Kit for detecting Tau-181 protein and application
Through the dual-antibody sandwich-coupled DNAzyme technology combined with rolling ring amplification and fluorescence detection, the sensitivity and specificity of Tau-181 protein detection was solved, and the accurate detection of low-concentration Tau-181 protein was achieved, which is suitable for early diagnosis and condition monitoring of Alzheimer's disease.
Patent Information
- Application Number
- CN202510745427.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-05
- Publication Date
- 2025-08-22
AI Technical Summary
The existing Tau-181 protein detection methods are cumbersome, time-consuming and difficult to meet the needs of high sensitivity and specificity. Traditional methods are not effective when detecting low-concentration Tau-181 proteins. Emerging technologies such as nucleic acid aptamers and nanomaterials have stability and cost problems.
Using a detection technology based on double-antibody sandwich-coupled DNAzyme, a specific antibody is used to connect the catalytically active DNAzyme components, and quantitative analysis of Tau-181 protein is achieved through rolling ring amplification reaction (RCA) and fluorescence signal detection.
High sensitivity and specificity detection of low-concentration Tau-181 protein is achieved, with a detection limit of 8.26pg/mL, which simplifies the operation process and reduces the sample size requirement. It is suitable for early diagnosis and rapid screening, and is suitable for neuroscience research and clinical diagnosis.
Smart Images

Figure CN120522397A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological detection technology, and in particular to a kit for detecting Tau-181 protein and its application. Background Art
[0002] Alzheimer's disease (AD) is a common neurodegenerative disorder that poses a serious threat to global public health. Its pathogenesis is complex and early diagnosis is difficult. Tau-181 protein is a key biomarker of AD. Abnormal changes in Tau-181 protein in AD patients are closely associated with disease progression. Accurately measuring Tau-181 protein levels in biological samples (such as blood and cerebrospinal fluid) is crucial for early diagnosis, disease monitoring, and treatment efficacy assessment of AD.
[0003] Traditional Tau-181 protein detection methods, such as enzyme-linked immunosorbent assay (ELISA) and Western blotting, have numerous shortcomings. ELISA is cumbersome and time-consuming, requiring a high laboratory environment and personnel; Western blotting suffers from poor quantitative accuracy and requires a large sample volume. Furthermore, these traditional methods struggle to meet the clinical requirements for high sensitivity and specificity when detecting low concentrations of Tau-181 protein.
[0004] Emerging detection technologies based on nucleic acid aptamers and nanomaterials also have limitations. For example, the stability and specificity of nucleic acid aptamers need to be improved, and the preparation and modification of nanomaterials are complex and costly. Therefore, there is an urgent need to develop a new, efficient, sensitive, and specific Tau-181 protein detection technology. In light of this, the present invention provides a kit and application for detecting Tau-181 protein. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a kit and application for detecting Tau-181 protein. The purpose is to provide a Tau-181 protein detection technology based on a double antibody sandwich coupled to a DNAzyme for in vitro quantitative detection of Tau-181 protein content in biological samples. This technology has applications in neuroscience research and clinical diagnosis, particularly in the early diagnosis and disease monitoring of neurodegenerative diseases such as Alzheimer's disease, as well as in the detection and analysis of Tau-181 protein, a disease-related biomarker, during drug development.
[0006] The technical solution of the present invention to solve the above technical problems is as follows:
[0007] In a first aspect, a kit for detecting Tau-181 protein is provided, comprising a first antibody coupled to a first component of a catalytically active DNAzyme, a second antibody coupled to a second component of the catalytically active DNAzyme, phi29 DNA polymerase, dNTPs, a circular DNA template, a primer, a fluorescent beacon probe, and a reaction buffer; the first antibody is specific for an epitope of the Tau-181 protein, and the second antibody is specific for an epitope of the Tau-181 protein; the first component of the catalytically active DNAzyme and the second component of the catalytically active DNAzyme assemble into an active DNAzyme in the presence of the Tau-181 protein.
[0008] On the basis of the above technical solution, the present invention can also be improved as follows.
