Molecular marker, method, primer pair and kit for identifying black edge character of watermelon seed coat and application of molecular marker, method, primer pair and kit

Abstract

The invention discloses a molecular marker, a method, a primer pair and a kit for identifying black edge characters of watermelon seed coats and application of the molecular marker, and belongs to the technical field of molecular marker-assisted breeding. The invention aims to identify the black edge of the seed coat of the watermelon more quickly and accurately in the seedling stage of the watermelon. The invention provides a molecular marker for identifying the black edge character of watermelon seed coats. The molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2. The invention further provides a method for identifying the black edge character of the watermelon seed coats. According to the identification method, the genomic DNA of the watermelon sample to be detected is extracted in the seedling stage, whether the watermelon seed coat black edge exists or not can be identified, operation is easy and convenient, the identification accuracy and efficiency are high, and an effective breeding tool and technology are provided for watermelon seed coat black edge molecular marker-assisted selection breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to a molecular marker, a method, a primer pair, a kit and applications thereof for identifying the black edge trait of watermelon seed coat. Background Art

[0002] Watermelon (Citrullus lanatus) is an annual, vine-bearing herbaceous plant of the Cucurbitaceae family. Widely cultivated in my country and worldwide, it is a globally important economic crop. Watermelon seeds, the edible part of the plant, come in a variety of colors, including black, white, yellow, and with or without a black border, which directly influences consumer choice. The black border of the seed coat contains high concentrations of phenolic compounds, which enhance its hardness and resistance to mechanical damage. Furthermore, the black border of the seed coat is often used as an identification marker for hybrid seeds, ensuring hybrid purity and reducing seed production costs. The watermelon seed coat is the product of both natural and artificial selection, ensuring seed survival and dispersal while also providing phenotypic markers for the selection and breeding of different watermelon varieties. Identifying key candidate genes for the black border of the seed coat in watermelon and applying them to germplasm screening and molecular breeding is of great significance.

[0003] InDel molecular markers are polymorphic molecular markers formed by base deletions and insertions in chromosomal sequences. These markers are widely distributed throughout the genome, are easy to operate, produce easily observable results, and are universally applicable across different germplasm resources of the same species. Therefore, discovering InDel molecular markers that can be used to identify the black edge trait in watermelon seed coats and applying them to watermelon germplasm screening and molecular breeding is of great significance. Summary of the Invention

[0004] The invention aims to identify the black edge of the seed coat of watermelon more quickly and accurately during the seedling stage.

[0005] The invention provides a molecular marker for identifying the black edge trait of watermelon seed coat. The molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0006] The invention provides a primer pair for amplifying and identifying a molecular marker for the black edge trait of watermelon seed rind. The sequences of the primer pair are shown as SEQ ID NO.3 and SEQ ID NO.4.

[0007] The invention provides a kit for identifying the black edge trait of watermelon seed rind. The kit comprises the above-mentioned primer pair, 10×PCR Buffer, dNTP and Taq enzyme.

[0008] The present invention provides an application of the molecular marker, the primer pair or the kit in identifying or screening the black edge trait of watermelon seed coat.

[0009] It is further defined that the trait of watermelon seed rind black edge is the presence of watermelon seed rind black edge or the absence of watermelon seed rind black edge.

[0010] It is further defined that if the watermelon contains SEQ ID NO.1, the watermelon has a black edge on the seed coat, and if the watermelon contains SEQ ID NO.2, the watermelon has no black edge on the seed coat.

[0011] It is further defined that PCR amplification is performed using the above-mentioned primer pair, and the characteristics of the black edge of the watermelon seed coat are judged based on the PCR product. If the amplified product contains a 252bp fragment, it is judged to be a type with a black edge of the seed coat; if the amplified product contains a 261bp fragment, it is judged to be a type with no black edge of the seed coat.

[0012] The present invention provides a method for identifying the black edge trait of watermelon seed rind, and the method is as follows:

[0013] Step 1: Extract genomic DNA from the watermelon tissue to be tested;

[0014] Step 2: Using the DNA obtained in step 1 as a template, perform PCR amplification using the above primer pair to obtain a PCR product to determine the black edge trait of the watermelon seed coat; if the amplified product contains a 252bp fragment, it is determined to be a seed coat with black edges type; if the amplified product contains a 261bp fragment, it is determined to be a seed coat without black edges type.

