RPA-LFD primer group and method for field on-site visual detection of pear fire blight bacteria and application of RPA-LFD primer group

Abstract

The invention relates to the technical field of agricultural biology, and particularly provides an RPA-LFD primer group and method for field on-site visual detection of pear fire blight bacteria and application of the RPA-LFD primer group and method. The primers comprise an upstream primer EaF, a downstream primer EaR and a probe Ea-pro, and the method comprises the following steps: preparing a pear fire blight sample leachate as a reaction template, carrying out an RPA-LFD reaction based on the primer group, and judging a detection result according to whether a quality control line (C) and a detection line (T) on an LFD test strip are carried or not. According to the method, DNA does not need to be extracted, high universality and specificity are achieved, the detection sensitivity can reach 5 * 10 <-6 > ng / mu L and 1 * 10 < 2 > CFU / mL, and compared with an existing rapid detection method, the detection sensitivity is remarkably improved. Technical support is provided for rapid and accurate field diagnosis, bacterial detection of plant propagation materials and evaluation of disease prevention and control effects.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology, and more particularly relates to an RPA-LFD primer set, method and application thereof for field on-site visual detection of Erwinia amylovora. Background Art

[0002] Xinjiang's unique geographical environment gives its fruit industry a strategic position in my country. It is a major agricultural product supplier nationwide and one of the world's six major fruit production belts. In recent years, with the widespread monoculture of fruit trees and increased rainfall, fruit tree diseases have become increasingly prevalent, the most prominent of which is fire blight. Fire blight, also known as branch dieback, is a quarantine bacterial disease caused by Erwinia amylovora (Erwinia amylovora), the first plant disease to be isolated and identified. Since its discovery in the Hudson River Basin of New York State in 1780, it has gradually spread globally, currently reaching over 60 countries across five continents. A locally invasive species in my country, fire blight was first introduced from Huocheng County, Ili, Xinjiang, in 2015 and rapidly spread to over 70 cities and counties in Xinjiang and Gansu provinces. The amylopectin pathogen has a wide host range, infecting over 220 plant species from 40 genera, including Pyrus, Malus, Cydonia, Eriobotrya, Fragaria, Rosa, Rosablanda, and Spiraea. It primarily hosts pome-bearing plants within the subfamily Maloideae of the Rosaceae family. Typical symptoms include blossom end rot, fruit rot, leaf blight, tip dieback, trunk necrosis, cankers, and bacterial pus formation, causing significant economic losses to local fruit trees. The disease has been listed in my country as a major invasive quarantine pest and a Category I pest.

[0003] Due to its rapid spread and severe damage, the effective prevention and control of amylopectin (E. amylopectin) remains a global bottleneck that is difficult to overcome. Furthermore, as E. amylopectin spreads globally, the pressure to prevent and control it is increasing. In my country, existing detection technologies are unable to provide efficient and accurate detection methods to provide a theoretical basis for prevention and control decisions. Therefore, there is an urgent need to develop new and precise detection technologies to improve the monitoring and prevention capabilities of E. amylopectin. With the development of molecular biology, research on detection technology for E. amylopectin (E. amylopectin) has evolved from traditional morphological observation and culture medium isolation to immunological methods and then to molecular biology technology. Each detection method has its own advantages and disadvantages. Traditional methods are simple to operate, but have a long detection cycle; immunological methods have high specificity but may be affected by antigenic variation; molecular biology methods have high sensitivity and specificity, but are complex and time-consuming. In recent years, the rapid detection technology that combines recombinase polymerase amplification (RPA) with lateral flow dipstick (LFD) has become an important tool for monitoring and controlling the amylopectin disease because of its simplicity, speed, and ability to provide instant results without the need for complex instruments. It has performed particularly well in the rapid screening of field diseases, providing strong support for early warning and precise prevention and control.