[0009] Furthermore, the DNA sequence of the first component of the DNAzyme having catalytic activity is shown in SEQ ID NO: 1 (the specific DNA sequence is: GCTAGCATCTGCTAGCTCGATCGATCCATCTCTTCAGTTCGACGTACCGAAAGGTACG);
[0010] The DNA sequence of the second component of the DNAzyme with catalytic activity is shown in SEQ ID NO: 2 (the specific DNA sequence is: TCGAACCTTCAGAGATAGTGAGTCGTACGTACGATCTACGTAGCTACTACGTA).
[0011] Furthermore, the molar ratio of the first component of the DNAzyme having catalytic activity to the first antibody is 1:2-1:10;
[0012] The molar ratio of the second component of the DNAzyme having catalytic activity to the second antibody is 1:2-1:10.
[0013] Furthermore, the first antibody coupled to the first component of the DNAzyme with catalytic activity is prepared by the following method: coupling the first antibody, the first component of the DNAzyme with catalytic activity and a first coupling agent to obtain the first antibody coupled to the first component of the DNAzyme with catalytic activity.
[0014] Furthermore, the first antibody coupled to the first component of the DNAzyme having catalytic activity is prepared by the following specific method:
[0015] preparing the first antibody into a first antibody solution; adding a solution of the first component of the DNAzyme having catalytic activity and a solution of the first coupling agent to the first antibody solution, performing a coupling reaction at 37±0.5° C. for 0.5-2 hours, and sequentially separating and dialyzing to obtain the first antibody coupled with the first component of the DNAzyme having catalytic activity;
[0016] The volume ratio of the first antibody solution, the solution of the first component of the catalytically active DNAzyme, and the solution of the first coupling agent is 1:2-10:5-20; the concentration of the first antibody solution is 1 g / L; the concentration of the solution of the first component of the catalytically active DNAzyme is 10 μM; and the concentration of the solution of the first coupling agent is 10 mg / mL;
[0017] The first coupling agent includes at least one of EDC, Sulfo-NHS, and DMTMM.
[0018] Furthermore, the second antibody coupled to the second component of the DNAzyme with catalytic activity is prepared by the following method: coupling the second antibody, the second component of the DNAzyme with catalytic activity and a second coupling agent to obtain the second antibody coupled to the second component of the DNAzyme with catalytic activity.
[0019] Furthermore, the second antibody coupled to the second component of the DNAzyme having catalytic activity is prepared by the following specific method:
[0020] The second antibody is prepared into a second antibody solution; the solution of the second component of the DNAzyme having catalytic activity and the solution of the second coupling agent are added to the second antibody solution, and the coupling reaction is carried out at 37±0.5° C. for 0.5-2 hours, followed by separation and dialysis to obtain the second antibody coupled with the second component of the DNAzyme having catalytic activity;
[0021] The volume ratio of the second antibody solution, the solution of the second component of the catalytically active DNAzyme, and the solution of the second coupling agent is 1:2-10:5-20; the concentration of the second antibody solution is 1 g / L; the concentration of the solution of the second component of the catalytically active DNAzyme is 10 μM; and the concentration of the solution of the second coupling agent is 10 mg / mL;
[0022] The second coupling agent includes at least one of EDC, Sulfo-NHS, and DMTMM.
[0023] Furthermore, the reaction buffer comprises a phosphate buffer with a concentration of 10mM-50mM, a sodium chloride with a concentration of 100mM-300mM, a potassium chloride with a concentration of 10mM-50mM, a magnesium ion with a concentration of 1mM-5mM, and an ethylenediaminetetraacetic acid with a concentration of 0.1mM-1mM, with a pH value ranging from 7.2 to 7.8.
[0024] Furthermore, the nucleotide sequence of the priming primer is shown in SEQ ID NO: 3 (the specific sequence is as follows: GCTACTAGCTACGTACGTAGTGACAGATGTAGATGAGT);
[0025] The nucleotide sequence of the fluorescent beacon probe is shown in SEQ ID NO: 4 (the specific sequence is as follows: GACTGGCGTATACACTACATGCATCCAGTC).
