice was obtained, and the sequence is shown in SEQ ID NO.1.

[0061] We obtained plasmid pET28a-SnoopCatcher with catalog number P9017 from Miaoling Biotechnology, and obtained the coding gene sequence of SnoopCatcher from plasmid pET28a-SnoopCatcher, as shown in SEQ ID NO.2.

[0062] (2) The four-transmembrane protein CD63 has two extracellular loops, a first extracellular loop (EC1) and a second extracellular loop (EC2). The two extracellular loops are located outside the cell or outside the exosome. The second extracellular loop is longer and has sufficient space exposure. Therefore, the coding gene of SnoopCatcher is inserted into the middle of the second extracellular loop of the coding gene of the four-transmembrane protein CD63 by introducing (Gly4Ser)3 flexible linker peptide sequences at both ends to preserve the overall conformation of the four-transmembrane protein CD63 and increase the structural freedom of SnoopCatcher. At the same time, an N-peptide domain is added to the C-terminus of the fusion protein and a (Gly4Ser)3 flexible linker peptide is introduced at its N-terminus to maintain the free conformation of the N-peptide. The sequence of the N-peptide is shown in SEQ ID NO.3. In addition, a polybasic intramembrane anchoring domain was modified at the C-terminus (before the N-peptide domain) of the fusion protein. The polybasic intramembrane anchoring domain is composed of arginine, proline and lysine residues, and the amino acid sequence is shown in SEQ ID NO.4.

[0063] (3) To facilitate the detection of fusion proteins, a Flag tag is added to the N-terminus of the fusion protein, that is, the gene encoding the Flag tag protein is added to the 5' end of the gene encoding the four-transmembrane protein CD63, and a Myc tag is added to the C-terminus of SnoopCatcher, that is, the gene encoding the Myc tag protein is added to the 3' end of the gene encoding SnoopCatcher.

[0064] The structure of the fusion protein is as follows: Flag–CD63 (up)–(Gly4Ser)3–SnoopCatcher–Myc–(Gly4Ser)3–CD63 (down)–polybasic intracellular anchoring domain–(Gly4Ser)3–N-peptide domain, where CD63(up) represents the amino acid sequence before the insertion site of the second extracellular loop of the four-transmembrane protein CD63, and CD63(down) represents the amino acid sequence after the insertion site of the second extracellular loop of the four-transmembrane protein CD63.

[0065] (4) Add the Kozak sequence to the 5' end of the fusion protein gene to help the expression of the fusion protein and obtain the coding gene of the fusion protein with the Kozak sequence added.

[0066] (5) The plasmid (pLV2-CMV-FLAG-CD63(mouse)-mCherry-Puro) with catalog number P38495 obtained from Miaoling Biotechnology was used as the expression vector framework for the fusion protein gene. Its map is shown below. Figure 1 As shown. The original target gene sequence of the plasmid was removed by double digestion using two unique restriction enzyme sites, Xho I and Not I. The coding gene of the fusion protein was seamlessly cloned into the plasmid with the original target gene sequence removed, resulting in the plasmid (pLV2-CMV-FLAG-CD63(mouse)-SnoopCatcher-Myc-N-peptide-Puro), as shown in the diagram. Figure 2 As shown.

[0067] A schematic diagram illustrating the expression of the CD63-SnoopCatcher-N-peptide fusion protein on the cell membrane surface is shown below. Figure 3 As shown.

[0068] Example 1 utilizes the four-transmembrane protein CD63 as an exosome membrane anchoring framework. A catcher and a flexible linker peptide are inserted into the second extracellular loop of CD63, preserving the overall conformation of CD63 and simultaneously displaying the extracellular catcher and intracellular N-peptide with minimal disturbance to the overall folding. To further stabilize the dual-module structure, a polybasic intracellular anchoring domain, primarily composed of arginine-lysine and interspersed with 1-2 proline folds, is added to the C-terminus of the fusion protein, forming a tunable-length "topological lock." This domain, with arginine at its core and rich in guanidine-type positive charges, can form multi-site, high-strength electrostatic interactions with the negatively charged heads of phospholipids on the inner side of the exosome membrane. Simultaneously, the inserted proline breaks the long straight chain to reduce secondary structure tendency, forming a flexible and high-charge-density tail, improving intracellular affinity. This structure effectively reduces the risk of membrane localization disorder or transmembrane flipping that may occur after extensive terminal structure modifications, thus maintaining the correct transmembrane topology of the fusion protein.

