Aptamer sensor for detecting ochratoxin A based on DNAzyme and CRISPR / Cas12a
Through the aptamer sensor based on the DNAzyme and CRISPR/Cas12a system, the trans cleavage activity of CRISPR/Cas12a is activated by nucleic acid components, solving the specificity and detection limit problems of OTA detection, and achieving fast and accurate quantitative detection.
Patent Information
- Application Number
- CN202510637391.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-08-22
AI Technical Summary
In the detection of ochratoxin A (OTA), the prior art has problems such as insufficient sample specificity and high detection limit, making it difficult to achieve fast and accurate quantitative analysis.
The aptamer sensor based on the DNAzyme and CRISPR/Cas12a system is used to activate the trans cleavage activity of CRISPR/Cas12a in the presence of Mg2+ by nucleic acid elements such as Apt-T complex probe, HPTC complex, and crRNA, and specifically cleave the FQ chain of the fluorescent probe to achieve the generation of fluorescent signals.
It realizes rapid detection of OTA with high specificity and low detection limit (7.05 pg/mL), simplifies the sample pre-processing process, reduces the operation complexity, is low in cost, and is suitable for industrialization.
Smart Images

Figure CN120519554A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of biosensors and relates to the construction of an aptamer sensor for detecting ochratoxin. Background Art
[0002] Mycotoxins, as important biotoxins, have attracted widespread attention due to their widespread presence and serious pollution. Ochratoxins (OTs), a class of secondary metabolites primarily produced by Aspergillus and Penicillium fungi, are structurally diverse and include ochratoxin A (OTA), ochratoxin B (OTB), ochratoxin C (OTC), ochratoxin D (OTD), methylated OTA, and methylated or ethylated OTB. OTA, OTB, and OTC are of particular concern due to their close relevance to human health. OTA, due to its potent toxicity and widespread distribution, is one of the most potent and harmful toxins affecting humans. Studies have shown that this highly toxic toxin exhibits potent immunotoxicity, nephrotoxicity, and even teratogenicity and carcinogenicity, and is now classified as a Class 2B carcinogen by the International Association for the Study of Cancer (IARC). Instrumental methods for detecting mycotoxins, such as spectral analysis, primarily utilize physical analysis to directly analyze samples qualitatively and quantitatively, eliminating the need for complex chemical reactions. These methods are characterized by speed and accuracy. However, instrumental methods primarily focus on the detection of aflatoxins, with relatively few reports on OTA detection. This may be due to the abundance of structural analogs, making instrumental methods incapable of distinguishing them with high specificity. Therefore, the development of simple, rapid, and highly specific detection technologies is of great significance for the prevention and diagnosis of foodborne pathogens.
[0003] Biosensors, with their advantages of high sensitivity, rapid analysis speed, and strong anti-interference capabilities, have received significant attention and experienced rapid development in recent decades. Aptamers are DNA or RNA oligonucleotides isolated from random libraries using the SELEX technique. Aptamers have the advantages of low immunogenicity, ease of large-scale synthesis, low cost, and good physicochemical stability. Therefore, they are widely used in biosensing platforms. Fluorescent biosensors utilize fluorescence technology to generate optical signals through the interaction between a target and a biorecognition element. They are widely used in the biosensing field due to their simplicity, high efficiency, and high analytical sensitivity. Summary of the Invention
[0004] In order to solve the problem of insufficient sample specificity in detecting OTA, the present invention proposes a biosensor for detecting OTA based on fluorescence technology with high specificity and sensitivity, low cost and fast detection speed.
[0005] To achieve the above objectives, the present invention adopts the following technical solutions.
[0006] An aptamer sensor for detecting OTA based on a DNAzyme and CRISPR / Cas12a system, comprising: Apt-T complex probe, DNAzyme chain, HPTC complex, crRNA, Cas12a, Mg 2+ and fluorescent probe FQ chain; The Apt-T composite probe is obtained by hybridization of the aptamer Apt and the T chain; The HPTC complex is obtained by hybridization of HP0, HP1 and HP2, and HP1 and HP2 are hairpin structures; The aptamer Apt, T chain, DNAzyme chain, HP0, HP1, HP2, and crRNA nucleotide sequences are as shown in SEQ ID NOs: 1-7; the 18th position of the DNAzyme is a ribonucleotide; The fluorescent probe FQ chain is a TTATT sequence with a fluorescent group modified at one end and a quenching group modified at the other end. Preferably, the fluorescent group of the FQ chain is FAM and the quenching group is BHQ.