[0004] Recombinase polymerase amplification (RPA) is an isothermal amplification technique invented by Olaf Piepenburg et al. in 2006. It can efficiently amplify specific DNA sequences at a constant temperature of 37-42°C. Its principle is to utilize the synergistic action of recombinase, single-strand binding protein, and strand-displacing DNA polymerase. The recombinase binds to the primer to form a recombinase-primer complex. This complex scans the template DNA and opens the double-stranded DNA at the region complementary to the target sequence, allowing the primer to bind directly to the target sequence without the need for a high-temperature denaturation step. After primer binding, the single-stranded binding protein (SSB) binds to the unpaired single-stranded DNA region, preventing reannealing of the DNA double strands and maintaining primer binding. Subsequently, a strand-displacing polymerase displaces the original complementary strand during primer extension, eliminating the need for high-temperature denaturation. Under isothermal conditions of 37-42°C, exponential amplification of the target DNA sequence is achieved. Compared with other detection methods, RPA has a rapid reaction, simple primer design, and high specificity and sensitivity. Combined with the lateral flow test strip, an intuitive and convenient reading platform, it not only simplifies the operation process but also enables instant on-site detection, thereby significantly improving detection efficiency and practicality.

[0005] At present, RPA technology has been widely used in many fields such as plant protection, medical health, and animal and plant quarantine. For the amylopectin bacteria, Pu Shuling, Tian Qian, Zhao Yancun and others have reported RPA-LFD detection methods developed based on its conserved regions. For example, Tian Qian et al. (2021) disclosed a method, kit and application of amylopectin bacteria detection method based on LFD-RPA technology in their patent (CN 113136442 B). This method uses the 16S-23S ITS gene (GenBank: AF449654.1) of amylopectin bacteria as the target sequence to design primers and probes. However, due to the high conserved nature of the ITS sequence, it is difficult to effectively distinguish amylopectin bacteria from its closely related species, and there is a risk of false positives. In addition, the detection sensitivity of this method is 1.2×10 4 CFU / mL, and the detection process requires the extraction of sample DNA, which is significantly limited in practical field applications. Zhao Yancun et al. (2022) optimized the RPA-LFD detection system in patent (CN116949195 B), increasing the sensitivity to 5×10 3 CFU / mL, but it still cannot meet the needs of rapid on-site detection of amylopectin. The RPA rapid detection technology developed by Pu Shuli et al. (2024) also uses the 16S-23SITS gene as the target sequence, with a detection sensitivity of 1×10 4 CFU / mL, and the detection process relies on DNA extraction steps, which greatly limits its application in field scenarios.

[0006] In summary, the existing detection technologies for Erwinia amylovora have the following three bottlenecks: First, existing methods generally design primers and probes based on the highly conserved 16S-23S ITS sequence, resulting in insufficient specificity and the risk of false positives caused by cross-reactions between closely related species; second, all detection systems require DNA extraction from the sample to be tested, which is cumbersome and time-consuming, and cannot meet the needs of rapid field detection. Third, the detection sensitivity is low, with the current highest sensitivity (5×10 3 CFU / mL) still falls short of the actual needs for on-site rapid diagnosis. Therefore, establishing a visual, rapid on-site detection technology that requires no DNA extraction and offers greater versatility and sensitivity has become a key challenge in the field detection of E. amylovora. Summary of the Invention

[0007] In view of this, the object of the present invention is to provide an RPA-LFD primer set, method and application thereof for field on-site visual detection of Erwinia amylovora, so as to achieve rapid and accurate field detection of Erwinia amylovora and overcome the technical bottlenecks of existing detection methods.

[0008] In order to achieve the above object, the present invention provides the following technical solutions:

[0009] The first aspect of the present invention provides an RPA-LFD primer composition, wherein the primer set includes an upstream primer Ea-F, a downstream primer Ea-R and a probe Ea-pro.