[0069] Simultaneously, this domain forms a synergistic mechanism with the N-peptide domain (RNA-binding module): its strong positive charge actively drags negatively charged mRNA to the N-peptide neighborhood through charge gradient effects. Combined with the specific binding of the N-peptide to the BoxB sequence, this creates an "adsorption-hook" dual fixation mechanism. This achieves secondary mRNA aggregation through the efficient electrostatic interaction between the arginine guanidine group and the RNA phosphate backbone, while the flexible structure avoids spatial interference with the specific recognition of the N-peptide, significantly improving the mRNA loading capacity and stability within exosomes. This synergistic design is expected to enhance RNA loading capacity and stability within exosomes, ensuring precise spatial positioning and functional independence between the extracellular catcher and the intracellular N-peptide, thereby comprehensively improving the structural stability and delivery efficiency of engineered exosomes.

[0070] Example 2: Obtaining a mammalian cell line stably expressing the fusion protein

[0071] (1) Example 1: An expression vector containing the fusion protein gene was constructed and transfected into mammalian cells (HEK293T cells) via LPEI, and co-transfected with a second-generation lentiviral packaging plasmid to generate lentivirus;

[0072] (2) HEK293T cells were infected with lentivirus and HEK293T cell lines that stably expressed fusion protein were screened.

[0073] Immunofluorescence results of ordinary HEK293T cells and HEK293T cells stably expressing the fusion protein are as follows: Figure 4As shown in the figure, DAPI is used to label the cell nucleus, and Myc is used to display the distribution of the fusion protein. The results show that the fusion protein can be detected on the cell membrane surface of HEK293T cells that stably express the fusion protein.

[0074] Example 3: Obtaining bifunctional exosomes with the ability to display catchers extracellularly and enrich RNA intracellularly.

[0075] Culture medium was collected from the HEK293T cell line prepared in Example 2, and exosomes expressing the fusion protein were extracted using differential centrifugation.

[0076] Western blot analysis of Myc tags in ordinary exosomes and exosomes expressing fusion proteins yielded the following results: Figure 5 As shown in the figure, the results indicate that exosomes extracted from the HEK293T cell line that stably expresses the fusion protein can detect the Myc-tagged fusion protein.

[0077] Example 4: Verification of the combination ability of SnoopCatcher and SnoopTag

[0078] (1) The peptide labeled with SnoopTag was labeled with FITC (a green fluorescent dye), and then co-incubated with the scaffold of HEK293T cells that stably expressed the fusion protein at 37°C for 1 h. After washing three times with phosphate buffer, the scaffold was fixed and blocked, and the cell nuclei were stained with DAPI.

[0079] Laser confocal microscopy results of ordinary HEK293T cells and HEK293T cells expressing the fusion protein are as follows: Figure 6 As shown, the results indicate that the SnoopTag-labeled peptide has excellent specific binding effect on the surface of HEK293T cells expressing the fusion protein, and the reaction conditions are mild.

[0080] (2) SnoopTag was used to label a gold nanocluster (approximately 2.5 nm in diameter) with near-infrared II emission capability. The SnoopTag-labeled gold nanocluster was co-incubated with HEK293T cells stably expressing the fusion protein on a shaker at 37°C at 100 rpm for 1 h. After repeated washing, centrifugation (800 rpm, 5 min), and resuspending seven times with phosphate buffer, near-infrared II imaging was performed.

[0081] Imaging results as follows Figure 7 As shown, the results indicate that SnoopTag-labeled gold nanoclusters can efficiently and specifically bind to the surface of HEK293T cells expressing the fusion protein, and the reaction conditions are mild.

[0082] (3) After SnoopTag-labeled gold nanoclusters and exosomes expressing fusion proteins were co-incubated in phosphate buffer at 37°C on a shaker for 1 h, they were then ultrafiltered with a 100 kDa ultrafiltration tube to remove excess gold nanoclusters. Subsequently, the exosomes were resuspended and purified by ultracentrifugation and concentration. Finally, they were detected by transmission electron microscopy.