[0026] In a second aspect, the kit for detecting Tau-181 protein is used to prepare a reagent for detecting Tau-181 protein.
[0027] The functions of the components of the kit for detecting Tau-181 protein of the present invention are as follows: Figure 1 ):
[0028] (1) Antibody part:
[0029] The first antibody (Tau-181 antibody 1) targets a specific epitope of the Tau-181 protein and is conjugated to a specific DNA sequence, the first component of the DNAzyme, to specifically recognize and bind to the Tau-181 protein and provide conditions for DNAzyme assembly;
[0030] Secondary antibody (Tau-181 antibody 2): Targets another specific epitope of the Tau-181 protein, connects to the specific DNA sequence of the second component of the DNAzyme, and synergizes with the primary antibody to form a sandwich structure, enhancing the binding ability to the Tau-181 protein and promoting DNAzyme assembly.
[0031] (2) Primer and probe part:
[0032] Primer: can be cut by active DNAzyme, and the cut fragments can trigger RCA reaction. Its sequence is designed according to the RCA reaction.
[0033] Fluorescent beacon probe: used to detect RCA products, contains a fluorescent group and a quencher group, and its sequence is complementary to the RCA product.
[0034] (3) Reaction buffer system:
[0035] Contains 10mM-50mM phosphate buffer, 100mM-300mM sodium chloride, 10mM-50mM potassium chloride, 1mM-5mM magnesium ion, and 0.1mM-1mM EDTA, pH 7.2-7.8. The phosphate buffer maintains the acid-base balance, the sodium chloride and potassium chloride regulate the ionic strength, the magnesium ion participates in the reaction, and the EDTA chelates interfering ions, providing a suitable environment for the reaction.
[0036] The detection method of the kit for detecting Tau-181 protein of the present invention comprises the following steps:
[0037] (1) Sample pretreatment:
[0038] The sample to be tested is mixed with a first antibody coupled to the first component of a catalytically active DNAzyme and a second antibody coupled to the second component of a catalytically active DNAzyme in a reaction buffer and reacted at 25-37°C for 5-40 minutes to form an antibody-antigen-antibody sandwich complex, allowing the DNAzyme components to approach and assemble into an active form.
[0039] (2) Primer cleavage and RCA reaction initiation:
[0040] The initiating primer is added and the active DNAzyme cuts the primer to produce a primer fragment that can initiate the RCA reaction. Then, the circular template and RCA reaction reagents are added to extend the primer to form a long DNA product.
[0041] (3) Fluorescence detection and quantitative analysis:
[0042] A fluorescent beacon probe is added and hybridized with the RCA product, releasing a fluorescent signal after the fluorophore and quencher separate. The intensity of the fluorescent signal is measured using a fluorescence detector, and the Tau-181 protein concentration in the sample is calculated based on a standard curve established using a Tau-181 protein standard.
[0043] The detection system of the present invention is based on the principle of a double-antibody sandwich method. Two antibodies targeting different specific epitopes of the Tau-181 protein are selected. Specific DNA sequences corresponding to the two components of the catalytically active DNAzyme are connected to the two antibodies through precise chemical coupling technology. When a sample containing the Tau-181 protein is added to the reaction system, the two antibodies specifically bind to it to form a sandwich complex, bringing the connected DNAzyme components into close proximity and assembling into a complete and active DNAzyme. This active DNAzyme can specifically cut a common primer. The cut primer can trigger a rolling circle amplification (RCA) reaction. Finally, the RCA product is detected by a fluorescent beacon probe. The intensity of the fluorescent signal is related to the content of Tau-181 protein in the sample, and quantitative detection is achieved with the help of a pre-established standard curve. Tau-181 protein is an important biomarker for Alzheimer's disease. The present invention provides a highly sensitive and specific method for its detection, which is of great significance for clinical applications such as early diagnosis and disease monitoring of Alzheimer's disease, and helps promote the precision medicine process for related diseases.