[0015] It is further defined that the watermelon tissue to be tested in step 1 is watermelon leaves.

[0016] The present invention provides an application of the molecular marker, the primer pair, the reagent or the method in assisting watermelon breeding or screening watermelon seed coat traits.

[0017] Beneficial effects: In the early stage of the present invention, a genetic population was constructed with watermelons with black seed edges and watermelons without black seed edges as parents. The chromosome segment closely linked to the black seed edge trait of watermelon seed edges was obtained using genome resequencing and BSA-seq (Bulked Segregation Analysis) technology. After two years of phenotypic identification and screening of recombinant plants in the genetic population, the black seed edge locus interval was obtained and named Clbbs. An InDel molecular marker was developed within the chromosome segment. The marker is located within the Clbbs positioning interval, a key site of the black seed edge trait of watermelon seed edges, approximately 236.336 kb, and is closely linked to the black seed edge trait of watermelon seed edges. By using the molecular marker-assisted selection method, the genomic DNA of the test sample to be tested can be extracted during the watermelon seedling stage to perform molecular marker-assisted selection for the black seed edge of watermelon seed edges, thereby improving the accuracy and efficiency of breeding. The molecular marker can be applied to watermelon molecular breeding, providing an efficient molecular breeding tool for the molecular identification of black seed edge of watermelon seed edges.

[0018] This invention utilizes molecular markers developed and obtained from parental resequencing data to design primer pairs for a tightly linked trait to the watermelon seed rind black edge. Due to the polymorphism of short sequence insertions and deletions present in this molecular marker fragment across different watermelon materials, the resulting primer pair is used to perform PCR amplification of watermelon seedling genomic DNA. The size of the PCR product fragments is then determined using polyacrylamide gel electrophoresis, enabling molecular identification of watermelon seed rind black edge at the seedling stage. This identification method, which extracts genomic DNA from the test watermelon sample at the seedling stage, can identify the presence of watermelon seed rind black edge. It is simple to perform and offers high accuracy and efficiency, providing an effective breeding tool and technology for molecular marker-assisted selection of watermelon seed rind black edge. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the result of locating the black edge site Clbbs of the watermelon seed coat in Example 1;

[0020] Figure 2 This is a graph showing the results of polyacrylamide gel electrophoresis detection of amplification products obtained by PCR amplification of seed coats with black edges and seed coats without black edges in a natural population and an F2 population produced by both parents using the primer pairs described in Example 2;

[0021] Figure 3 These are the phenotypic results of watermelon seed coat; A is the seed coat phenotype of the watermelon variety PI 186490; B is the seed coat phenotype of the watermelon variety sanbai; C is the F1 generation seed coat phenotype. DETAILED DESCRIPTION

[0022] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. Except for the contents specifically mentioned below, the processes, conditions, experimental methods and reagents for implementing the present invention are common knowledge in the art and conventional products on the market, and the present invention is not particularly limited.

[0023] Method for extraction of genomic DNA:

[0024] The genomic DNA extraction method was based on and improved upon the method of Murray et al. (1980) (Murray M., Thompson WF, Rapid isolation of high molecular weight plant DNA [J]. Nucl. Acid. Res., 1980, 8: 668-673.).

[0025] Example 1: Molecular markers tightly linked to the black edge trait of watermelon seed coat and methods for obtaining the same

[0026] This example provides key gene linkage loci for the watermelon rind black edge trait, InDel markers, and methods for obtaining the markers.

[0027] (1) Selection of test materials:

[0028] The test materials include maternal, paternal, F1 and F2 generation populations;

[0029] The male parent material is: sanbai, the seed coat is without black edges;

[0030] The female parent material is: PI 186490, the seed coat has black edges; the characteristics are as follows Figure 3 shown.

[0031] The maternal and paternal parent genes are disclosed in Gao Ye, Guo Yu, Su Zhiyuan, Yu Yu, Zhu Zicheng, Gao Peng*, Wang Xuezheng*. Transcriptome analysis of genes related to fruit texture in watermelon. 2020, 262, 109075, Scientia Horticulturae.

[0032] The F1 generation is: the F1 generation obtained by hybridizing the above two materials as parents;

[0033] The F2 generation population is: the F2 generation population obtained by self-pollination of the above-mentioned F1 generation, and 120 and 336 F2 generation populations were sown in 2023 and 2024 respectively.