[0083] Transmission electron microscopy results are as follows Figure 8 As shown, the results indicate that the surface of exosomes expressing the fusion protein exhibits distinct gold nanoclusters (GNACs). Figure 8 In the case of B), gold nanoclusters were almost not observed on the surface of ordinary exosomes. Figure 8 (A) This demonstrates the feasibility of using SnoopCatcher / SnoopTag to construct modular engineered exosomes, and shows that it can be easily modularly assembled with any SnoopTag-labeled material (such as nanomaterials, signal probes, targeting peptides, etc.), and the assembled products have good specificity, stability and flexibility.

[0084] Example 5: Verification of N-peptide's ability to efficiently enrich RNA carrying BoxB

[0085] We obtained plasmid (pEnCMV-Il12a(mouse)-3×linker-Il12b(mouse)-SV40-Neo) with catalog number P29435 from Miaoling Biotechnology Co., Ltd., and added a BoxB sequence to the 3′ end of the IL12 (interleukin 12) gene, as shown in SEQ ID NO.5, to construct an IL12 expression plasmid carrying the BoxB tag.

[0086] The plasmid was transfected into ordinary HEK293T cells and HEK293T cells expressing the fusion protein, respectively. After 48 hours, exosomes were extracted from them. The two types of exosomes were added to ordinary HEK293T cells without any treatment and incubated for another 48 hours. They were named the EV+IL12 group and the FP-EV+IL12 group, respectively. Ordinary HEK293T cells without exosome treatment were set as the control group.

[0087] The expression level of IL12 protein in three groups of cells was detected using Western blotting. The results are as follows: Figure 9 As shown, only the FP-EV+IL12 group showed a significant IL12 band, while no significant band signal was observed in the control group and the EV+IL12 group. This indicates that exosomes carrying the N-peptide fusion protein can effectively enrich mRNA containing the BoxB sequence and achieve significant expression in target cells. This demonstrates the effectiveness and specificity of N-peptide / BoxB in exosome-mediated RNA enrichment and expression.

[0088] Sequence:

[0089] SEQ ID NO.1:

[0090] atggcggtggaaggaggaatgaagtgtgtcaagtttttgctctacgttctcctgctggccttctgcgcctgtgcagtgggattgatcgccattggtgtagcggttcaggttgtcttgaagcaggccattacccatgagactactgctggctcgctgttgcctgtggtcatcattgcagtgggtgccttcctcttcctggtggcctttgtgggctgctgtggggcctgcaaggagaactactgtctcatgattacatttgccatcttcctgtctcttatcatgcttgtggaggtggctgtggccattgctggctatgtgtttagagaccaggtgaagtcagagtttaataaaagcttccagcagcagatgcagaattaccttaaagacaacaaaacagccactattttggacaaattgcagaaagaaaataactgctgtggagcttctaactacacagactgggaaaacatccccggcatggccaaggacagagtccccgattcttgctgcatcaacataactgtgggctgtgggaatgatttcaaggaatccactatccatacccagggctgcgtggagactatagcaatatggctaaggaagaacatactgctggtggctgcagcggccctgggcattgcttttgtggaggtcttgggaattatcttctcctgctgtctggtgaagagtattcgaagtggctatgaagtaatgtag

[0091] SEQ ID NO.2:

[0092] ATGAAGCCGCTGCGTGGTGCCGTGTTTAGCCTGCAGAAACAGCATCCCGACTATCCCGATATCTATGGCCGATTGATCAGAATGGGACCTATCAAAATGTGCGTACCGGCGAAGATGGTAAACTGACCTTTAAGAATCTGAGCGATGGCAAATATCGCCTGTTTGAAA ATAGCGAACCCGCTGGCTATAAACCGGTGCAGAATAAGCCGATTGTGGCGTTTCAGATTGTGAATGGCGAAGTGCGTGATGTGACCAGCATTGTGCCGCAGGATATTCCGGCTACATATGAATTTACCAACGGTAAACATTATATCACCAATGAACCGATACCGCCGAAA

[0093] SEQ ID NO.3:

[0094] ATGGATGCTCAGACACGGCGACGAGAGAGAAGAGCTGAAAAGCAGGCCCAGTGGAAAGCAGCCAAC

[0095] SEQ ID NO.4:

[0096] RRKPRRKRR

[0097] SEQ ID NO.5:

[0098] GCCCTGAAAAAGGGC

[0099] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A general method for constructing engineering exosomes based on a bidirectional load module, characterized in that: Includes the following steps: Step S1: Construct a plasmid expression vector containing the gene encoding the fusion protein; The fusion protein comprises: a: a four-transmembrane protein CD63 with a tag protein at its N-terminus; b: a SnoopCatcher inserted into the second extracellular loop of the opened four-transmembrane protein CD63, the SnoopCatcher being connected at both ends by flexible linker peptides and carrying a tag protein at its C-terminus; c: a structural module located at the C-terminus of the four-transmembrane protein CD63, comprising: (i) a polybasic intramembrane anchoring domain; (ii) a flexible linker peptide of 10-20 amino acids in length; and (iii) an N-peptide domain derived from λ phage. The coding gene sequence of the four-transmembrane protein CD63 is shown in SEQ ID NO.1, the coding gene sequence of SnoopCatcher is shown in SEQ ID NO.2, the coding gene of the N-peptide domain derived from λ phage is shown in SEQ ID NO.3, the polybasic intramembrane anchoring domain is composed of arginine, proline and lysine residues, and the amino acid sequence is shown in SEQ ID NO.

4. The N-terminus of the four-transmembrane protein CD63 carries a Flag tag protein, the C-terminus of SnoopCatcher carries a Myc tag protein, and the flexible linker peptide is (Gly4Ser)n, n=2-4; Step S2: The plasmid expression vector is packaged with lentivirus and purified before being introduced into mammalian cells. Mammalian cell lines that stably express the fusion protein are then screened for. Step S3: In the culture medium of the mammalian cell line, bifunctional exosomes with the ability to display SnoopCatcher outside the membrane and enrich RNA inside the membrane are extracted by centrifugation. Outside the exosome membrane, SnoopCatcher forms heteropeptide bonds with functional molecules labeled with corresponding tags to achieve covalent linkage. Inside the exosome membrane, the N-peptide domain enriches target mRNA molecules carrying BoxB sequences.

2. The general engineering exosome construction method based on a bidirectional load module as described in claim 1, characterized in that: In step S2, the mammalian cells include HEK293T cells.

3. The general engineering exosome construction method based on a bidirectional load module as described in claim 2, characterized in that: In step S3, the corresponding tag-labeled functional molecules include fluorescently labeled peptides or gold nanoclusters; the corresponding tag-labeled functional molecules are linked to the drug or protein they are attached to via valine-citrulline acid-sensitive cleavable linker peptides, which spontaneously hydrolyze in a lysosomal environment to achieve controlled release of the delivered substance.

4. A fusion protein, characterized in that: include: a: CD63, a four-transmembrane protein with a tag protein at its N-terminus; b: SnoopCatcher inserted into the second extracellular loop of the open four-transmembrane protein CD63, the SnoopCatcher being connected end-to-end by flexible linker peptides and carrying a tag protein at its C-terminus; c: Structural modules located at the C-terminus of the four-transmembrane protein CD63, including: (i) a polybasic intramembrane anchoring domain; (ii) a flexible linker peptide of 10-20 amino acids in length; and (iii) an N-peptide domain derived from λ phage. The coding gene sequence of the four-transmembrane protein CD63 is shown in SEQ ID NO.1, the coding gene sequence of SnoopCatcher is shown in SEQ ID NO.2, the coding gene of the N-peptide domain derived from λ phage is shown in SEQ ID NO.3, the polybasic intramembrane anchoring domain is composed of arginine, proline and lysine residues, and the amino acid sequence is shown in SEQ ID NO.

4. The N-terminus of the four-transmembrane protein CD63 carries a Flag tag protein, the C-terminus of the Catcher carries a Myc tag protein, and the flexible linker peptide is (Gly4Ser)n, where n=2-4.

5. Plasmid expression vectors, lentiviruses, or universal engineered exosomes constructed using the universal engineered exosome construction method based on bidirectional load modules as described in any one of claims 1-3.

6. The application of plasmid expression vectors, lentiviruses, or universally engineered exosomes constructed based on bidirectional loading modules as described in claim 5 in the preparation of targeted drug delivery, vaccine vectors, or nanomaterial display products.

Images