[0044] The beneficial effects of the present invention are:
[0045] (1) The innovative combination of the DNAzyme assembly activation mechanism and the RCA signal amplification mechanism introduced in this invention enables the sensitive detection of low-concentration Tau-181 protein with a detection limit of 8.26 pg / mL. Even in the early stages of the disease, when the Tau-181 protein level shows only slight changes, the detection method of the present invention can still accurately capture this subtle signal, providing strong support for the early diagnosis of neurodegenerative diseases such as Alzheimer's disease. Early diagnosis is of decisive significance for the intervention and treatment of the disease and can significantly improve the patient's prognosis and quality of life.
[0046] (2) The entire detection process of the present invention is simple in design, and the operating steps are easy to master, without the need for complex instruments and equipment and cumbersome operating procedures; at the same time, the required sample size is relatively small, which greatly reduces the burden on patients, and the detection time is short, and the test results can be provided quickly, meeting the needs of clinical rapid detection and large-scale screening; this makes the present invention have broad application prospects in clinical practice, and it can not only be widely used in large medical institutions, but also be easy to promote and use in primary medical units or areas with limited resources, providing a practical technical means for early prevention and intervention of diseases. BRIEF DESCRIPTION OF THE DRAWINGS
[0047] Figure 1 It is a schematic diagram of the principle of the present invention;
[0048] Figure 2 This is the fluorescence signal diagram of the present invention;
[0049] Figure 3 This is the fitting curve diagram of the present invention;
[0050] Figure 4 This is a graph showing the reactivity of antibody No. 1 of the present invention with antigens;
[0051] Figure 5 This is a graph showing the reactivity of the antibody No. 2 of the present invention with the antigen;
[0052] Figure 6 This is a graph showing the reactivity of antibody No. 3 of the present invention with antigens;
[0053] Figure 7 is a curve fitting diagram of the antibody combination pair 1 of the present invention and the antigen;
[0054] Figure 8 is a curve fitting diagram of the antibody combination pair 2 of the present invention and the antigen;
[0055] Figure 9 is a correlation fitting diagram between the antibody combination pair 1 of the present invention and the sample;
[0056] Figure 10 This is a correlation fitting diagram between the antibody combination pair 2 of the present invention and the sample. DETAILED DESCRIPTION
[0057] The principles and features of the present invention are described below. The examples are only used to explain the present invention and are not intended to limit the scope of the present invention. Where specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in this field or the product instructions are used. Where the manufacturers of the reagents or instruments used are not specified, they are all conventional products that can be purchased through regular channels.
[0058] Sources of materials and reagents:
[0059] Primary antibody (Shenzhen Heavy Chain Biotechnology Co., Ltd. and Lixing (Beijing) Technology Co., Ltd.); secondary antibody (Shenzhen Heavy Chain Biotechnology Co., Ltd. and Lixing (Beijing) Technology Co., Ltd.); phi29 DNA polymerase (Sangon Biotech (Shanghai) Co., Ltd.); dNTPs (Sangon Biotech (Shanghai) Co., Ltd.); circular DNA template (Sangon Biotech (Shanghai) Co., Ltd.); initiator primer (Sangon Biotech (Shanghai) Co., Ltd.); fluorescent beacon probe (Sangon Biotech (Shanghai) Co., Ltd.); p-Tau-18 protein (Shenzhen Heavy Chain Biotechnology Co., Ltd. and Nanjing Ainodi Biotechnology Co., Ltd.); Sulfo-NHS (Sangon Biotech (Shanghai) Co., Ltd.); EDC (Sangon Biotech (Shanghai) Co., Ltd.).
[0060] Example
[0061] 1. The coupling process of the antibody to a specific DNA sequence (5' end).
[0062] (1) The coupling process of the first antibody and the specific DNA sequence (5' end):
[0063] Prepare 1 mg of the primary antibody (targeting a specific epitope of the Tau-181 protein) and dissolve it in 1 mL of 0.1 M borate buffer (pH 8.5) to form a primary antibody solution.