[0007] The preparation method of the HPTC complex comprises the following steps: (1) After heat denaturation of HP1 or HP2 solution at 95°C, immediately quench in an ice bath to form the hairpin structure H1 or H2; (2) The hairpin structure HP1 and HP2 solutions were mixed with the HP0 solution and incubated at 37°C to form a three-chain HPTC complex.
[0008] In step (2), the molar ratio of HP0, HP1 and HP2 is 1:1:1.
[0009] A kit for preparing the above-mentioned aptamer sensor.
[0010] The aptamer sensor and kit can be used to detect ochratoxin A (OTA).
[0011] A method for detecting OTA, comprising the following steps: The test solution or the solution without the target was incubated with the Apt-T composite probe, DNAzyme chain, crRNA, Cas12a, FQ, and HPTC complex in a buffer solution at 37°C, and then the fluorescence was measured.
[0012] The detection principle of the present invention is as follows Figure 1 As shown, the sequences of the nucleic acid elements are as follows: Apt: 5'-GATGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAG-3'; T chain: 5'- TGTCCGATGTT TT TTTACACCCGA -3'; DNAzyme: 5'-CA TCGGGTGTAAA GCGT / rA / GCTTATGCTTTTTGACTCCGAGCCGGACGAACGC AACATCGGA CA -3'; HP0: 5'-AGTCATAGTGCTAGTGCATTATCGTACCTGTGTC-3' HP1: 5'-ACCGTAAT CATCGGGTGTTTTACGCTTTACACCCGATGACCACGGTAGTA CAGTACTAGCACTATGACT-3' HP2: 5'-GACACAGGTACGATAGC TAC AG TACCGTGGTCATCGGGTGTAAAGCGTAAAACACCCGATG -3'; crRNA: 5'-UAA UUU CUA CUA AGU GUA GAU CGC UUU ACA CCC GAU GAA GC-3' FQ: 5′-FAM-TTATT-BHQ-3′.
[0013] The above nucleic acid elements form functional structures such as Apt-T composite probe and HPTC complex through base complementary pairing. The aptamer sensor containing the above functional structures is activated in Mg 2+ The following reactions can occur in the presence of Cas12a protein: In the absence of a target, the Apt-T composite probe is in a stable structure. When a target is present, the reaction system can undergo the following reactions: the Apt chain in the Apt-T composite probe specifically binds to OTA, releasing the T chain; Free T chain in the metal ion Mg 2+ When present, it binds to DNAzyme and activates its cleavage activity, releasing the S chain through self-cleavage (CATCGGGTGTAAAGCGT); The released S chain can induce the opening of HP1 and HP2 on the HPTC complex and form a double chain, which activates the trans-cutting activity of the CRISPR / Cas12a system and non-selectively cuts the FQ chain, thereby generating fluorescence for the purpose of detection.
[0014] The present invention has the following advantages: The biosensor provided by the present invention has a low detection limit, and utilizes the specific recognition of nucleic acid aptamers and the combination of aptamers and OTA to achieve high-specificity detection of the target; the T chain and the padlock probe are brought into proximity with each other and the padlock probe is deformed, thereby releasing the T chain, and the released T chain is then released in the presence of metal ions Mg. 2+ When present, binding to the DNAzyme activates its cleavage activity, releasing the S strand. The released S strand induces HP1 and HP to open and bind to form a double strand, activating the trans-cleavage activity of the CRISPR / Cas12a system and non-selectively cleaving the FQ strand, thereby generating fluorescence for detection. This improves detection sensitivity, enabling ultrasensitive detection of the target OTA, with a detection limit of 7.05 pg / mL. The sensor's simple construction effectively avoids tedious sample pretreatment, offering advantages such as ease of operation, fast reaction speed, and stable performance. The main detection steps are carried out in a homogeneous phase, increasing reaction speed and reducing operational complexity, enabling rapid, simple, and sensitive detection of the target. The biosensor's low-cost manufacturing process makes it suitable for industrial applications. With its advantages of fast detection speed, simple operation, low cost, low detection limit, and high specificity, this sensor can overcome the shortcomings of existing OTA detection methods and achieve rapid and accurate quantitative detection of OTA. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 The schematic diagram of the experiment. Figure 2 This is the feasibility test result diagram of the sensor; Figure 3 Optimize the test result graph for reaction time; Figure 4 This is a graph showing the results of HPTC concentration optimization testing; Figure 5 This is a graph showing the specific detection results of the biosensor for detecting OTA; Figure 6 The fluorescence detection results of the biosensor for different concentrations of OTA. DETAILED DESCRIPTION
[0016] The present invention will be further described below with reference to the embodiments and accompanying drawings, but the present invention is not limited to the following embodiments.
