Rapid construction method of gill cell line of cyprinid fishes growing in saline-alkali environment

Abstract

The invention discloses a rapid construction method of a gill cell line of cyprinid fishes growing in a saline-alkali environment, and relates to a rapid construction method of a fish cell line. The method comprises the following steps: 1, disinfecting a fish body, and taking gill filaments in the fish body under a sterile condition; 2, temporarily digesting gill tissues; 3, co-culturing the tissue blocks and digestive cells; and 4, constructing a stable passage cell line. The cells obtained by the method disclosed by the invention can still be stably subcultured after being recovered after cryopreservation, the carp cell line can be stably cultured to 50 generations at present, and the crucian carp cell line can be stably cultured to 30 generations at present. The culture method of the gill cells of the cyprinid fishes is simple, can be directly used for research on the stress resistance mechanism of the saline-alkaline environment of the cyprinid fishes, and provides a basic material for research on the saline-alkaline stress resistance of the fishes.

Description

Technical Field

[0001] The invention relates to a method for constructing a fish cell line. Background Art

[0002] Saline-alkali water refers to water with high salinity, alkalinity and mineralization, which cannot be drunk by humans and animals, nor used for agricultural irrigation. Most of the water bodies are in a state of abandonment, including saline-alkali lakes, low-lying saline-alkali land and underground salt water. 7 hm 2 Widely distributed across 19 provinces (autonomous regions, and municipalities) nationwide, the development and utilization of saline-alkali waters for aquaculture has become a new development direction in the fishery industry. The impact of salinity on fish is primarily related to their optimal salinity range and osmotic regulation mechanisms. When salinity fluctuates significantly, fish activate their osmotic regulation mechanisms to maintain osmotic homeostasis, increasing energy consumption and impacting growth (Ge Jianmin, 2023). Furthermore, water alkalinity can also cause severe physiological stress in fish, triggering a series of adverse reactions, including oxidative damage to the liver and spleen, imbalances in the intestinal microbiome, disruption of tight junctions, and elevated blood ammonia nitrogen and endotoxin levels. Ultimately, these reactions can lead to growth retardation and decreased survival (Che Xinghua, 2024).

[0003] Cyprinid fish are the most important aquaculture group in my country, accounting for more than 50% of the existing 800 freshwater aquaculture fish species. Carassius auratus ), for example, demonstrates strong environmental adaptability, such as tolerance to cold, alkali, and hypoxia, enabling it to survive in a variety of harsh environments. It also boasts outstanding economic traits, including strong stress resistance, low aquaculture costs, and ease of processing. The advantages of carp in saline-alkali aquaculture are gradually gaining attention. Currently, carp species such as the Northeastern yarrow (Leuciscus waleckii), Walleye's yarrow (Leuciscus waleckii), and the giant barb (Barbus capito) have been successfully used in saline-alkali water aquaculture (Zhang Shuocheng, 2023).

[0004] Gills are important physiological organs of fish, responsible for gas exchange and osmotic pressure regulation, and are also the main portal for the invasion of external pathogens. In addition, since gill tissue is directly exposed to the water environment, a large number of microbial pollutants are often attached to its surface, which brings special technical challenges to the establishment of gill-derived cell lines. However, it is worth noting that fish gill cells have a strong mitotic ability, and this ability is not affected by the individual development stage, which makes them an ideal source of material for in vitro cell culture. Traditional fish gill cell culture usually uses a single enzymatic digestion method or tissue patch method. Complete digestion causes great damage to the tissue and is not conducive to cell passage and line establishment. However, the tissue patch method has slow cell crawling out (7-10 days to crawl out), which reduces the culture efficiency (Sun Yun, 2021). Researchers have begun using gill cell lines to investigate the mechanisms by which fish respond to alkali, osmotic, or hypoxic stress. For example, a gill cell line from the fish Leuciscus walleye was used to investigate its alkali-tolerant growth characteristics (Xu Yue, 2023); a gill cell line from the Chinese sturgeon was used to study its osmotic regulation mechanism (Fan Jiahui, 2024); and a gill cell line from the giant bream (Braybrook bream) was used to study hypoxic stress (Xu Wenya, 2024). With my country's increasing emphasis on the development and utilization of saline-alkali water resources, saline-alkali aquaculture is experiencing significant development opportunities. Strengthening research on the mechanisms of salt-alkali tolerance in native fish species and cultivating high-quality salt-alkali-tolerant fish are top priorities (Li Mingshuang, 2023). The establishment of a system for constructing gill cell lines for carp fish is becoming increasingly important. Summary of the Invention