[0010] Among them, the nucleotide sequence of the upstream primer Ea-F is shown in SEQ ID NO.1 (GCTGCTGCATCGGGTCGCTGGAGTCTGAGGT), the nucleotide sequence of the downstream primer Ea-R is shown in SEQ ID NO.2 (GCGGTTCGCTGAACACGCTGGGCTCGAAAGG), and the nucleotide sequence of the probe Ea-pro is the sequence formed after the base at the 33rd position of the 5' end of the sequence shown in SEQ ID NO.3 is replaced with tetrahydrofuran (SEQ ID NO.3: TCTGTGCCGGAGGTGGAATCGTCGTTTTGGGAGTTGAGTTAATATCCCA).

[0011] Furthermore, the 5' end of the downstream primer Ea-R has a biotin group; the 5' end of the probe Ea-Pro is labeled with a carboxyl fluorescent group FAM, and the 3' end of the probe Ea-Pro is labeled with a modification group C3-Spacer.

[0012] A second aspect of the present invention provides a kit comprising the above primer combination.

[0013] The third aspect of the present invention provides the use of the above primer combination or the above kit in the detection or auxiliary detection of Erwinia amylovora.

[0014] A fourth aspect of the present invention provides use of the primer composition or the kit in preparing a detection or auxiliary detection reagent for Erwinia amylovora.

[0015] A fifth aspect of the present invention provides an RPA-LFD method for field-based visual detection of Erwinia amylovora, comprising the following steps:

[0016] (1) After the sample is surface disinfected, a small piece of plant tissue at the junction of the diseased and healthy tissues is taken, minced with scissors, and suspended in 1 mL of sterile water. The suspension is then soaked for 30 min to allow the pathogen to fully dissolve in the water to form a bacterial solution. The solution is then centrifuged at 12,000 rpm for 15 min, the supernatant is removed, and the precipitate is resuspended in 500 μL of sterile water.

[0017] (2) using the soaked bacterial solution as a template, performing an RPA-LFD amplification reaction using the above-mentioned primer combination or the above-mentioned kit;

[0018] (3) Take 10 μL of the amplified product and add it to a centrifuge tube containing 190 μL of ultrapure water, and use LFD test strips for detection. Observe the interpretation results of the quality control line C and the detection line T within 5 minutes: if both the quality control line C and the detection line T of the test strip show red strips, it is judged as a positive result, indicating that the sample contains amylovora; if only the quality control line C shows a red strip, it is judged as a negative result, indicating that the sample does not contain amylovora; if both the C line and the T line do not show color, it indicates that the test strip or amplification reagent may be damaged, invalid, or improperly operated.

[0019] Furthermore, in step (2), the RPA-LFD amplification reaction system includes: 29.4 μL ABuffer, 2 μL 10 μM upstream primer, 2 μL 10 μM downstream primer, 0.6 μL 10 μM probe, 2 μL sample extract, 12.1 μL ultrapure water, and 2.5 μL Bbuffer.

[0020] Furthermore, in step (2), the reaction temperature of the RPA-LFD amplification reaction is 33-41° C., and the reaction time is 11-21 min.

[0021] Further preferably, the optimal reaction temperature of the RPA-LFD amplification reaction is 39° C., and the optimal reaction time is 15 min.

[0022] Compared with existing detection methods, the advantages of the present invention are:

[0023] (1) The present invention designs primers and probes using the pathogenic gene hrpN as the target sequence, which have high versatility and specificity. They can detect E. amylovora isolated from different regions and hosts, but cannot detect bacterial diseases and other common plant diseases in the same habitat as E. amylovora, thus avoiding the possibility of false positives and false negatives.

[0024] (2) In terms of efficiency, the most significant advantage of the present invention is that it does not require DNA extraction and can directly use the sample extract as a reaction template, greatly improving the detection efficiency. The RPA amplification system can amplify double-stranded DNA in the range of 33°C to 41°C, and a visual result can be obtained in as fast as 11 minutes. Compared with other detection methods, the RPA-LFD detection system established by the present invention has higher amplification efficiency and more flexible reaction conditions.