[0034] (2) Phenotypic identification of seed coat black edges of test materials: seeds were collected from mature fruits, dried in the sun, and 15 full seeds were selected from each fruit. Photos were taken to record the presence or absence of seed coat black edges.

[0035] The results of this step showed that the seed coat of the F1 generation had black edges, and the presence or absence of black edges in the F2 generation was in a ratio of 3:1, indicating that the black edges in the watermelon seed coat were inherited as a quality trait.

[0036] (3) Using BSA-seq and genetic linkage analysis methods, we obtained the chromosome segment that is closely linked to the black edge trait of the watermelon seed coat:

[0037] In the F2 generation, 20 plants with and without black edges were selected. DNA was extracted from each plant, adjusted to a consistent DNA concentration, and then mixed in equal amounts to construct a watermelon seed coat black edge gene pool for BSA-seq analysis. Based on the analysis results and combined with genome resequencing data from the two parents, InDel molecular markers were developed within the chromosome segments of the BSA-seq analysis results. Genetic linkage analysis was performed on the F2 generation populations in 2023 and 2024. Finally, the watermelon seed coat black edge trait locus was located on chromosome 3 of the watermelon genome, with an interval of approximately 236.336 Kb (chromosomal physical position: 5596783 bp-5833119 bp), which was named Cmbbs. Figure 1 This is the location result of the black edge site Cmbbs in the watermelon seed coat.

[0038] (4) Development of candidate InDel markers:

[0039] Based on the resequencing data from both parents, indel molecular markers were developed. Genotyping of individual plants in both the natural population and the aforementioned F2 population was performed, and the consistency between genotype and phenotype was assessed in combination with phenotypic data. The results showed that a variation in an indel site within this region was closely linked to the black seed coat trait.

[0040] Furthermore, the present invention obtained the Chr03_5741584 molecular marker tightly linked to the black edge of the watermelon seed coat. The nucleotide sequence of the Chr03_5741584 molecular marker is a 252bp nucleotide fragment as shown in SEQ ID NO.1, and the nucleotide sequence is a 261bp nucleotide fragment as shown in SEQ ID NO.2. The SEQ ID NO.1 is tightly linked to the trait of having a black edge on the seed coat, and the SEQ ID NO.2 is tightly linked to the trait of not having a black edge on the seed coat.

[0041] SEQ ID NO.1:

[0042] TAAAGAATCTCCTCCAGGTTGGG GGTTTTGGTAATTGTCTCCATTAGA[-]AGCTTT GCATGACACATAATTAATGCTCACCCTTTTGTTTCGAGGAATAGATGATTCATTTTTTCCTCTAGAATATGGAGAAATTGATAGAAGATGATAGAGAAGCCATAGTTTTGCTTGGTTGTTATTGAGTTTTAGTTGTGTGTTCTCTTAAATAGGAAAAAAAACTCCAAAATTA CAACATTTCCTCCCTAATCTTTCG;

[0043] SEQ ID NO.2:

[0044] TAAAGAATCTCCTCCAGGTTGGG GGTTTTGGTAATTGTCTCCATTAGA[TCCATT AGA]AGCTTTGCATGACACATAATTAATGCTCACCCTTTTGTTTCGAGGAATAGATGATT CATTTTTTCCTCTAGAATATGGAGAAATTGATAGAAGAGATGATAGAAGCCATAGTTT TGCTTGTGTTGTTGAGTTTTAGTTGTGTGTTCTCTTAAATAGGAAAAAAAACTCCAA AATTA CAACATTTCCTCCCTAATCTTTCG.

[0045] Example 2: Acquisition of primer pairs for identifying the black edge trait of watermelon seed coat

[0046] Based on the results of parental resequencing data development, a Chr03-5741584 molecular marker was developed that was tightly linked to the black edge trait of the watermelon seed coat. A primer pair was designed to amplify the molecular marker. Specifically, within the positioning interval of Example 1, primers were designed based on the InDel differences in the sequencing data of the two parents, and an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4 were obtained.

[0047] The upstream primer sequence is Chr03_5741584-F (SEQ ID NO. 3): 5'-TAAAGAATCTCCTCCAGGTTGGG-3'; the downstream primer sequence is Chr03_5741584-R (SEQ ID NO. 4): 5'-CGAAAGATTAGGGAGGAAATGTTG-3'.