[0005] The invention provides a method for quickly constructing a gill cell line of cyprinid fishes for growing in a saline-alkali environment.

[0006] The present invention provides a method for rapidly constructing a gill cell line of a cyprinid fish grown in a saline-alkali environment, which is carried out by the following steps:

[0007] 1. Disinfect the fish and remove the gill filaments from the fish under sterile conditions;

[0008] 2. Gill tissue digestion: Cut the gill filaments from step 1 into 1.5-2.5 mm lengths and briefly digest them with 0.25% trypsin at 26-30°C until the tissue becomes viscous. The volume ratio of gill filament tissue to trypsin is 1:4-5. Then, add M199 complete medium equal to the amount of trypsin to terminate the digestion.

[0009] 3. Prepare patches and digest cells: The digested gill filament tissue was pipetted and centrifuged to obtain a cell and tissue pellet. The cell and tissue pellet was then placed in a T25 culture flask, supplemented with 1 mL of M199 complete medium, and placed in an incubator at 26-30°C for primary culture.

[0010] 4. Establish cell lines: The T25 culture flasks cultured in step 3 were replaced with M199 complete medium the next day, and then replaced every 2 to 3 days. During the entire culture process, subculture was performed after a monolayer of cells had grown. The subcultured cells were 70% to 90% confluent and digested with 0.25% trypsin. The number of cells per cell was 20,000 cells / cm for 1 to 5 generations. 2 , 10000 cells / cm after 6 generations 2 Counting and passage are performed, and the preparation of the gill cell line is completed after passage to P30; wherein the M199 complete culture medium described in steps 2, 3, and 4 is composed of 15% fetal bovine serum, 1% L-glutamine, 1% penicillin-streptomycin-amphotericin mixture, 1% cyprinid fish serum, 1% cyprinid fish embryo extract, 0.02% basic fibroblast growth factor, and the remainder M199 basal culture medium according to volume percentage.

[0011] The present invention provides a method for efficiently culturing carp gill cells by combining trypsin digestion with tissue block patching. Brief trypsin digestion significantly increases the number of primary cells obtained, shortens the time it takes for cells to crawl out of the single patch method, and improves culture efficiency. Combining the digestion method with the gill filament fragment tissue block patching method provides a growth environment for the cells and accelerates the growth of primary cells.

[0012] The present invention provides a culture medium that is beneficial to the growth of gill cells of cyprinid fish, namely, M199 complete culture medium: composed of, by volume, 15% fetal bovine serum, 1% L-glutamine, 1% penicillin-streptomycin-amphotericin mixture, 1% cyprinid fish serum, 1% cyprinid fish embryo extract, 0.02% basic fibroblast growth factor, and the remainder M199 basal culture medium. The 1% cyprinid fish serum, 1% cyprinid fish embryo extract, and 0.02% basic fibroblast growth factor are nutritional components. The high-quality serum and embryo extract provide rich nutrition for cell proliferation; basic fibroblast growth factor promotes the proliferation and migration of gill cells. The cells obtained by the present invention grow rapidly and can rapidly proliferate into a monolayer in 5 days, greatly shortening the culture time compared to the traditional single-cell patch method. The cells obtained by the method of the present invention can still be stably passaged after being frozen and revived. Currently, the carp cell line can be stably cultured to 50 generations, and the crucian carp cell line can be stably cultured to 30 generations.

