A probe system and method for detecting testicular germ cell tumor miRNA based on PER-driven Split G4 / ThT cascade
Through the PER-driven Split G4/ThT cascade detection system, using dumbbell-shaped probes and G-tetramer fluorescence signal conversion, the problems of low sensitivity and high false positives in testicular germ cell tumor miRNA detection were solved, and efficient and low-cost rapid detection was achieved.
Patent Information
- Application Number
- CN202511013601.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-23
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2045-07-23
AI Technical Summary
Existing RNA detection methods in the diagnosis of testicular germ cell tumors have problems such as cumbersome operation, low sensitivity, high false positive rate and high cost, making it difficult to achieve rapid, non-destructive and efficient detection.
A PER-driven Split G4/ThT cascade detection system was designed. Utilizing the dumbbell-shaped probe HP-371a-3p and the PG probe, a primer exchange reaction (PER) and G-tetramer (G4) fluorescence signal conversion were used to achieve high-sensitivity, low-background detection of testicular germ cell tumor miRNA.
It achieves high-sensitivity and high-specificity detection of testicular germ cell tumor miRNA, reduces detection costs, simplifies operation procedures, and improves the timeliness and accuracy of detection.
Smart Images

Figure CN120519585B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological analysis and detection, and particularly relates to a probe system and method for detecting testicular germ cell tumor miRNA based on PER-driven Split G4 / ThT cascade. Background Art
[0002] Germ cell tumors (GCTs) refer to a group of tumors formed by primitive multipotent germ cells during differentiation, maturation, and migration. They mainly occur in the gonads (testes and ovaries), but can also occur in the anterior mediastinum, pineal gland, and brain. In 2016, the World Health Organization divided GCTs into germ cell tumors and non-germ cell germ cell tumors. Germ cell tumors can be further divided into seminomas originating from testicular primordial germ cells and dysgerminomas originating from ovarian primordial germ cells. In clinical practice, testicular germ cell tumors (TGCTs) are mainly diagnosed by imaging examinations, such as: (1) Ultrasound examination, which is mainly used for initial screening and can distinguish between internal and external testicular lesions and identify orchitis, hematoma, etc.; (2) Abdominal / pelvic CT, which can evaluate retroperitoneal lymph node metastasis and accurately measure the size of metastatic lesions, thereby guiding surgical decisions after chemotherapy; (3) Chest CT and brain MRI, which are mainly used for brain metastasis screening and are suitable for patients with β-hCG >5000 IU / L or neurological symptoms. Imaging studies can provide anatomical features such as the exact location and severity of the lesion. However, they lack pathological information, have a certain lag in test results, and lack sufficient resolution in human tissue structures, making them insufficient for the early diagnosis of TGCTs. A biopsy is the gold standard for diagnosing testicular germ cell tumors, but the complex anatomical structure of some TGCTs makes surgical resection difficult.
[0003] With the rapid development and continuous cross-fertilization of oncology, biochemistry, and nanomedicine, nanodiagnostic and therapeutic strategies based on tumor marker activation, as a new concept, offer novel insights and approaches for the development of novel cancer diagnostic and therapeutic technologies. Tumor markers are substances present in tumor cells themselves or produced by their abnormal expression. They are often found in serum, cells, urine, body fluids, or tissues. Changes in their levels can be used for tumor diagnosis, therapeutic efficacy assessment, and recurrence and prognosis assessment. RNA markers more dynamically reflect cellular states and regulatory processes than DNA markers, providing reliable genetic early warning for tumors. Furthermore, the diverse array of RNA species can provide richer information for in situ, real-time, and non-invasive genetic molecular diagnosis of tumors. Therefore, RNA has garnered increasing attention and recognition as a novel tumor marker in the field of cancer diagnosis and treatment. MicroRNA (miRNA) is a class of small RNA fragments approximately 19-25 nt in length, classified as endogenous single-stranded small molecules. Research has shown that miRNAs are involved in important biological processes such as cell proliferation and differentiation, apoptosis, stem cell regulation, and tumorigenesis. Disturbances in miRNA expression are a key factor in the development of TGCTs. Therefore, using abnormal miRNA levels in tissues and semen as a new biomarker for the diagnosis of TGCTs is expected to achieve non-invasive diagnosis of testicular germ tumors through liquid biopsy technology, and its detection results are more clinically guiding than traditional diagnostic methods.