[0048] Example 3: A method for identifying the black edge trait of watermelon seed skin

[0049] A method for identifying the black edge trait of watermelon seed rind, comprising the following steps:

[0050] (1) Extract genomic DNA from leaves or other tissues of the watermelon sample to be tested.

[0051] The identification method of the present invention can use watermelon seedlings at different stages as materials. In order not to affect the optimal period of subsequent growth, this embodiment uses leaves of watermelon seedlings (two leaves and one heart stage) as materials to extract DNA.

[0052] The specific steps are as follows:

[0053] ① After washing and drying the collected young true leaves with sterile water, take 0.2 g and place them in a 1.5 mL centrifuge tube. Add liquid nitrogen and grind thoroughly until white powder is obtained. Add 800 μL of 2% CTAB solution (2% CTAB, 100 mmol / L Tris-HCl pH = 8.0) preheated at 65°C, 1.4 mol / L NaCl, 20 mmol / L EDTA pH = 8.0, 2% β-mercaptoethanol) and mix thoroughly. Incubate in a 65°C water bath for 1 h, shaking gently every 10 min.

[0054] ② Remove the centrifuge tube, cool it to room temperature, and centrifuge it at 13,000 rpm for 10 minutes. Aspirate the supernatant and transfer it to a new centrifuge tube. To prevent mechanical shear damage to the DNA, the tip of the pipette tip used for transfer should be cut off with scissors in advance to widen the pipette opening.

[0055] ③ Add 750 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the cell wall, mix thoroughly, let it rest for 10 minutes, and then centrifuge at 13,000 rpm for 10 minutes.

[0056] ④ Take out the centrifuge tube and use the same treatment method as above to suck out 700μL of supernatant with the pipette tip attached to the wall and place it in a new centrifuge tube.

[0057] ⑤ Add 700 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the tube wall, gently shake the tube to mix the solution thoroughly, let it stand for 10 minutes, and then centrifuge at 13000 rpm for 10 minutes.

[0058] ⑥ Aspirate 650 μL of supernatant from the tube and place it in a new tube. Add 2 μL of RNase (10 mg / mL) and mix well. Place in a 37°C water bath for 2 h.

[0059] ⑦ Add 650 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the cell wall, mix thoroughly, let it stand for 10 minutes, and then centrifuge at 13000 rpm for 10 minutes.

[0060] ⑧ Aspirate 550 μL of supernatant from the tube and place it in a new tube. Add 550 μL of -20℃ pre-cooled isopropanol (add it to the tube wall). Close the tube tightly, turn it upside down several times, and place it in a -20℃ refrigerator for 60 minutes.

[0061] ⑨ Remove the centrifuge tube and centrifuge it at 13000 rpm for 10 minutes. Carefully discard the supernatant and retain the sediment at the bottom of the centrifuge tube.

[0062] ⑩ Wash the precipitate three times with pre-cooled 70% ethanol, place the centrifuge tube in a clean bench, blow dry with sterile air, add 200μL ddH2O to dissolve it, and store it at -20℃ for later use.

[0063] (2) Using the Chr03_5741584 primer pair obtained in Example 2, PCR amplification was performed on the genomic DNA of different samples to obtain amplified products. The amplified products were detected by polyacrylamide gel electrophoresis. If the amplified product contained a 252 bp fragment, it was determined to be a type with a black edge on the seed coat; if the amplified product contained a 261 bp fragment, it was determined to be a type without a black edge on the seed coat.

[0064] The PCR reaction system is as follows: 1 μL of upstream and downstream primers (primer concentration is 2 pM), 2 μL of DNA template (concentration is 30 ng / μL), 1 μL of 10× PCR Buffer (containing Mg 2+ 15 mM), dNTP 0.15 μL (concentration of 10 mM), Taq enzyme 0.1 μL (5 U / μL), and sterile deionized water 6.75 μL.

[0065] The PCR reaction program was as follows: 94°C pre-denaturation for 7 min, 94°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, 72°C extension for 10 min, and storage at 4°C.

[0066] PCR product detection method: Take 2μL of PCR product, add 2μL of Loading Buffer, mix well, and then spot it on polyacrylamide gel. Perform electrophoresis at 220V / 400mA for 50-60min.