[0013] The tissue block patch method of the present invention is combined with the digestion method, and the functions and effects of the M199 culture medium are fully utilized in the whole process, thereby improving the culture efficiency and also being able to establish the gill cell line more quickly. The method for culturing gill cells of Cyprinidae fish described in the present invention is simple and can be directly used for the study of the stress resistance mechanism of Cyprinidae fish in saline-alkali environments, providing basic materials for the research on the saline-alkali stress resistance of fish. The method for rapidly constructing the gill cell line of Cyprinidae fish provided by the present invention can not only provide reliable experimental materials for the study of salt-alkali stress mechanism and related gene functions, but can also be expanded to multiple fields such as toxicological evaluation and drug screening. The establishment of this cell line will significantly reduce the demand for live experimental animals and provide a stable and repeatable experimental model for salt-alkali stress resistance research. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The cell growth of the crawling cells of the carp gill tissue in Example 1 under a 4x optical microscope;

[0015] Figure 2 The cell growth conditions of the carp gill cells after passage in Example 1 under a 4x optical microscope and a 10x optical microscope are shown;

[0016] Figure 3 is the growth curve of the optimal culture medium screening of carp gill cells in Example 1;

[0017] Figure 4 This is a chromosome metaphase phase diagram and a prepared chromosome model diagram of carp cells after colchicine treatment in Example 1;

[0018] Figure 5 is the relative expression of the NKA gene in gill cells, gill tissue, and liver in Example 1;

[0019] Figure 6 The cell growth of the crawling cells of the crucian carp gill tissue in Example 2 under a 4x light microscope and a 10x light microscope;

[0020] Figure 7 is the relative cell proliferation rate curve of gill cells under different NaCl concentrations in Example 4;

[0021] Figure 8 is the relative cell proliferation rate curve of gill cells under different concentrations of NaHCO3 in Example 4;

[0022] Figure 9 are the SOD activity values ​​and NaK-ATPase activity values ​​measured for gill cells under different concentrations of NaCl in Example 4;

[0023] Figure 10 These are the SOD activity values ​​and NaK-ATPase activity values ​​measured by gill cells under different concentrations of NaHCO3 in Example 4. DETAILED DESCRIPTION

[0024] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0025] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments may be combined with each other.

[0026] Specific embodiment 1: In this embodiment, a method for rapidly constructing a gill cell line of a cyprinid fish grown in a saline-alkali environment is carried out according to the following steps:

[0027] 1. Disinfect the fish and remove the gill filaments from the fish under sterile conditions;

[0028] 2. Gill tissue digestion: Cut the gill filaments from step 1 into 1.5-2.5 mm lengths and briefly digest them with 0.25% trypsin at 26-30°C until the tissue becomes viscous. The volume ratio of gill filament tissue to trypsin is 1:4-5. Then, add M199 complete medium equal to the amount of trypsin to terminate the digestion.

[0029] 3. Prepare patches and digest cells: The digested gill filament tissue was pipetted and centrifuged to obtain a cell and tissue pellet. The cell and tissue pellet was then placed in a T25 culture flask, supplemented with 1 mL of M199 complete medium, and placed in an incubator at 26-30°C for primary culture.

[0030] 4. Establish cell lines: The T25 culture flasks cultured in step 3 were replaced with M199 complete medium the next day, and then replaced every 2 to 3 days. During the entire culture process, subculture was performed after a monolayer of cells had grown. The subcultured cells were 70% to 90% confluent and digested with 0.25% trypsin. The number of cells per cell was 20,000 cells / cm for 1 to 5 generations. 2 , 10000 cells / cm after 6 generations 2 Counting and passage are performed, and the preparation of the gill cell line is completed after passage to P30; wherein the M199 complete medium described in steps 2, 3, and 4 is composed of 15% fetal bovine serum, 1% L-glutamine, 1% penicillin-streptomycin-amphotericin mixture, 1% cyprinid fish serum, 1% cyprinid fish embryo extract, 0.02% basic fibroblast growth factor, and the remainder M199 basal medium (GIBCO, C11150500BT) according to volume percentage.