[0025] (3) In terms of sensitivity, for bacterial suspension samples, the detection limit of this system is as low as 10 2cfu / mL, a 100-fold improvement over traditional PCR technology. Compared to the rapid amylopectinea blight system previously established by Zhao Yancun et al., the sensitivity is 50-fold higher; compared to Tian Qian et al., the sensitivity is 120-fold higher; and compared to Pu Shuli et al., the sensitivity is 100-fold higher. For genomic DNA samples, the detection sensitivity of this system is on the same order of magnitude as the rapid detection system established by Zhao Yancun and is 100-fold higher than the detection system established by Pu Shuli et al.

[0026] This experiment established a field visual on-site rapid detection technology with better versatility, higher sensitivity and no need for DNA extraction. This invention can be used to perform efficient and accurate specific detection of amylovora in the field, providing a theoretical basis for precise prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Shown is the universality and specificity detection of the primers designed by the present invention, wherein Figure 1 -A is the universality test of the designed primers. From left to right, 1 to 23 are 23 representative strains of Fire blight isolated from different hosts and regions. N is the negative control. Figure 1 -B is the specificity test of the designed primers. From left to right, 1 to 15 are eight strains of Erwinia amylovora isolated from different hosts and regions, including Pantoea agglomerans, Serratia marcescens, Pseudomonas fluorescens, Bacillus subtilis, Erwinia amylovora, Ralstonia solanacearum, and bacterial fruit spot pathogen. N is the negative control, and M represents a 100 bp marker.

[0028] Figure 2 The figure shows the screening of the optimal reaction conditions for the RPA-LFD detection method, where Figure 2 -A is the screening of the optimal reaction temperature. From left to right, 1 to 8 are 27°C, 29°C, 31°C, 33°C, 35°C, 37°C, 39°C and 41°C. N is the negative control. Figure 2 -B is the screening of the optimal reaction time, from left to right 1 to 8 are 9 min, 11 min, 13 min, 15 min, 17 min, 19 min, 21 min and 23 min, N is the negative control;

[0029] Figure 3 The figure shows the specificity test of the RPA-LFD detection method. From left to right, 1 to 15 are strains of Erwinia amylovora, Pantoea agglomerans, Serratia marcescens, Pseudomonas fluorescens, Bacillus subtilis, Erwinia amylovora, Ralstonia solanacearum, and bacterial fruit spot pathogens isolated from eight different hosts and regions. N is the negative control.

[0030] Figure 4 Shown is the sensitivity determination of the RPA-LFD detection method. Figure 3-A is the sensitivity test of the suspension of Erwinia amylovora, and 1 to 8 from left to right are 1×10 8 cfu / mL, 1×10 7 cfu / mL, 1×10 6 cfu / mL, 1×10 5 cfu / mL, 1×10 4 cfu / mL, 1×10 3 cfu / mL, 1×10 2 cfu / mL and 1×10 cfu / mL, N is the negative control, Figure 3 -B is the sensitivity test of genomic DNA of Erwinia amylovora, from left to right 1 to 8 are 50 ng / μL, 5 ng / μL, 500 pg / μL, 50 pg / μL, 5 pg / μL, 500 fg / μL, 50 fg / μL and 5 fg / μL, N is the negative control;

[0031] Figure 5 The figure shows the RPA-LFD detection method used to detect actual field samples. From left to right, 1 to 6 are six field samples that tested positive, P is a positive control, 7 to 8 are two field samples that tested negative, N1 is a Pantoea control, and N2 is a negative control.

[0032] Figure 6 This is a schematic diagram of the interpretation of the results of the special nucleic acid test strips. DETAILED DESCRIPTION

[0033] The technical solutions in the embodiments of the present invention are described clearly and completely below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the scope of the present invention.