[0004] Traditional RNA analysis and detection methods primarily include Northern blotting, ribonuclease protection assay (RPA), reverse transcription polymerase chain reaction (RT-PCR), and fluorescence quantify polymerase chain reaction (FQ-PCR). These methods have played an important role in the analysis and detection of RNA tumor markers, but they still face several challenges. For example, Northern blotting is the gold standard and most widely used method for RNA detection, but it is cumbersome, time-consuming, and has low sensitivity, making it unsuitable for detecting low-molecular-weight RNA. RPA offers high sensitivity but requires radionuclide labeling, which poses challenges in nuclear decay, autoradiolysis, and maintaining biological activity during the procedure, as well as safety precautions. Nucleic acid amplification methods such as RT-PCR and FQ-PCR have become routine and reliable techniques for RNA detection due to their wide dynamic range, high sensitivity, and strong sequence specificity. While they can theoretically amplify single RNA target molecules millions of times, they are highly susceptible to contamination during the procedure, resulting in false-positive signals. Therefore, developing new methods for rapid and non-destructive diagnosis and monitoring of RNA germ cell tumor markers to ensure the timeliness and accuracy of germ cell tumor diagnosis and treatment is of great significance for improving the cure rate of germ cell tumor patients and reducing the economic burden on patients' families.
[0005] DNA nanotechnology utilizes the molecular properties of deoxyribonucleic acid (DNA) or other nucleic acids, such as self-assembly, to construct manipulable two- or three-dimensional structures. Through sequence design, linear DNA molecules can spontaneously hybridize, twist, splice, and fold to form a variety of two- or three-dimensional geometric structures with a high degree of order, controllability, addressability, and stability. Since Nadrian Seeman first described the concept of DNA nanotechnology in the early 1980s, DNA nanotechnology has made significant progress in the directed assembly of highly complex nanostructures, as well as in the assembly of DNA structures and functional DNA structures. Due to its excellent biocompatibility, ease of modification, and excellent nucleic acid stability, DNA nanostructures have been used in a wide range of fields, including molecular detection, biosensing, disease diagnosis, cancer treatment, DNA molecular manipulation, molecular machines, and DNA molecular computers.
[0006] Primer Exchange Reaction (PER) is an isothermal nucleic acid amplification technology based on the catalysis of DNA polymerase. Its core principle is to use specific primers to guide DNA polymerase to extend along the template chain, trigger primer exchange through reactions such as enzyme cleavage, and thus achieve chain amplification. PER does not require a high-temperature deformation step and can be performed under isothermal conditions. It is easy to operate and has the advantages of high sensitivity and strong specificity. It has broad application prospects in the field of rapid nucleic acid detection. G-quadruplex (G4) is a special nucleic acid secondary structure composed of a guanine (G)-rich DNA sequence through specific hydrogen bonds at K + , Pb 2+ or NH 2+ G4 folds into parallel or antiparallel quadruplex structures in a volatile environment. The interaction between G4 and thioflavin (ThT) is a paradigm of structure-specific fluorescent switching. Its rapid response, label-free nature, and conformational selectivity make it a core element for ultrasensitive detection of cancer biomarkers such as miRNAs. Summary of the Invention
[0007] To address the above technical problems, this protocol provides a probe system and method for detecting testicular germ cell tumor miRNAs based on the PER-driven Split G4 / ThT cascade. This probe system is simple in design, highly sensitive, and highly specific. Through a programmed cascade reaction, it can achieve more efficient and rapid detection of miRNAs in TGCTs patients. The dumbbell probe HP-371a-3p designed in this protocol can self-close to eliminate background, achieve exponential signal gain through PER cyclic amplification, and trigger the conformational transition of the PG probe with the help of competitive displacement to form a DNA G-tetramer. Ultimately, the specific embedding of ThT molecules activates fluorescence to achieve label-free, low-background, and highly specific target detection.