[0031] The cyprinid fish selected in step 1 of this embodiment are 6 to 12 months old and are reared in purified water for 48 hours before the experiment.

[0032] The M199 basal culture medium described in this embodiment is a commercial reagent purchased from the market, ThermoFisherScientific 41300039, wherein 10 mL of hepes and 3.4 μl of β-mercaptoethanol are added to every 1 L of M199 basal culture medium.

[0033] The embryo extract in the M199 complete medium in this embodiment is a cyprinid fish embryo extract. Fresh cyprinid fish embryos are manually ground to disrupt the surface of the embryonic membrane, and the cells are disrupted by repeated freezing and thawing (liquid nitrogen - 37°C). The supernatant is then centrifuged at 3500 g for 30 minutes at 4°C, followed by further centrifugation at 18000 g for 30 minutes at 4°C. The supernatant is then filtered through a 0.22 μm filter to obtain the cyprinid fish embryo extract. The protein in the embryo extract provides nutrients for cyprinid fish cell growth.

[0034] The cyprinid serum in the complete M199 medium of this embodiment is obtained by collecting blood from the tail vein of the fish after disinfection. The collected blood is placed in a pre-cooled centrifuge tube soaked in PBS and allowed to stand at 4° C. for 16 hours before extraction.

[0035] In step 4 of this embodiment, after a monolayer of cells has grown for 5 to 7 days, subculture is performed, and the cell fusion reaches 70% to 90% after 2 to 3 days of subculture.

[0036] Specific embodiment 2: This embodiment differs from Specific embodiment 1 in that, in step 1, fish disinfection involves drawing blood from the tail vein, soaking in 0.01% potassium permanganate solution for 20 minutes, drying, and thoroughly disinfecting with 75% ethanol before placing in a sterile environment. Other steps and parameters are the same as those in Specific embodiment 1.

[0037] Specific Embodiment 3: This embodiment differs from Specific Embodiment 1 in that, in step 1, aseptic gill tissue is harvested: gill filaments are rinsed in PBS supplemented with 5% antibiotics, while surface mucus and red blood cells are removed with tweezers. Repeated washing is performed until no visible blood cells are present in PBS. The tissue is then immersed in antibiotics for 5 minutes, and the liquid is discarded by aspiration. Other steps and parameters are the same as those in Specific Embodiment 1.

[0038] The antibiotics used in this embodiment are a mixed antibiotic of penicillin, streptomycin and amphotericin.

[0039] Specific embodiment 4: This embodiment differs from specific embodiment 1 in that the centrifugation condition in step 3 is: centrifugation at 1500 rpm for 6 min. Other steps and parameters are the same as those in specific embodiment 1.

[0040] Specific embodiment 5: This embodiment differs from specific embodiment 1 in that the number of blowing in step 3 is more than 50 times. Other steps and parameters are the same as those in specific embodiment 1.

[0041] Example 1 Construction of carp gill cell line. This example uses carp as the experimental subject.

[0042] 1. Preparation of cell culture medium

[0043] Cell culture was performed using M199 complete medium, which was composed of 15% fetal bovine serum, 1% L-glutamine, 1% penicillin-streptomycin-amphotericin mixture, 1% cyprinid fish serum, 1% cyprinid fish embryo extract, 0.02% basic fibroblast growth factor, and the remainder M199 basal medium in volume percentages.

[0044] 2. Fish Disinfection

[0045] Carp aged 6 to 12 months were raised in purified water for 48 hours. Blood was collected from the tail vein of the fish. The fish were anesthetized and soaked in 0.01% potassium permanganate solution for 20 minutes. The fish were then dried, disinfected with 75% ethanol, and placed in a sterile environment. The collected blood was placed in a pre-cooled centrifuge tube soaked in PBS and allowed to stand at 4°C for 16 hours before processing.