[0034] Test Strains: The thirty strains used in this invention are all from this laboratory collection, and the applicant promises to make them permanently available to the public. These include 23 target strains (Ea1-Ea23) of Erwinia amylovora from different regions and hosts, and seven control strains (H1-H7): Erwinia pyrifoliae, Pseudomonas fluorescens, Serratia marcescens, Pantoea agglomerans, Bacillus subtilis, Ralstonia solanacearum, and Acidovorax citrulli.

[0035] Table 1 Bacteria used in the present invention and their host plants

[0036]

[0037] The kits used: DNA Constant Temperature Rapid Amplification Kit (Basic Type), DNA Constant Temperature Rapid Amplification Kit (Colloidal Gold Test Strip Type) and HybriDetect Colloidal Gold Test Strips were all purchased from Weifang Anpu Future Biotechnology Co., Ltd., AxyPrepPCR Cleaning Kit was purchased from Corning Life Sciences (Haojiang) Co., Ltd., and Bacterial Genomic DNA Extraction Kit was purchased from TIANGEN.

[0038] Example 1: Design of primers and probes for RPA amplification system and universal specificity detection

[0039] Genomic DNA extraction: DNA of the strains listed in Table 1 was extracted using the TIANamp Bacteria DNA Kit and stored at -20°C until use.

[0040] Preparation of bacterial suspension: Under sterile conditions, use an inoculating loop to dip into a suspension of each test strain stored at -80°C. For E. amylovora and E. amylovora strains, streak onto CCT medium; for other strains, streak onto NA medium. After incubation at 28°C for 48 hours, single colonies with typical characteristics of E. amylovora were selected and transferred to CCT medium; for other strains, representative single colonies were transferred to NA medium. Cultured at 28°C with shaking until OD600 = 0.8-1.0. Turbidimetric determination of the concentration was 1.0 × 10 8 cfu / mL bacterial suspension for later use.

[0041] Design and screening of primers for the RPA amplification system: Six housekeeping genes related to the basic life activities of E. amylovora were selected as candidate targets for RPA detection, namely hrpN, gyrB, hrpB, filC, rpoD, and rpoB. First, the complete genome sequence of the E. amylovora FB-20 strain was downloaded from NCBI, and the sequences of the target genes were extracted using UltraEdit and BioEdit software. According to the relevant principles of RPA primer design, primers were designed using Primer Premier 5 software, and the designed primers were submitted to Shanghai Sangon Biotechnology Co., Ltd. for synthesis. Then, using the genomic DNA of the test strain as a template, the basic RPA kit and agarose gel electrophoresis were used to observe the size and brightness of the primer bands to screen out primers suitable for the target genes.

[0042] Versatility and specificity of RPA amplification primers: The synthesized primers were further screened, using Erwinia amylovora strains from different regions and hosts as target strains. Pantoea agglomerans, Serratia marcescens, Pseudomonas fluorescens, Bacillus subtilis, as well as Erwinia amylovora, Ralstonia solanacearum, and Pseudomonas aeruginosa isolated from the same habitat served as control strains (see Table 1 for details). PCR and RPA amplification reactions were performed using template DNA from these strains using the newly designed primers to ensure good versatility and specificity. Based on the screened primer sequences, probe sequences were designed. The probes were required to be located between the upstream and downstream primers, be 46-50 nt in length, complementary to the target fragment, and modified with different chemical groups at the 5' and 3' ends and in the middle of the probe. Finally, primers and probes were designed targeting the core pathogenic gene hrpN (see Table 2 for details).

[0043] SEQ ID NO.1: GCTGCTGCATCGGGTCGCTGGAGTCTGAGGT;

[0044] SEQ ID NO.2: GCGGTTCGCTGAACACGCTGGGCTCGAAAGG;

[0045] SEQ ID NO. 3: TCTTGGCCGGAGGTGGAATCGTCGTTTTGGGAGTTGA GTTAATATCCCA.

[0046] Table 2 shows the basic information of primers and probes for RPA-LFD amplification reaction.