[0008] To achieve the above objectives, this protocol first provides a probe system for detecting testicular germ cell tumor miRNA based on PER-driven Split G4 / ThT cascade, which includes a dumbbell-shaped probe HP-371a-3p, Bst DNA polymerase, PG probe, primer Primer, K + In the presence of target miR-371a-3p, target miR-371a-3p specifically binds to the dumbbell-shaped probe HP-371a-3p, and the signal is amplified by the primer exchange reaction cascade, thereby achieving the detection of target miR-371a-3p.
[0009] The PG probe is self-assembled by P1-G probe, P2-C probe, G4-a probe and G4-b probe;
[0010] The sequence of the dumbbell-shaped probe HP-371a-3p is shown in SEQ ID NO. 1;
[0011] The sequence of the P1-G probe is shown in SEQ ID NO. 2;
[0012] The sequence of the P2-C probe is shown in SEQ ID NO. 3;
[0013] The sequence of the G4-a probe is shown in SEQ ID NO. 4;
[0014] The sequence of the G4-b probe is shown in SEQ ID NO. 5;
[0015] The sequence of the target miR-371a-3p is shown in SEQ ID NO. 6;
[0016] The sequence of the primer is shown in SEQ ID NO. 18.
[0017] Based on a general inventive concept, this solution also provides a method for detecting testicular germ cell tumor miRNA using a probe system for non-diagnostic purposes, comprising the following steps:
[0018] S1. Nucleic acid probe pretreatment: Prepare the synthesized P1-G, P2-C, G4-a, G4-b probes and dumbbell-shaped probe HP-371a-3p lyophilized powder into 100 μM stock solutions with DEPC water and store at 4°C until use.
[0019] S2. Annealing of the dumbbell-shaped probe HP-371a-3p: Anneal the dumbbell-shaped probe HP-371a-3p at 95°C for 5 min and then slowly cool it to room temperature to allow it to self-assemble into a dumbbell-shaped structure through complementary base pairing. Store it in a refrigerator at 4°C until use.
[0020] S3. Target miRNA activation PER reaction: The miRNA to be tested, primer, and 1 µM dumbbell probe HP-371a-3p were incubated in pH 7.4 PBS buffer at 37°C for 30 min. Then, under the action of Bst DNA polymerase and strand displacement, the reaction raw materials dATP, dTTP, dCTP, and 1× Bst Reaction Buffer were added. The reaction was incubated at 65°C for 60 min, and finally, the enzyme was inactivated by incubation at 80°C for 2 min.
[0021] S4, PG probe assembly and PER product-induced conformational change: Probes P1-G, P2-C, G4-a, and G4-b were added to PBS buffer at a molar ratio of 1:1:1:1 and mixed evenly. After annealing at 95°C for 5 min, they were slowly cooled to room temperature to allow them to self-assemble into PG probes through base complementary pairing. The PG probes were then added to the system prepared in S3 and co-incubated.
[0022] S5. G-tetramer structure formation and ThT signal activation and fluorescence detection: 20 µM Thioflavin T was added to the system prepared in S4, and the reaction was carried out in PBS buffer. The fluorescence spectrum was collected using an RF-6000 fluorescence spectrophotometer.
[0023] Preferably, the pH of the 1× Bst Reaction Buffer in S3 is 8.8, and it contains 20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, and 0.1% Triton X-100.
[0024] Preferably, the pH of the PBS buffer in S4 is 7.4.
[0025] Preferably, the co-incubation temperature in S4 is 37° C., and the co-incubation time is 30 min.
[0026] Preferably, the pH of the PBS buffer in S5 is 7.4 and contains 50 mM KCl.
[0027] Preferably, the reaction temperature in S5 is 37° C. and the reaction time is 30 min.
[0028] Preferably, the fluorescence spectrophotometer in S5 is set to have an excitation wavelength Ex=450 nm and an emission wavelength Em between 465 nm and 600 nm.