[0046] 3. Aseptic Collection of Gill Tissue

[0047] The gill filaments were rinsed in PBS supplemented with 5% antibiotics. The surface mucus and red blood cells were removed with tweezers while rinsing. The filaments were washed repeatedly for 5 times until there were no obvious blood cells in the PBS. Then, the filaments were immersed in antibiotics for 5 minutes and the liquid was discarded.

[0048] 4. Gill tissue digestion:

[0049] Gill filaments were minced with ophthalmic scissors into pieces approximately 1.5–2.5 mm in length. 0.25% trypsin was added at a ratio of 1:4–5 by volume of gill filament tissue to trypsin, and digestion was performed at 28°C for 30 min. An equal volume of serum-containing M199 complete medium was then added to terminate the digestion.

[0050] 5. Primary Culture:

[0051] The digested gill filament tissue was centrifuged at 1500 rpm for 6 min to obtain cell and tissue precipitates. The obtained cell and tissue precipitates were affixed to a T25 culture flask, supplemented with 1 mL of M199 complete medium, and placed in a 28°C incubator for primary culture. The M199 medium was then replaced every 2 to 3 days. A monolayer of cells was grown after 5 to 7 days. Figure 1 The cell growth of carp gill tissue monolayer cells under 4x light microscope;

[0052] 6. Subculture:

[0053] When the primary culture cells fill the T25 culture flask, subculture them. Aspirate the culture medium, wash the cell surface twice with 2 mL PBS, add 1 mL PBS and 1 mL 0.25% trypsin to digest for 4 min, add 1 mL of the original culture medium after digestion, blow down the cells and mix them, centrifuge at 1500 rpm for 6 min, discard the supernatant, and place the cell pellet into a T75 culture flask that has been rinsed with M199 medium to expand the system. When the cells are 70% to 90% confluent, subculture them. For passages 1 to 5, use 20,000 cells / cm 2 After 6 generations, the cell count was 10,000 cells / cm 2 Perform counting passages ( Figure 2 (The cell growth status of carp gill cells after passage under 4x and 10x light microscopes).

[0054] 7. Determination of the optimal culture medium: DMEM, DMEM / F12, RPM1640 and L15 basal culture medium were used to replace M199 basal culture medium, and the effects of different basal culture media on cell proliferation were detected by CCK8 kit. The results are as follows: Figure 3 As shown in the figure (growth curve of screening the optimal culture medium for carp gill cells), M199 is the optimal culture medium required for gill cells.

[0055] 8. Chromosome counting:

[0056] Chromosome counts were performed on gill cells of carp at the 20th generation. One day before treatment, 10 mL of fresh culture medium was replaced and colchicine was added to culture for 16 hours. After trypsin digestion and resuspension, sections were prepared. Metaphase division phase diagrams of chromosomes were observed and counted under a high-power microscope to prepare chromosome model diagrams ( Figure 4 is a diagram of chromosome metaphase division and a prepared chromosome model diagram after carp cells were treated with colchicine). Figure 4 Analysis showed that the number of chromosomes counted was 2n=100. After karyotype analysis, the results showed that among the 100 chromosomes in the gill cells of mirror carp, there were 15 pairs of median centromere chromosomes (m), 13 pairs of sub-median centromere chromosomes (sm) and 22 pairs of sub-telomeric centromere chromosomes (st). The karyotype formula was 2n=30m+26sm+44st, which was consistent with the chromosome characteristics of mirror carp.

[0057] IX. Detection of gene expression of gill cell highly expressed genes (NKA)

[0058] RNA was extracted from the 20th generation carp gill cells in the proliferation stage. －△△CTThe relative expression of NKA gene in gill cells, gill tissue and liver was detected by the method. The sequences of 18S internal reference primers were F: ACGATCAGATACCGTCGTAGTTCC, R: CTGTCAATCCTTTCCGTGTCCG, and the sequences of primers for high expression of NKA in gill cells were F: GCTCGTGCGTCGATGAAGAA, R: CCTTTTCCTCCCTCGGACAG. Figure 5 is the relative expression of NKA gene in gill cells (cell), gill tissue (S) and liver (GZ). Figure 5 It can be seen that the NKA gene is highly expressed in this cell line, second only to gill tissue and much higher than liver tissue.