[0064] Take 100 μL of the primary antibody solution, add 50 μL of a 10 mM solution of a specific DNA sequence (5' end modified with an NH2 group, the sequence is shown in SEQ ID NO: 1), then add 20 μL of a 10 mg / mL first coupling agent (EDC), and react with gentle stirring at 37°C for 1 hour.
[0065] After the reaction is complete, treat the reaction mixture with a Protein A / G column or magnetic beads to separate the antibody from the unbound DNA. Dissociate the antibody to obtain the DNA-conjugated antibody. Collect the primary antibody conjugated to the DNA sequence and dialyze overnight against phosphate-buffered saline (PBS) containing 0.05% bovine serum albumin (BSA). Store at 4°C until needed.
[0066] (2) The coupling process of the second antibody and the specific DNA sequence (3' end):
[0067] 1 mg of the secondary antibody (targeting another specific epitope of the Tau-181 protein) was weighed and dissolved in 1 mL of 0.1 M borate buffer (pH 8.5) to form a secondary antibody solution.
[0068] Take 100 μL of the secondary antibody solution, add 50 μL of a 10 mM solution of a specific DNA sequence (3' end modified with an NH2 group, the sequence is shown in SEQ ID NO: 2), then add 20 μL of a 10 mg / mL coupling agent (Sulfo-NHS), and react at 37°C with gentle stirring for 1 hour.
[0069] After the reaction is complete, treat the reaction mixture with a Protein A / G column or magnetic beads to separate the antibody from the unbound DNA. Dissociate the antibody to obtain the DNA-conjugated antibody. Collect the primary antibody conjugated to the DNA sequence and dialyze overnight against phosphate-buffered saline (PBS) containing 0.05% bovine serum albumin (BSA). Store at 4°C until needed.
[0070] 2. Use the detection kit to establish a standard curve.
[0071] (1) Detection reaction operation:
[0072] like Figure 110 μL of each Tau-181 protein standard solution was added to the corresponding wells of a 96-well plate. To each well, 5 μL of 10X reaction buffer, 5 μL of the primary antibody conjugated to the first component of the catalytically active DNAzyme, 5 μL of the secondary antibody conjugated to the second component of the catalytically active DNAzyme, 2 μL of the initiator primer (sequence shown in SEQ ID NO: 3), 5 U of phi29 DNA polymerase, 1 μL of the circular template, and 2 μL of the fluorescent beacon probe (sequence shown in SEQ ID NO: 4) were added. The volume was brought to a total of 50 μL. The plates were gently shaken to mix, and the plates were incubated in a 37°C incubator for 10 minutes to allow the antibody to bind to the Tau-181 protein and the DNAzyme to assemble and cleave the primer. The plates were then reacted at 55°C for 40 minutes for the RCA reaction.
[0073] (2) Fluorescence detection and data processing
[0074] Use qPCR instrument to detect the fluorescence intensity of each well and record the data. Use the concentration of Tau-181 protein standard as the horizontal axis (X) and the average fluorescence intensity at 20 minutes as the vertical axis (Y) to draw a standard curve using professional data analysis software. Select the appropriate curve fitting model to fit the data and obtain the standard curve equation and related statistical parameters ( Figure 2 and 3 ), which is used to calculate the Tau-181 protein concentration in the subsequent samples to be tested.
[0075] 3. Experimental testing.
[0076] (1) Selection and determination of p-Tau-181 antigen.
[0077] The p-Tau-18 antigen was selected with a protein purity greater than 90% and a protein concentration greater than 0.5 mg / mL, suitable for immunoassays. The p-Tau-18 antigens from the two sources were serially diluted with a protein-containing PBS solution (concentrations of 500 pg / mL, 200 pg / mL, 100 pg / mL, 50 pg / mL, 10 pg / mL, and 0 pg / mL, respectively). Immunoreactivity was then measured using a commercial p-Tau-18 protein assay kit (magnetic microparticle chemiluminescence immunoassay). The results are shown in Table 1.