[0029] The mechanism of miRNA detection provided by this protocol is as follows:
[0030] This protocol first designed a dumbbell-shaped DNA probe (HP-371a-3p) containing a target recognition region H1 (5' to 3': ACACTCAAAAGATGGCGGCACTT), a blocking sequence a (5' to 3': TAGCTTATC), and the PER template b H2 b*a* (5' to 3': AGAGTGATGTTGACCCTTTTGGGTCAACATCACTCTGATAAGCTA). In the absence of target, the blocking sequence a complements the primer-binding sequence a* (5' to 3': GATAAGCTA) to form an a*-stabilized hairpin structure a*H1 a (5' to 3': GATAAGCTAACACTCAAAAGATGGCGGCACTTTAGCTTATC), which blocks primer binding to the template. In the presence of target, recognition of the miRNA and H1 sequence unfolds the hairpin structure (a*H1 a), exposing the primer-binding sequence (a*). Then, under the action of Bst DNA polymerase and chain displacement, the primer Primer (5' to 3': TAGCTTATC) is extended along the template to the stop point. After the extension is terminated, the extension primer ab (5' to 3': TAGCTTTATCAGAGTGATGTTGACCC) is separated from the template due to branch migration, and then the template is released to the next cycle, achieving a cascade amplification effect. Finally, a large amount of single-stranded DNA (ab) is produced. The large amount of single-stranded DNA (ab) produced by PER can form base complementary pairing with the sticky end of the P2-C sequence in the PG probe pre-assembled by DNA self-assembly, further competing it off to form a P2-PER product complex. At this time, the middle of the PG probe is in a single-stranded state, and Ga and Gb can be in K + When it is present, it forms a DNA tetramer structure. When there is a ThT signal molecule, it can be embedded in the DNA tetramer structure (5' to 3': GGGTTAGGGTTAGGGTTAGGG), thereby generating a strong fluorescent signal, achieving highly sensitive, highly specific, and low background detection of the target miRNA.
[0031] The key technologies of this probe system detection are:
[0032] (1) Unique dumbbell-shaped DNA probe (HP-371a-3p): The core structure contains the target recognition region (H1), the blocking sequence (a), and the PER template (b H2 b*a*); self-sealing mechanism (background suppression): In the absence of target, the blocking sequence (a) and the primer binding sequence (a*) complement each other to form a stable hairpin structure (a*H1 a). This structure physically hinders the binding of the primer to the primer binding site (a*) on the template, effectively reducing the background signal.
[0033] (2) Target-triggered conformational transition (signal on): When the target miRNA is present, it specifically binds to the H1 sequence on the probe. This binding destroys the original hairpin structure (a*H1 a), causing the probe to unfold. After unfolding, the originally blocked primer binding sequence (a*) is exposed.
[0034] (3) Primer exchange reaction (PER) cascade signal amplification: The exposed a* allows primer binding. Under the action of Bst DNA polymerase (with strand displacement activity), the primer extends along the PER template (b H2 b*a*), and the extension terminates at the stop point designed by the template; the extension product (ab) separates from the template through the branch migration mechanism; the separated template is released and can cyclically bind to new primers for the next round of extension reaction. This process realizes cascade amplification, ultimately producing a large amount of single-stranded DNA products (ab).
[0035] (4) G-tetramer (G4) fluorescence signal conversion and readout:
[0036] Pre-assembly of PG probes: pre-designed and self-assembled to form a structure (PG probe) containing a P2-C sequence with sticky ends;
[0037] Competitive displacement of PER products: A large number of single-stranded products (ab) produced by PER undergo base complementary pairing with the sticky ends of the P2-C sequence on the PG probe;
[0038] Structural conversion: This pairing competitively displaces the P2-C sequence from the PG probe, forming a P2-PER product complex. The displacement causes the middle portion of the PG probe to become single-stranded.
[0039] G-tetramer formation: The PG probe portion in the single-stranded state contains G-rich sequences (Ga and Gb). + In the presence of , this portion of the G-rich sequence folds to form an intermolecular DNA G-tetramer (G4) structure;
[0040] Fluorescence signal generation: When the fluorescent dye ThT is added, the ThT molecules specifically integrate into the resulting G-tetramer structure. This integration significantly enhances the fluorescence intensity of the ThT, generating a strong, detectable fluorescent signal. This signal intensity correlates with the amount of the initial target miRNA.
[0041] The high sensitivity and specificity of the probe system in this solution are reflected in:
[0042] (1) High sensitivity: PER cascade amplification produces a large number of ab products, significantly amplifying the initial miRNA binding event;
[0043] (2) High specificity: The entire detection process is initiated by the specific hybridization of miRNA and H1 sequence.