[0047]

[0048] The RPA amplification method described above involves performing RPA amplification reactions using genomic DNA or bacterial suspensions of Erwinia amylovora and control bacteria as templates. The RPA reaction system consists of adding A Buffer, upstream primer (10 μM), downstream primer (10 μM), DNA template or bacterial suspension, and ultrapure water to a 50 μL dry powder reaction tube. Finally, add B Buffer to initiate the reaction. After mixing and centrifugation, the reaction is incubated in a metal bath at 37-39°C for 15 minutes. The RPA product is then purified using the AxyPrep PCR Cleanup Kit.

[0049] The specific experimental steps are:

[0050] (1) Add 3 volumes of BufferPCR-A to the RPA reaction solution (if BufferPCR-A is less than 100 μL, add to 100 μL), mix well, and transfer to a preparation tube. Place the preparation tube in a 2 mL centrifuge tube (provided in the kit), centrifuge at 12,000 rpm for 1 min, and discard the filtrate.

[0051] (2) Place the preparation tube back into a 2 mL centrifuge tube, add 700 μL of Buffer W2, centrifuge at 12,000 rpm for 1 min, and discard the filtrate.

[0052] (3) Place the preparation tube in a centrifuge tube, return the preparation tube to a 2 mL centrifuge tube, add 400 μL of Buffer W2, and centrifuge at 12,000 rpm for 1 min.

[0053] (4) Place the preparation tube in a clean 1.5 mL centrifuge tube, add 25-30 μL of Eluent or deionized water to the center of the preparation tube membrane, let it stand at room temperature for 1 minute, and centrifuge at 12,000 rpm for 1 minute to elute the DNA.

[0054] The purified product was subjected to agarose gel reaction and the intensity and brightness of the bands were observed to determine the universality and specificity of the primers. The specific reaction system for RPA amplification is shown in Table 3:

[0055] Table 3 shows the RPA amplification reaction system.

[0056]

[0057] Example 2: Establishment of RPA-LFD detection reaction and screening of optimal reaction conditions

[0058] To set up the RPA-LFD reaction, use a 50μL RPA-LFD reaction system. Add Buffer A, Buffer, upstream primer (10μM), downstream primer (10μM), probe (10μM), DNA template or bacterial suspension, and ultrapure water to a dry powder reaction tube. Finally, add Buffer B to initiate the reaction. Mix thoroughly, centrifuge, and incubate in a metal bath at 37-39°C for 15 minutes. After the reaction is complete, add 10μL of the reaction product to a centrifuge tube containing 190μL of ultrapure water. Mix thoroughly, then drop 50μL onto a colloidal gold test strip. Observe the control line (C) and test line (T) within 5 minutes. If both the control line (C) and the test line (T) on the test strip show red strips, it is judged as positive, indicating that the amylovora blight pathogen has been detected; if only the control line (C) shows a red strip, it is judged as negative, indicating that the amylovora blight pathogen has not been detected; if both the C line and the T line do not show color, it indicates that the test strip or the amplification reagent may be damaged, invalid, or improperly operated (see Figure 6 ).

[0059] Table 4 RPA-LFD amplification reaction system

[0060]

[0061] Screening of the optimal reaction conditions: The reaction conditions were optimized through single-factor experiments. First, a temperature gradient was designed (27°C, 29°C, 31°C, 33°C, 35°C, 37°C, 39°C, 41°C). The RPA-LFD reaction was performed using genomic DNA as a template. The optimal reaction temperature was determined based on the strength of the positive detection band on the test strip. Finally, 39°C was determined to be the optimal reaction temperature. The results are shown in the figure. Figure 2 A.

[0062] Based on the determined optimal reaction temperature, a reaction time gradient (9 min, 11 min, 13 min, 15 min, 17 min, 19 min, 21 min) was further designed. The RPA-LFD reaction was performed using genomic DNA as a template. The optimal reaction time was determined according to the strength of the positive detection band on the test strip. Finally, 15 min was determined to be the optimal reaction time. The results are shown in Figure 2 B.