[0067] The identification method of the present invention can be used to determine the black edge trait of the seed coat of watermelon during the seedling stage, with the sampling time being approximately the two-leaf, one-heart period. Conventional breeding requires determining the presence or absence of the black edge of the seed coat after the fruit matures. The identification method of the present invention can effectively shorten the breeding time and accelerate the breeding speed.

[0068] Example 4: Screening of natural watermelon populations and F2 populations for black edge of seed coat using the primers obtained in Example 2

[0069] In order to determine the accuracy of the molecular markers obtained in Example 1, the primer pairs obtained in Example 2, and the identification method obtained in Example 3 in identifying the black edge of the watermelon seed coat, samples from a natural watermelon population and the F2 population in Example 1 were selected. The presence or absence of the black edge of the seed coat was identified in each sample according to the identification method described in Example 3, and the field phenotypic data of the presence or absence of the black edge of the seed coat was recorded during the ripening period of the watermelon fruit.

[0070] In this example, genomic DNA of each individual plant in the paternal, maternal, F1, F2 generations and natural population in Example 1 was extracted respectively, and the genomic DNA of the above samples was amplified by PCR using the primer pairs obtained in Example 2 to obtain PCR products. The PCR products were detected by polyacrylamide gel electrophoresis. The results are shown in FIG. Figure 2 .

[0071] Lanes 1-3 are maternal, paternal and F1 generations respectively. Natural population materials are shown in Figure 2 Lanes 4 to 16: Lane 4 is W1-43, Lane 5 is ZXG1164, Lane 6 is ZXG1486, Lane 7 is ZXG1561, Lane 8 is JM, Lane 9 is W1-61, Lane 10 is COS, Lane 11 is W1-17, Lane 12 is W202005, Lane 13 is W202009, Lane 14 is W202010, Lane 15 is W202104, and Lane 16 is W202109. The natural population materials of Lanes 5-7 were published in the following articles:

[0072] Shang Jianli, Wang Jiming, Ma Shuangwu. Identification of watermelon germplasm resources resistant to zucchini yellow mosaic virus. 2014, 27(4): 14-15, 18. Chinese Journal of Melons and Vegetables.

[0073] Lane 8 natural population material was published in the following article:

[0074] Jiang Jiao,Feng Qin,Zhao Zijun,Liu Qiyan,Liu Man,Wang Jiafa,LuanFeishi,Zhang Xian,Tian Shujuan,Liu Shi*,Yuan Li*.Establishing a highlyefficient diploid seedless watermelon production system through manipulationof the SPOROCYTELESS gene.2024,244,1128-1136,New Phytologist.

[0075] Lanes 9-11 natural population materials were published in the following articles:

[0076] Pei Shuang,Wu Zexu,Ji Ziqiao,Liu Zheng,Zhu Zicheng*,Luan Feishi*,Liu Shi*.Quantitative trait lociidentification reveals zinc finger protein CONSTANS-LIKE 4as the keycandidate gene of stigma color in watermelon(Citrullus lanatus).2024,23,2292-2305,Journal of Integrative Agriculture.

[0077] like Figure 2 As shown, the PCR product detection results of the female parent (P1) showed a 252 bp fragment, and the enzyme digestion results of the male parent (P2) showed a 261 bp fragment. It was judged that the female parent had a black-edged seed coat, and the male parent had a black-edged seed coat. This conclusion is consistent with the results of the presence or absence of black-edged seed coats of the male and female parents in Example 1. The PCR product detection results of the natural population in lanes 4-7 showed a 252 bp fragment, and the PCR product detection results of the natural population in lanes 8-16 showed a 261 bp fragment. It was judged that the natural population in lanes 4-7 had the black-edged seed coat trait, and the natural population in lanes 8-16 had the black-edged seed coat trait. PCR product detection results for the F2 population in lanes 17-24 showed a 252 bp fragment, and PCR product detection results for the F2 population in lanes 25-32 showed a 261 bp fragment, indicating that the F2 population in lanes 17-24 has the seed coat with black edges, while the F2 population in lanes 25-32 has the seed coat without black edges. Based on actual measurements of seed coat black edges in natural and F2 populations, it was found that the natural population in lanes 4-7 exhibited the seed coat with black edges, the natural population in lanes 8-16 exhibited the seed coat without black edges, the F2 population in lanes 17-24 exhibited the seed coat with black edges, and the F2 population in lanes 25-32 exhibited the seed coat without black edges. Therefore, the watermelon seed coat black edge trait determined based on the PCR product electrophoresis results (marker genotyping results) was consistent with the actual presence or absence of seed coat black edge in each watermelon variety. The genotype and phenotype were completely consistent, and the molecular marker identification results were 100% consistent with the actual seed coat black edge trait. This further demonstrates that the molecular markers provided in Example 1, the primer pairs provided in Example 2, and the method for identifying the watermelon seed coat black edge trait provided in Example 3 are feasible and accurate and can be applied to molecular marker identification of the presence or absence of seed coat black edge in watermelons at the seedling stage.