[0017] Example 1 Construction of biosensor The aptamers Apt, T strand, HP0, HP1, HP2, crRNA, and FQ (FAM-TTATT-BHQ) were commercially synthesized according to SEQ ID NOs: 1-7.
[0018] (1) Preparation of Apt-T composite probe Equal volumes of 10 μM Apt and 10 μM T chain were incubated in Tris-HCl buffer (50 mM Tris, 0.5 M NaCl, 100 mM KCl) at 95°C for 5 min, cooled naturally to room temperature to form Apt-T composite probe (10 μM), and stored at 4°C until use.
[0019] (2) Preparation of HPTC complex (i) HP1 and HP2 solutions were added to NEBuffer 2.1 (working concentration: 10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl2, 100 μg / mL recombinant albumin, pH = 7.9) and distilled water, respectively. The mixture was heated in a 95°C water bath for 5 min and then immediately placed in an ice bath for 30 min to complete quenching. (ii) After quenching, the hairpins HP1 (5 μL, 10 mM) and HP2 (5 μL, 10 mM) were mixed with HP0 (5 μL, 10 mM). NEBuffer 2.1 (5 μL) was added and the mixture was incubated in a 95°C water bath for 5 min. The mixture was then cooled slowly to room temperature to form an HP0-HP1-HP2 triplex complex (HPTC) structure and stored at 4°C until use.
[0020] (3) Construction of biosensors A 5 μL OTA solution with a concentration of 100 ng / mL was mixed with an Apt-T complex probe (5 μL, 10 mM), DNAzyme (5 μL, 10 mM), crRNA (5 μL, 10 mM), Cas12a (5 μL, 100 nM), FQ (1 μL, 1 μM), 5 μL 10×NEBuffer, and 5 μL HPTC complex solution. The solution was incubated in a metal bath at 37°C in the dark for 90 min. The fluorescence signal of OTA with a final concentration of 1 mM was measured using a fluorescence spectrophotometer. The detection parameters were: excitation wavelength 485 nm, emission wavelength range 500-650 nm. The results are shown in Figure 2. Figure 2 As shown in the figure, compared with the control, a significant fluorescence enhancement was observed in the corresponding solution after adding OTA. This indicates that the fluorescence increase can be detected near 525 nm using a fluorescence spectrophotometer, and the constructed biosensor can be used for the detection of OTA.
[0021] Example 2 Effect of reaction time on the analytical performance of fluorescence sensor Take the Apt-T composite probe and HPTC complex prepared in Example 1, and then determine the optimal reaction time according to the following steps: A biosensor was constructed according to the method in Example 1, and the reaction system was reacted for 15 min, 30 min, 45 min, 60 min, 90 min, and 120 min, respectively, and the fluorescence intensity was measured under the same other conditions.
[0022] The results are as follows Figure 3 As shown in the figure: with the increase of time, the fluorescence intensity gradually increases, and the fluorescence reaches an equilibrium state at 90 minutes and no longer changes. Therefore, 90 minutes is selected as the optimal reaction time of the system.
[0023] Example 3 Effect of HPTC concentration on the analytical performance of the fluorescence sensor Take the Apt-T composite probe and HPTC complex prepared in Example 1, and then determine the optimal HPTC concentration according to the following steps: The biosensor was constructed according to the method in Example 1, and the HPTC concentrations in the reaction system were set to 1 μM, 2 μM, 4 μM, 6 μM, 8 μM, 10 μM, and 15 μM, respectively, and then the fluorescence intensity was measured.
[0024] The results are as follows Figure 4 As shown in the figure, the fluorescence intensity increases with the increase of HPTC concentration, and the two are positively correlated. When the HPTC concentration reaches 1 μM, the absorbance reaches the maximum value, so the HPTC concentration of 1 μM is regarded as the optimal concentration of the reaction.