[0044] Compared with the prior art, the present invention has the following beneficial effects:
[0045] (1) This scheme innovatively utilizes the PER isothermal nucleic acid amplification technology initiated by the target miRNA and the programmed spilt-G4-ThT specific fluorescence "lighting" characteristics induced by its product to construct an "interlocked" DNA nanodevice that can programmatically respond to testicular germ cell tumor miRNA biomarkers. Through the specific recognition of the target and the programmed "unlocking" initiated by the PER product, the spilt-G4-ThT signal cascade in the nanodevice is induced to start, thereby achieving high sensitivity and high specificity in the "user-defined" manner. Accurate detection and rapid detection of miRNA markers in testicular germ cell tumors, in order to obtain "effective information" of the "invisible manifestations" in the early development of testicular germ cell tumors, and provide new technical methods and important information for the accurate diagnosis, prognosis monitoring and drug design of testicular germ cell tumors.
[0046] (2) This approach overcomes the limitations of traditional miRNA detection technology, such as complex operation, expensive equipment, and high learning costs, and utilizes the advantages of DNA nanotechnology, such as directional, controllable assembly, and easy functional integration.
[0047] (3) The probes in this scheme have the advantages of high sensitivity and high specificity, low background and low cost. The low background is reflected in: the self-closed hairpin structure (a*H1 a) of the initial probe effectively prevents nonspecific primer binding and extension; the G4-ThT system itself also has low background fluorescence; the low cost is reflected in: signal generation depends on the target-activated PER reaction and nucleic acid self-assembly, and there is no need to label the probe or target with expensive fluorescent / quenching groups, which reduces costs. BRIEF DESCRIPTION OF THE DRAWINGS
[0048] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0049] Figure 1 Schematic diagram of the experimental principle in Example 1;
[0050] Figure 2 The electrophoresis verification probe assembly and target activation feasibility analysis in Example 2;
[0051] Figure 3The feasibility analysis of the PER cycle verified by electrophoresis in Example 3 is as follows;
[0052] Figure 4 This is the G4-ThT fluorescence specificity analysis in Example 4;
[0053] Figure 5 This is the feasibility analysis of the PER-PG system and target response fluorescence in Example 5;
[0054] Figure 6 This is a specific analysis of the PER-PG system and target response in Example 6. DETAILED DESCRIPTION
[0055] In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.
[0056] The following examples are provided to illustrate the present invention but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.
[0057] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; unless otherwise specified, the reagents used in the examples are commercially available.
[0058] The probes involved in the present invention were purchased from Shanghai Sangon Biotechnology Co., Ltd., as shown in Table 1:
[0059]
[0060] Example 1: Detection of testicular germ cell tumor miRNA based on PER-driven Split G4 / ThT cascade
[0061] (1) Nucleic acid probe pretreatment: Use DEPC water to prepare the synthesized P1-G, P2-C, G4-a, G4-b probes, dumbbell-shaped probe HP-371a-3p, and primer freeze-dried powder into 100 μM stock solutions and store them at 4°C for later use.
[0062] (2) Annealing of the dumbbell-shaped probe HP-371a-3p: Anneal the dumbbell-shaped probe HP-371a-3p at 95 °C for 5 min and then slowly cool it to room temperature to allow it to self-assemble into a dumbbell-shaped structure through base complementary pairing. The probe was then stored in a refrigerator at 4 °C for later use.
[0063] (3) Target miRNA activates PER reaction: First, the target miRNA, primer, and 1 μM dumbbell probe HP-371a-3p were incubated in pH 7.4 PBS buffer at 37°C for 30 min. If the target miRNA is miR-371a-3p, miR-371a-3p will recognize the H1 sequence of the dumbbell probe HP-371a-3p and unfold the hairpin structure (a*H1 a), thereby exposing the primer binding sequence (a*). Then, under the action of Bst DNA polymerase and chain displacement, the reaction raw materials dATP, dTTP, dCTP and 1× Bst Reaction Buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mMKCl, 2 mM MgSO4, 0.1% Triton X-100) were added, and the primer was extended along the template to the stop point. The reaction was carried out at 65°C for 60 min. After extension is terminated, the extension primer (ab) separates from the template due to branch migration, and the template is released to the next cycle, achieving a cascade amplification effect. Finally, a large amount of single-stranded DNA (ab) is produced. Finally, the enzyme is inactivated by incubation at 80°C for 2 minutes.