[0078] Example 5: A kit for identifying the black edge trait of watermelon seed rind

[0079] A kit for identifying the black edge trait of watermelon seed rind comprises the following reagents:

[0080] Chr03_5741584-F and Chr03_5741584-R described in Example 2 (both at 2 pM), 10× PCR Buffer (containing Mg 2+ 15 mM), dNTP (concentration of 10 mM), Taq enzyme (5 U / μL), sterile deionized water.

[0081] Example 6: Method for using a kit for identifying the black edge trait of watermelon seed rind

[0082] (1) Extract the genomic DNA of the watermelon to be tested and adjust the genomic DNA concentration to 30 ng / μL.

[0083] (2) Add samples and reagents according to the following PCR system:

[0084]

[0085]

[0086] (3) PCR amplification was performed. The reaction procedure for PCR amplification was as follows: 94°C pre-denaturation for 7 min, 94°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, 72°C extension for 10 min, and storage at 4°C.

[0087] (4) Detect the PCR product using polyacrylamide gel electrophoresis, and determine the black edge trait of the watermelon seed coat based on the detection results. Specifically, if the amplified product is a 252 bp fragment, it is determined that the seed coat has a black edge trait; if the amplified product is a 261 bp fragment, it is determined that the seed coat does not have a black edge trait. If the watermelon contains SEQ ID NO. 1, the watermelon has a black edge on the seed coat; if the watermelon contains SEQ ID NO. 2, the watermelon does not have a black edge on the seed coat.

[0088] Although the present invention has been disclosed above with reference to preferred embodiments, this is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A molecular marker for identifying the black edge trait of watermelon seed coat, characterized in that: The molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.

2.

2. A primer pair for amplifying and identifying a molecular marker for the black edge trait of watermelon seed rind, characterized in that: The sequences of the primer pair are shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. A kit for identifying the black edge trait of watermelon seed rind, characterized in that: The kit comprises the primer pair according to claim 2, 10×PCR Buffer, dNTP and Taq enzyme.

4. Use of the molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in identifying or screening the black edge trait of watermelon seed coat.

5. The use according to claim 4, characterized in that The trait of watermelon seed coat black edge is that the watermelon seed coat has a black edge or does not have a black edge.

6. The use according to claim 4, characterized in that If the watermelon contains SEQ ID NO.1, the watermelon has a black edge on the seed coat. If the watermelon contains SEQ ID NO.2, the watermelon has no black edge on the seed coat.

7. The use according to claim 4, characterized in that PCR amplification is performed using the primer pair described in claim 2, and the characteristics of the black edge of the watermelon seed coat are judged according to the PCR product. If the amplified product contains a 252bp fragment, it is judged to be a type with a black edge of the seed coat; if the amplified product contains a 261bp fragment, it is judged to be a type without a black edge of the seed coat.

8. A method for identifying the black edge trait of watermelon seed rind, characterized in that: The method described is as follows: Step 1: Extract genomic DNA from the watermelon tissue to be tested; Step 2: Using the DNA obtained in step 1 as a template, perform PCR amplification using the primer pair described in claim 2 to obtain a PCR product to determine the black edge trait of the watermelon seed coat; if the amplified product contains a 252bp fragment, it is determined to be a type with a black edge in the seed coat; if the amplified product contains a 261bp fragment, it is determined to be a type without a black edge in the seed coat.

9. The method according to claim 8, characterized in that The watermelon tissue to be tested in step 1 is watermelon leaves.

10. Use of the molecular marker according to claim 1, the primer pair according to claim 2, the reagent according to claim 3, or the method according to claim 8 or 9 in assisting watermelon breeding or screening watermelon seed coat traits.

Images