[0025] Example 4 Specificity of Sensor Take the Apt-T composite probe and HPTC complex prepared in Example 1, and then determine the specificity of the detection according to the following steps: A biosensor was constructed according to the method in Example 1. While ensuring that other experimental conditions were consistent, 100 ng / mL of non-target substances (zearalenone, ochratoxin B, ochratoxin C, aflatoxin B1, and mixed samples) were used instead of 10 ng / mL OTA. Positive samples and blank samples were also set up for fluorescence intensity measurement.
[0026] The results are as follows Figure 5 As shown in the figure, only the mixed sample and the positive sample have high fluorescence intensity, while the other samples show relatively low fluorescence. This shows that the fluorescence sensing technology can specifically identify OTA and generate a significant fluorescence signal, indicating that the sensor has good specificity.
[0027] Example 5 Detection limit of sensor The Apt-T composite probe and HPTC complex prepared in Example 1 were used to determine the detection limit of the fluorescence sensor according to the following steps: A biosensor was constructed according to the method in Example 1. While ensuring that other experimental conditions were consistent, the final concentrations of OTA were 0 pg / mL, 0.005 ng / mL, 0.01 ng / mL, 0.05 ng / mL, 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, 3 ng / mL, 5 ng / mL, and 10 ng / mL, and the fluorescence intensity was measured.
[0028] The results are as follows Figure 6 As shown, the fluorescence intensity at 525 nm gradually increased with increasing OTA concentration from 0 ng / mL to 10 ng / mL, demonstrating that the prepared fluorescent biosensor is sensitive to changes in OTA concentration. Within the OTA concentration range of 0 ng / mL to 10 ng / mL, the logarithm of the concentration and the fluorescence intensity exhibited a good linear relationship. The limit of detection (LOD) was calculated to be 7.05 pg / mL based on the 3σ principle of the blank response.
Claims
1. An aptamer sensor for detecting OTA based on DNAzyme and CRISPR / Cas12a system, characterized in that: include: Apt-T complex probe, DNAzyme chain, HPTC complex, crRNA, Cas12a, Mg 2+ and fluorescent probe FQ chain; The Apt-T composite probe is obtained by hybridization of the aptamer Apt and the T chain; The HPTC complex is obtained by hybridization of HP0, HP1 and HP2, and HP1 and HP2 are hairpin structures; The aptamer Apt, T chain, DNAzyme chain, HP0, HP1, HP2, and crRNA nucleotide sequences are as shown in SEQ ID NOs: 1-7; the 18th position of the DNAzyme is a ribonucleotide; The fluorescent probe FQ chain is a TTATT sequence with a fluorescent group modified at one end and a quenching group modified at the other end.
2. The aptamer sensor according to claim 1, wherein The fluorescent group of the FQ chain is FAM, and the quenching group is BHQ.
3. The aptamer sensor according to claim 1, wherein The preparation method of the HPTC complex comprises the following steps: (1) After heat denaturation of HP1 or HP2 solution at 95°C, immediately quench in an ice bath to form the hairpin structure H1 or H2; (2) The hairpin structure HP1 and HP2 solutions were mixed with the HP0 solution, heat denatured at 95°C, and naturally cooled to room temperature to form a three-chain HPTC complex.
4. The aptamer sensor according to claim 3, characterized in that In step (2), the molar ratio of HP0, HP1 and HP2 is 1:1:
1.
5. A kit comprising the aptamer sensor according to any one of claims 1 to 4.
6. Use of the aptamer sensor according to any one of claims 1 to 4 or the kit according to claim 5 in detecting ochratoxin A.
7. A method for detecting OTA, characterized in that: The following steps are involved: The test solution or the target-free solution was incubated with the Apt-T composite probe, DNAzyme chain, crRNA, Cas12a, FQ, and HPTC complex in a buffer solution at 37°C, and then fluorescence was measured; The Apt-T composite probe is obtained by hybridization of the aptamer Apt and the T chain; The HPTC complex is obtained by hybridization of HP0, HP1 and HP2, and HP1 and HP2 are hairpin structures; The aptamer Apt, T chain, DNAzyme chain, HP0, HP1, HP2, and crRNA nucleotide sequences are as shown in SEQ ID NOs: 1-7; the 18th position of the DNAzyme is a ribonucleotide; The nucleotide sequence of the fluorescent probe FQ chain is TTATT, and one end is modified with a fluorescent group FAM and the other end is modified with a quenching group BHQ.