[0059] The carp gill cells prepared by the present invention have been propagated for more than 50 generations. The cells are passaged at a ratio of 1:3 (1 bottle is passed to 3 bottles), and one generation can be achieved in 2 to 3 days. During the culture period, the cells grow stably and proliferate rapidly, thereby obtaining a stable genetic carp gill cell line.

[0060] Example 2 Construction of Crucian Carp Gill Cell Line. This example uses Crucian Carp as the research object.

[0061] 1. Disinfection and Sampling

[0062] Healthy one-year-old colored crucian carp and Dali Lake alkali crucian carp were selected and housed in purified water for 48 hours. After anesthesia, blood was collected from the tail vein and placed in a 15 mL centrifuge tube soaked in pre-chilled PBS. The blood was allowed to rest at 4°C for 16 hours before serum separation. The fish were then soaked in 0.01% potassium permanganate solution for 20 minutes, wiped dry, thoroughly disinfected with 75% ethanol, and placed in a sterile environment. The entire gill arch was removed and placed in a Petri dish for later use.

[0063] 2. Tissue Cleaning

[0064] The gill filaments were rinsed in PBS supplemented with 5% antibiotics, and surface mucus and red blood cells were removed with tweezers while rinsing. After repeated washing for 5 times until there were no obvious blood cells in the PBS, the gill filaments were cut with ophthalmic scissors, thoroughly rinsed, and soaked in antibiotics for 5 minutes, and the liquid was discarded;

[0065] 3. Gill tissue digestion:

[0066] Use ophthalmic scissors to fully mince the gill filaments into approximately 1.5 to 2.5 mm lengths. Add 0.25% trypsin at a volume ratio of 1:4 to 5 for gill filament tissue and trypsin. Digest at 28°C for 30 min, then add an equal volume of serum-containing M199 complete medium to terminate the digestion.

[0067] 5. Primary Culture:

[0068] The digested gill filament tissue was centrifuged at 1500 rpm for 6 min, and the resulting cell and tissue pellets were attached to a T25 culture flask. 1 mL of M199 complete medium was added and placed in a 28°C incubator for primary culture. The M199 medium was then replaced every 2 to 3 days. A monolayer of cells was grown after 5 to 7 days. Figure 6 The cell growth of crawling cells in crucian carp gill tissue under 4x and 10x microscopes);

[0069] 6. Subculture:

[0070] After the primary culture cells have filled the T25 culture flask, subculture them. Aspirate the culture medium, wash the cell layer twice with 2 mL of PBS, and add 1 mL of PBS and 1 mL of 0.25% trypsin to digest for 4 minutes to terminate the digestion. Filter the tissue fragments and subculture them. For passages 1-5, use 20,000 cells / cm 2 After 6 generations, the cell count was 10,000 cells / cm 2 Perform counting passages.

[0071] The crucian carp gill cells prepared by the present invention have been passaged to the 30th generation. The cells are passaged at a ratio of 1:3 (1 bottle to 3 bottles), and one generation can be achieved in 2 to 3 days. During the culture period, the cells grow stably and proliferate rapidly, thereby obtaining a stable genetic crucian carp gill cell line.

[0072] Example 3 Cryopreservation and thawing of gill cell lines

[0073] 1. Cell Cryopreservation

[0074] The culture medium was changed one day before freezing, and the gill cells in the logarithmic growth phase were digested and collected. After centrifugation, the cells were counted and resuspended in pre-cooled freezing solution to a concentration of 1×10 6 cells / mL, transfer the cell suspension into cryovials and label the tubes with the cell name, cell passage number, cell number, and freezing date. Place the cryovials in a 4°C pre-cooled programmed cooling box, first at -20°C for 30 minutes, then transfer to a -80°C freezer overnight. The next day, transfer to a liquid nitrogen tank for long-term storage. The freezing solution consists of 10% DMSO and 90% fetal bovine serum.