[0063] Example 3: Determination of specificity and sensitivity of RPA-LFD detection method

[0064] Determination of specificity of RPA-LFD detection method: The present invention uses eight strains of E. amylovora isolated from different hosts and regions as target strains (Ea1~Ea8), and Pantoea agglomerans, Serratia marcescens, Pseudomonas fluorescens, Bacillus subtilis and other plant pathogenic bacteria such as E. amylovora, Ralstonia solanacearum and bacterial fruit spot pathogen isolated from the same habitat as E. amylovora as control strains. Using the genomic DNA of these strains as templates, RPA-LFD reactions were carried out, and the specificity of the detection method was evaluated by observing whether the detection line appeared. The results showed that only the E. amylovora strain showed an obvious positive detection line on the test strip, while the other control strains did not show an obvious positive detection line, and the reactions were all negative, indicating that the detection method has high specificity (see Figure 3 ).

[0065] The RPA-LFD amplification method is shown in Example 2.

[0066] Sensitivity determination of RPA-LFD detection method: The present invention uses 10-fold gradient dilution of genomic DNA of Erwinia amylovora (5×10~10 -6 ng / μL) and Erwinia amylovora suspension (1×10 8 ~10 cfu / mL) as templates, and RPA-LFD was performed respectively. In bacterial suspension samples, RPA-LFD can effectively detect 1×10 8 to 1×10 2 The detection limit of bacterial suspension samples is as low as 1×10 2 cfu / mL,; for genomic DNA template, it can be between 5×10 to 5×10-6 The detection was effective within the concentration range of ng / μL, and the lower limit of detection was 50fg / μL, indicating that the detection method had high sensitivity.

[0067] The RPA-LFD amplification method is shown in Example 2.

[0068] Example 4: Field Sample Measurement

[0069] RPA-LFD detection method for detecting field samples: The present invention collected 8 samples of apricot fire blight plants from Ili, Changji and Tiemenguan in Xinjiang. After the surface of the sample was disinfected, a small piece of plant tissue at the junction of the diseased and healthy parts was taken, cut into pieces with scissors, suspended in 1 mL of sterile water, and soaked for 30 minutes to allow the pathogen to fully dissolve in the water to form a bacterial solution. Subsequently, centrifugation was carried out at 12000 rpm for 15 minutes, the supernatant was removed, and 500 μL of sterile water was added to resuspend the precipitate. Using the soaked bacterial solution as a template, RPA-LFD and plate coating experiments were carried out respectively, with apricot fire blight pathogen as a positive control, and ultrapure water and pantoea as negative controls. By comparing the results of the two detection methods, the feasibility of the established RPA-LFD method for field detection of apricot fire blight samples was evaluated.

[0070] The results are as follows: Among the 8 field samples, 6 samples showed obvious positive detection bands on the test strips, and the positive control detection line was the brightest. Neither Pantoea nor ultrapure water showed detection lines, indicating a negative reaction (see Figure 5 ).

[0071] To further verify the accuracy of the test results, these samples were evenly spread on CCT culture medium. After 48 hours, the growth of fire blight pathogens was observed in all positive samples on the culture medium. Miscellaneous bacteria grew on the culture medium of the two negative samples, but no amylovora pathogen was observed.

[0072] Statistics show that these positive samples originated from multiple plant parts, including leaves, petioles, branches, and fruit surfaces. This shows that the detection method can effectively identify infection of E. amylovora in different plant parts and can realize rapid detection of suspected samples in the field.