[0064] (4) PG probe assembly and PER product-induced conformational change: The probes P1-G, P2-C, G4-a, and G4-b were added to pH 7.4 PBS buffer at a molar ratio of 1:1:1:1 and mixed evenly. After annealing at 95 °C for 5 min, they were slowly cooled to room temperature to allow them to self-assemble into PG probes through base complementary pairing. The PER product in (3) was co-incubated with the PG probe at 37 °C for 30 min. The PER product could undergo base complementary pairing with the sticky end of the P2-C sequence in the PG probe, further competing it off to form a P2-PER product complex. At this time, the middle of the PG probe was in a single-stranded state, and Ga and Gb could be in K + When present, a DNA tetramer structure is formed, which is then used for downstream signal activation. The feasibility of the assembly and the feasibility of the competitive reaction between the P2 sequence in the PG probe and the PER product are verified by polyacrylamide gel electrophoresis and fluorescence.
[0065] (5) G-tetramer structure formation and ThT signal activation and fluorescence detection: 20 μM ThT was added to the above (4) and reacted at 37 °C in PBS buffer (pH 7.4, 50 mM KCl) for 30 min. The fluorescence spectrum of the target miRNA-activated PER-PG-ThT reaction was collected using an RF-6000 fluorescence spectrophotometer, with the excitation wavelength Ex = 450 nm and the emission wavelength Em = 465-600 nm.
[0066] The detection principle is as follows Figure 1 shown.
[0067] Example 2, PG probe assembly and feasibility analysis of PG activation by PER products:
[0068] 12% polyacrylamide gel electrophoresis (PAGE) was used to investigate the feasibility of PG probe assembly and PER product activation of PG probe, such as Figure 2 As shown, lane 1 is a DNA marker, lane 2 is G4-a+P1-G, lane 3 is G4-b+P1-G, lane 4 is P1-G+P2-C, lane 5 is G4-a+P1-G+G4-b, lane 6 is G4-a+P1-G+P2-C, lane 7 is G4-b+P1-G+P2-C, and lane 8 is a PG probe (G4-a+P1-G+P2-C+G4-b). With the addition of DNA complementary sequences, the PG probe can be successfully assembled. Lane 9 shows the P2-C + PER product, and lane 10 shows the electrophoretic bands after the PG probe is added to the PER product (G4-a + P1-G + P2-C + G4-b + PER product). This shows the presence of the PG probe in the system (compare to lane 8). The PER product can compete with the PG probe to form the P2-C + PER product probe, which corresponds to the result in lane 9 (P2-C + PER product). In addition, the G4-a + P1-G + G4-b assembly structure remains in the system, which corresponds to the result in lane 5. The electrophoresis results demonstrate that the PG probe designed in this scheme can be successfully assembled and respond to the PER product.
[0069] Example 3, PER reaction feasibility analysis:
[0070] 12% PAGE was used to confirm the feasibility of PER: Figure 3 As shown, lane 1 is a DNA marker, lane 2 is G4-a+P1-G+G4-b, and lane 3 is a PG probe (G4-a+P1-G+P2-C+G4-b); lane 4 is the result of co-incubation of the PG probe with the PER product (purchased DNA sequence for verification), lane 5 is the result of co-incubation of the PG probe with the PER system probe in the absence of the target (G4-a+P1-G+P2-C+G4-b+PER-P without target), and lane 6 is the experimental group, that is, the result after the PER system reacted with the PG probe in the presence of the target miRNA (G4-a+P1-G+P2-C+G4-b+PER-P+target). The electrophoresis results are consistent with the phenomenon in lane 4, indicating that the PER reaction can be activated when the target is present, and this design is feasible.