[0075] 2. Cell Recovery

[0076] Remove the frozen gill cells and quickly place them in a 37°C water bath, shake them continuously until they melt, transfer them into a 9 mL centrifuge tube containing M199 complete medium with 15% fetal bovine serum, pipette gently, and centrifuge at 1300 rpm for 5 min; remove the upper waste liquid containing DMSO, resuspend the cell pellet with M199 complete medium, transfer it to a T25 culture flask with the bottom rinsed with M199 complete medium, shake it evenly, and place it in a 28°C incubator for culture. Change the medium after 16 h.

[0077] Example 4: Effects of saline-alkali environment on carp gill cells

[0078] Different salinities of NaCl and different alkalinities of NaHCO3 were set to simulate saline-alkali environment.

[0079] The NaCl salinity was set to 6 gradients: 1‰, 2‰, 4‰, 6‰, 8‰, and 10‰. Weigh NaCl and dissolve it in M199 complete medium. After dissolution, filter it through a 0.22 μm filter.

[0080] Set the NaHCO3 alkalinity to 7 levels: 2.5, 5, 7.5, 10, 12.5, 25, and 50 mmol / L. Weigh NaHCO3 and dissolve it in M199 complete medium. After dissolution, filter it through a 0.22 μm filter.

[0081] Carp gill cells at the 46th generation of logarithmic growth phase were digested, counted, and resuspended in different concentrations of salt and alkaline culture medium to adjust the density to 5×10 4 Cell suspensions of 100 cells / mL were plated in 6 wells at each concentration and placed in a 28°C incubator. Cultures were continued for 24, 48, and 72 hours. 10 μL of CCK8 was then added. The cells were then incubated at 28°C for 2.5 hours. The OD value of each well was measured at 450 nm using a microplate reader. The relative cell proliferation rate was calculated as:

[0082] Relative cell proliferation rate = (OD value of experimental group - OD value of blank control) / (OD value of control group - OD value of blank control) × 100%

[0083] GraphPad Prism 9 was used to draw a line graph of cell proliferation rate.

[0084] Figure 7 This is the relative cell proliferation rate curve of gill cells under different NaCl concentrations. Under salinity stress, the relative cell proliferation rate showed the same trend in the three time periods, reaching the highest when the salinity was 2‰, dropping to the lowest when the salinity was 6‰, and then tending to be flat.

[0085] Figure 8Figure 3 is the relative proliferation rate curve of gill cells under different NaHCO3 concentrations. Under alkalinity stress, the cell proliferation curve at 24 h first increased and then decreased, with the maximum proliferation rate occurring at an alkalinity of 7.5 mmol / L. The curves at 48 h and 72 h first decreased, then increased, and then decreased again, with the maximum value of the increasing process also occurring at an alkalinity of 7.5 mmol / L.

[0086] According to the relative proliferation rate curves of gill cells under different NaCl and NaHCO3 concentrations, NaCl concentrations of 2‰ and 6‰ and NaHCO3 concentrations of 2.5, 7.5, and 25 mmol / L were selected for further experiments and named as CL2 group, CL6 group, O1 group, O2 group, and O3 group, respectively.

[0087] Carp gill cells at the 46th generation of logarithmic growth phase were digested, resuspended, and passaged at a ratio of 1:3. When the cell confluence reached 60-70%, the normal M199 medium was replaced with M199 medium with salinity of 2‰, 6‰, and alkalinity of 2.5, 7.5, and 25 mmol / L. After culturing for 72 h, the cells were collected and the SOD activity and NaK-ATPase activity were detected, respectively.