[0078] Table 1 Comparison of immunological activity of p-Tau-18 antigen materials from different sources
[0079]
[0080] First, p-Tau-18 antigens from two suppliers were diluted to the same concentration as indicated by each supplier. These samples were then assayed for activity using a p-Tau-18 protein assay kit (magnetic microparticle chemiluminescence immunoassay). The results, shown in Table 1, show that at the same antigen concentration, the antigen from Company A exhibited greater activity than the antigen from Company B. Therefore, Company A's p-Tau-18 antigen was preferred in the present invention.
[0081] (2) Selection and determination of coating antibodies.
[0082] Three p-Tau-18 coated antibodies (No. 1, No. 2, and No. 3) were used to label the p-Tau-18 antibody according to the above DNAzyme labeling process to form a DNAzyme Part A-antibody conjugate. The sequence of DNAzyme Part A is shown in SEQ ID NO: 1. The p-Tau-18 antigen was labeled with the p-Tau-18 antigen according to the DNAzyme labeling process to form a DNAzyme Part B-antigen conjugate. The sequence of DNAzyme Part B is shown in SEQ ID NO: 2. The DNAzyme Part B-antigen conjugate was mixed with a high concentration sample and then diluted in a 2-fold gradient. A total of 6 dilution gradients were used as samples for testing to evaluate the reactivity of the Part A antibody with the antigen. The results are shown in Tables 2 and 3. Figure 4-6 .
[0083] Table 2 Reactivity of different brands of DNAzyme-labeled antibodies with antigens
[0084]
[0085]
[0086] At the same dilution factor, all three antibodies reacted well with the antigen and showed better reactivity than antibody No. 2. Therefore, antibodies No. 1 and No. 3 were preliminarily identified.
[0087] (3) Determination and selection of antibody pairs.
[0088] p-Tau-18 antibodies No. 1 and No. 3 were labeled with Part A (sequence as shown in SEQ ID NO: 1) and Part B (sequence as shown in SEQ ID NO: 2) of DNAzyme, respectively, to form antibody combination pair 1 (Antibody No. 1-Part A: Antibody No. 3-Part B) and antibody combination pair 2 (Antibody No. 1-Part B: Antibody No. 3-Part A).
[0089] The p-Tau-18 antigen was gradient diluted to 500pg / mL, 200pg / mL, 100pg / mL, 50pg / mL, 10pg / mL, and 0pg / mL, and tested. The test was repeated 3 times and the average value was calculated. A linear relationship between the end-point fluorescence value and the concentration was established to evaluate the linearity of the reaction between the antibody and the antigen. 20 samples with gradient concentrations were taken to establish a linear relationship between the sample concentration and the end-point fluorescence value to evaluate the correlation between the antibody pair and the sample. The linearity of the reaction between the antibody and the antigen and the correlation between the antibody and the sample were comprehensively evaluated to evaluate the feasibility of the entire system. The results are shown in Tables 3-5 and Figure 7-10 .
[0090] Table 3 Linear relationship between antibody combination 1 and antigen
[0091]
[0092]
[0093] Table 4 Linear relationship between antibody combination pair 2 and antigen
[0094]
[0095] Table 5 Correlation between antibody combination pairs and samples
[0096] Sample serial number Sample concentration Combination 1 Combination 2 1 3.51 3.57 3.3957 2 4.56 4.0726 4.4541 3 8.85 4.116 7.994 4 17.61 6.7634 18.319 5 18.93 11.9868 18.1748 6 24.69 10.9396 31.0527 7 30.78 16.4906 34.9279 8 37.08 20.006 56.1491 9 53.07 26.1352 87.85 10 65.37 41.055 117.6651 11 72.27 39.7656 130.648 12 91.83 40.2696 132.9328 13 108.45 52.7604 176.7598 14 120.24 46.6788 250.5608 15 123.51 52.1654 308.413 16 176.16 46.5682 343.693 17 205.56 50.645 395.8143 18 211.02 60.1888 452.2791 19 226.89 46.1986 430.9739 20 307.89 63.6006 732.5045
[0097] Antibody combination 2 has better reactivity and is more relevant to the sample. Therefore, the labeling combination of Antibody 1-Part B: Antibody 3-Part A was selected.