[0071] Example 4: Feasibility of PER reaction initiated by target miRNA:
[0072] The feasibility of the PER reaction initiated by the target miRNA was investigated using a fluorescence spectrophotometer. The target miRNA was used to initiate PER, and then the PER product activated the PG probe to undergo a competitive reaction. After forming a DNA G-tetramer, the fluorescence of the interaction with ThT was significantly enhanced. This led to the construction of a label-free fluorescence signal output mode (G-Quadruplex-ThT) in which G-Quadruplex "lits up" ThT. First, the binding specificity of ThT and G-tetramer was verified. The results are as follows: Figure 4 As shown in the figure, the fluorescence of ThT is significantly enhanced only in the G-tetramer state, while incubation of ThT with the control group sequences A21 (SEQ ID NO.7), T21 (SEQ ID NO.8), C21 (SEQ ID NO.9), G21 (SEQ ID NO.10), and R21 (SEQ ID NO.11) only shows a weak background signal, indicating that ThT has G-tetramer enhancement specificity.
[0073] Example 5: Feasibility analysis of target activation system:
[0074] Verify the feasibility of the target activation system, the results are as follows Figure 5 As shown in the results, free ThT has almost no fluorescence. When the target is not present, there is a certain background signal after incubation of the PG probe and PER probe system. This result is basically consistent with the independent PG probe system, indicating that the PER reaction cannot be activated in the absence of the target, thereby failing to initiate the chain displacement reaction of the PG probe and the fluorescence enhancement of the cleaved G tetramer. When the target is present, the fluorescence signal is significantly enhanced. This result is basically consistent with the results of the positive control experiment (ThT+G4), indicating that the presence of the target can activate the PER reaction and further initiate the chain displacement reaction of the PG probe, thereby forming an intermolecular DNA G-tetramer, which generates a strong fluorescence signal after binding to ThT, indicating that the PER-PG probe system can be used for the analysis and detection of target miRNA.
[0075] Example 6, PER-PG system specificity analysis:
[0076] Fluorescence spectrophotometry was used to investigate the specificity of the PER-PG system for the target miR-371a-3p. MiR-200b (SEQ ID NO. 12), miR-155 (SEQ ID NO. 13), and miR-24 (SEQ ID NO. 14), which are highly expressed in tumor patients, were selected as controls. MiR-21 with different base mismatches: single-base mismatch SmiR-21 (SEQ ID NO. 15), double-base mismatch DmiR-21 (SEQ ID NO. 16), and triple-base mismatch TmiR-21 (SEQ ID NO. 17), as well as a PG blank probe were used as controls. The results are shown in Figure 2. Figure 6 As shown, when the target miR-371a-3p was present, the fluorescence intensity of the PER-PG detection system was significantly higher than that of the control group, indicating that the probe had good selectivity and specificity for the target miR-371a-3p.
[0077] The above is only a preferred embodiment of the present invention, and the scope of protection of the present invention is not limited to the above embodiment. For those skilled in the art, improvements and modifications obtained without departing from the technical concept of the present invention should also be considered as the scope of protection of the present invention.
Claims
1. A probe system for detecting testicular germ cell tumor miRNA based on PER-driven Split G4 / ThT cascade, characterized in that: The probe system includes dumbbell-shaped probe HP-371a-3p, Bst DNA polymerase, PG probe, primer Primer, K + In the presence of target miR-371a-3p, target miR-371a-3p specifically binds to the dumbbell-shaped probe HP-371a-3p, and the signal is amplified by the primer exchange reaction cascade, thereby achieving the detection of target miR-371a-3p. The PG probe is self-assembled by P1-G probe, P2-C probe, G4-a probe and G4-b probe; The sequence of the dumbbell-shaped probe HP-371a-3p is shown in SEQ ID NO. 1; The sequence of the P1-G probe is shown in SEQ ID NO. 2; The sequence of the P2-C probe is shown in SEQ ID NO. 3; The sequence of the G4-a probe is shown in SEQ ID NO. 4; The sequence of the G4-b probe is shown in SEQ ID NO. 5; The sequence of the target miR-371a-3p is shown in SEQ ID NO. 6; The sequence of the primer is TAGCTTATC.
Citation Information
Patent Citations
Fluorescence sensor for detecting exosome miRNA21 as well as preparation and application of fluorescence sensor
CN116463400A
Methods of typing germ cell tumors
WO2021118349A1