[0088] The trends of different groups measured by SOD kit and NaK-ATP kit were the same.

[0089] Figure 9 The SOD activity value and NaK-ATPase activity value measured in gill cells under different concentrations of NaCl. In the salinity groups, the activities of the two enzymes were higher in the CL2 group than in the control group, and lower in the CL6 group than in the control group. Figure 9 shown.

[0090] Figure 10 The SOD activity values ​​and NaK-ATPase activity values ​​were measured in gill cells under different concentrations of NaHCO3. In the alkalinity group, the SOD activity values ​​varied greatly among the groups, with the O1 group being significantly higher than the O2 group and the O3 group, and there was no significant difference between the O3 group and the control group. The NaK-ATPase activity showed an overall downward trend, with the control group having the highest value and the O3 group having the lowest value. Except for the significant difference between the O1 and O2 groups, the differences between the other adjacent groups were not significant, while the differences between non-adjacent groups were significant.

Claims

1. A method for rapidly constructing a gill cell line of a cyprinid fish grown in a saline-alkali environment, characterized in that The rapid construction method of gill cell lines of cyprinid fish grown in saline-alkali environment is carried out according to the following steps:

1. Disinfect the fish and remove the gill filaments from the fish under sterile conditions; 2. Gill tissue digestion: Cut the gill filaments from step 1 into 1.5-2.5 mm lengths and briefly digest them with 0.25% trypsin at 26-30°C until the tissue becomes viscous. The volume ratio of gill filament tissue to trypsin is 1:4-5. Then, add M199 complete medium equal to the amount of trypsin to terminate the digestion.

3. Prepare patches and digest cells: The digested gill filament tissue was pipetted and centrifuged to obtain cell and tissue pellets. The cell and tissue pellets were then placed in a T25 culture flask, supplemented with 1 mL of M199 complete medium, and placed in an incubator at 26-30°C for primary culture.

4. Establish cell lines: The T25 culture flasks cultured in step 3 were replaced with M199 complete medium the next day, and then replaced every 2 to 3 days. During the entire culture process, subculture was performed after a monolayer of cells had grown. The subcultured cells were 70% to 90% confluent and digested with 0.25% trypsin. The number of cells per cell was 20,000 cells / cm for 1 to 5 generations. 2 , 10000 cells / cm after 6 generations 2 Counting and passage are performed, and the preparation of the gill cell line is completed after passage to P30; wherein the M199 complete culture medium described in steps 2, 3, and 4 is composed of 15% fetal bovine serum, 1% L-glutamine, 1% penicillin-streptomycin-amphotericin mixture, 1% cyprinid fish serum, 1% cyprinid fish embryo extract, 0.02% basic fibroblast growth factor, and the remainder M199 basal culture medium according to volume percentage.

2. The method for rapidly constructing a gill cell line of a cyprinid fish grown in a saline-alkali environment according to claim 1, characterized in that Method for fish disinfection in step 1: blood was collected from the tail vein, and the fish was soaked in 0.01% potassium permanganate solution for 20 min. The fish was wiped dry and thoroughly disinfected with 75% ethanol before being placed in a sterile environment.

3. The method for rapidly constructing a gill cell line of a cyprinid fish grown in a saline-alkali environment according to claim 1, characterized in that In step 1, aseptically obtain gill tissue: rinse the gill filaments in PBS supplemented with 5% antibiotics, and use tweezers to remove surface mucus and red blood cells while rinsing. Wash repeatedly until there are no obvious blood cells in PBS, then soak in antibiotics for 5 minutes and discard the liquid.

4. The method for rapidly constructing a gill cell line of a cyprinid fish grown in a saline-alkali environment according to claim 1, characterized in that Centrifugation conditions in step 3: Centrifuge at 1500 rpm for 6 min.

5. The method for rapidly constructing a gill cell line of a cyprinid fish grown in a saline-alkali environment according to claim 1, characterized in that In step 3, the number of blowing and beating is more than 50 times.

Images