[0098] (4) Blank limit and detection limit analysis
[0099] Five blank samples and five low-concentration samples were used, and each sample was tested four times. The results are shown below:
[0100] Table 6 Blank sample test results
[0101] Number of tests Blank sample 1 Blank sample 2 Blank sample 3 Blank sample 4 Blank sample 5 1 6.83 7.43 7.25 7.00 7.26 2 7.02 6.72 6.55 6.73 7.33 3 6.68 7.09 7.54 7.20 7.12 4 6.68 6.48 7.45 6.76 6.68
[0102] Table 7 Test results of low-value samples
[0103] Number of tests Low value sample 1 Low value sample 2 Low value sample 3 Low value sample 4 Low value sample 5 1 9.89 9.99 10.65 9.66 10.44 2 9.93 10.10 9.28 9.43 10.67 3 10.21 10.73 10.44 9.77 10.01 4 9.83 9.41 9.91 10.79 9.21
[0104] The data in Tables 6 and 7 were tested for normal distribution. In this study, a nonparametric method was used to evaluate the LoB estimate, and a parametric method was used to evaluate the LoD estimate.
[0105] Nonparametric methods were used to estimate the LoB: The test results for the five blank samples were combined and ranked from lowest to highest. Using a typical Type I error risk of ɑ = 0.05 and a corresponding percentile of P = 1 - ɑ = 0.95, the LoB estimate was calculated. The blank limit for the present invention was 7.45 pg / mL.
[0106] The LoD estimate is evaluated by the parametric method: the combined standard deviation SDz is calculated from the measurement results of multiple low-concentration level samples, and the LoD is calculated according to the following formula.
[0107]
[0108]
[0109] LOD=LOB+kSDz (3);
[0110] Table 8 SDz and LoD calculation of the test results of low LoD value samples
[0111]
[0112] According to Table 8, the detection limit of the present invention is 8.26 pg / mL.
[0113] In summary, the innovative integration of the DNAzyme assembly activation mechanism and the RCA signal amplification mechanism introduced in this invention enables sensitive detection of low concentrations of Tau-181 protein. Even in the early stages of the disease, when Tau-181 protein levels show only slight changes, the detection method of this invention can accurately capture this subtle signal, providing strong support for the early diagnosis of neurodegenerative diseases such as Alzheimer's disease. Early diagnosis is crucial for disease intervention and treatment, significantly improving patient prognosis and quality of life.
[0114] The whole detection process of the present invention is simple in design, and the operation steps are easy to master, without the need for complex instruments and equipment and cumbersome operating procedures. At the same time, the required sample size is relatively small, which greatly reduces the burden on the patient, and the detection time is short, and the test results can be quickly provided, meeting the needs of clinical rapid detection and large-scale screening. This makes the present invention have a wide range of application prospects in clinical practice, and it can not only be widely used in large medical institutions, but also be convenient for promotion and use in primary medical units or resource-limited areas, providing a practical and feasible technical means for early prevention and intervention of diseases.
[0115] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.
Claims
1. A kit for detecting Tau-181 protein, characterized in that: The kit for the Tau-181 protein includes a first antibody coupled to a first component of a catalytically active DNAzyme, a second antibody coupled to a second component of the catalytically active DNAzyme, phi29 DNA polymerase, dNTPs, a circular DNA template, a primer, a fluorescent beacon probe, and a reaction buffer; the first antibody is specific to an epitope of the Tau-181 protein, and the second antibody is specific to an epitope of the Tau-181 protein; the first component of the catalytically active DNAzyme and the second component of the catalytically active DNAzyme assemble into an active DNAzyme in the presence of the Tau-181 protein.
2. A kit for detecting Tau-181 protein according to claim 1, characterized in that: The DNA sequence of the first component of the catalytically active DNAzyme is shown in SEQ ID NO: 1; The DNA sequence of the second component of the DNAzyme having catalytic activity is shown in SEQ ID NO:
2.