[0073] Based on a conserved sequence in the core pathogenic gene hrpN of the amylovora pathogen, a pair of specific primers Ea-F / R and a probe Ea-pro were designed to establish a method for visual on-site detection of amylovora. The optimal reaction temperature and time for this method are 39°C and 15 minutes, at which the positive detection line is brightest. The established RPA-LFD detection method can amplify amylovora from different regions, demonstrating good versatility. Furthermore, the method amplifies only the target strain, resulting in positive bands and detection lines, demonstrating good specificity. The detection limits for genomic DNA and bacterial suspension are 5×10 -6 ng / μL and 1×10 2 CFU / mL, significantly improving sensitivity compared to existing detection methods. Testing eight samples of amylovora from Xinjiang, six tested positive, consistent with plate-based isolation testing. Furthermore, on-site testing eliminates the need for DNA extraction, significantly improving detection efficiency. Experimental validation demonstrates that this method can rapidly and accurately identify the amylovora pathogen in the field.

[0074] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. An RPA-LFD primer composition, characterized in that The primer set includes an upstream primer Ea-F, a downstream primer Ea-R and a probe Ea-pro, The nucleotide sequence of the upstream primer Ea-F is shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer Ea-R is shown in SEQ ID NO.2, and the nucleotide sequence of the probe Ea-pro is the sequence formed by replacing the 33rd base at the 5' end of the sequence shown in SEQ ID NO.3 with tetrahydrofuran.

2. The primer composition according to claim 1, characterized in that The 5' end of the downstream primer Ea-R has a biotin group; the 5' end of the probe Ea-Pro is labeled with a carboxyl fluorescent group FAM, and the 3' end of the probe Ea-Pro is labeled with a modification group C3-Spacer.

3. A kit comprising the primer composition according to any one of claims 1 to 2.

4. Use of the primer composition according to any one of claims 1 to 2 or the kit according to claim 3 in the detection or auxiliary detection of Erwinia amylovora.

5. Use of the primer composition according to any one of claims 1 to 2 or the kit according to claim 3 in the preparation of a detection or auxiliary detection reagent for Erwinia amylovora.

6. A RPA-LFD method for field-based visual detection of Erwinia amylovora, characterized in that: RPA-LFD detection is performed using the primer composition according to any one of claims 1 to 2 or the kit according to claim 3.

7. The RPA-LFD method for field visualization detection of Erwinia amylovora according to claim 6, wherein The following steps are involved: (1) After the sample is surface disinfected, a small piece of plant tissue at the junction of the diseased and healthy tissues is taken, minced with scissors, and suspended in 1 mL of sterile water. The suspension is then soaked for 30 min to allow the pathogen to fully dissolve in the water to form a bacterial solution. The solution is then centrifuged at 12,000 rpm for 15 min, the supernatant is removed, and the precipitate is resuspended in 500 μL of sterile water. (2) using the soaked bacterial solution as a template, and performing an RPA-LFD amplification reaction using the primer composition according to any one of claims 1 to 2 or the kit according to claim 3; (3) Take 10 μL of the amplified product and add it to a centrifuge tube containing 190 μL of ultrapure water, and use LFD test strips for detection. Observe the interpretation results of the quality control line C and the detection line T within 5 minutes: if both the quality control line C and the detection line T of the test strip show red strips, it is judged as a positive result, indicating that the sample contains amylovora; if only the quality control line C shows a red strip, it is judged as a negative result, indicating that the sample does not contain amylovora.

8. The RPA-LFD method for field visualization detection of Erwinia amylovora according to claim 7, wherein In step (2), the RPA-LFD amplification reaction system includes: 29.4 μL ABuffer, 2 μL 10 μM upstream primer, 2 μL 10 μM downstream primer, 0.6 μL 10 μM probe, 2 μL sample extract, 12.1 μL ultrapure water, and 2.5 μL B buffer.

9. The RPA-LFD method for field visualization detection of Erwinia amylovora according to claim 7, wherein In step (2), the reaction temperature of the RPA-LFD amplification reaction is 33-41° C., and the reaction time is 11-21 min.

10. The RPA-LFD method for field visualization detection of Erwinia amylovora according to claim 9, characterized in that: The reaction temperature of the RPA-LFD amplification reaction was 39° C., and the reaction time was 15 min.

Images