3. A kit for detecting Tau-181 protein according to claim 1, characterized in that: The molar ratio of the first component of the catalytically active DNAzyme to the first antibody is 1:2-1:10; The molar ratio of the second component of the DNAzyme having catalytic activity to the second antibody is 1:2-1:
10.
4. A kit for detecting Tau-181 protein according to claim 1, characterized in that: The first antibody coupled to the first component of the DNAzyme with catalytic activity is prepared by the following method: coupling the first antibody, the first component of the DNAzyme with catalytic activity and a first coupling agent to obtain the first antibody coupled to the first component of the DNAzyme with catalytic activity.
5. A kit for detecting Tau-181 protein according to claim 4, characterized in that: The first antibody coupled to the first component of the catalytically active DNAzyme is prepared by the following specific method: preparing the first antibody into a first antibody solution; adding a solution of the first component of the DNAzyme having catalytic activity and a solution of the first coupling agent to the first antibody solution, performing a coupling reaction at 37±0.5° C. for 0.5-2 hours, and sequentially separating and dialyzing to obtain the first antibody coupled with the first component of the DNAzyme having catalytic activity; The volume ratio of the first antibody solution, the solution of the first component of the catalytically active DNAzyme, and the solution of the first coupling agent is 1:2-10:5-20; the concentration of the first antibody solution is 1 g / L; the concentration of the solution of the first component of the catalytically active DNAzyme is 10 μM; and the concentration of the solution of the first coupling agent is 10 mg / mL; The first coupling agent includes at least one of EDC, Sulfo-NHS, and DMTMM.
6. A kit for detecting Tau-181 protein according to claim 1, characterized in that: The second antibody coupled to the second component of the DNAzyme with catalytic activity is prepared by the following method: coupling the second antibody, the second component of the DNAzyme with catalytic activity and a second coupling agent to obtain the second antibody coupled to the second component of the DNAzyme with catalytic activity.
7. A kit for detecting Tau-181 protein according to claim 6, characterized in that: The second antibody coupled to the second component of the catalytically active DNAzyme is prepared by the following specific method: The second antibody is prepared into a second antibody solution; the solution of the second component of the DNAzyme having catalytic activity and the solution of the second coupling agent are added to the second antibody solution, and the coupling reaction is carried out at 37±0.5° C. for 0.5-2 hours, followed by separation and dialysis to obtain the second antibody coupled with the second component of the DNAzyme having catalytic activity; The volume ratio of the second antibody solution, the solution of the second component of the DNAzyme with catalytic activity, and the solution of the second coupling agent is 1:2-10:5-20. The concentration of the second antibody solution is 1 g / L; the concentration of the solution of the second component of the DNAzyme with catalytic activity is 10 μM; and the concentration of the solution of the second coupling agent is 10 mg / mL. The second coupling agent includes at least one of EDC, Sulfo-NHS, and DMTMM.
8. A kit for detecting Tau-181 protein according to claim 1, characterized in that: The reaction buffer comprises a phosphate buffer with a concentration of 10mM-50mM, a sodium chloride with a concentration of 100mM-300mM, a potassium chloride with a concentration of 10mM-50mM, a magnesium ion with a concentration of 1mM-5mM, and an ethylenediaminetetraacetic acid with a concentration of 0.1mM-1mM, with a pH value ranging from 7.2 to 7.
8.
9. A kit for detecting Tau-181 protein according to claim 1, characterized in that: The nucleotide sequence of the priming primer is shown in SEQ ID NO: 3; The nucleotide sequence of the fluorescent beacon probe is shown in SEQ ID NO:
4.
10. Using the kit for detecting Tau-181 protein according to any one of claims 1 to 9 in preparing a reagent for detecting Tau-181 protein.
Citation Information
Patent Citations
Alzheimer's disease marker protein immune PCR detection reagent and kit
CN118006730A
Lead ion detection method based on combination of DNAzyme and rolling circle amplification and application
CN118006740A
Tau protein detection kit of double-antibody sandwich coupled DNAzyme and application of Tau protein detection kit
CN120594842A