Application of SNP (Single Nucleotide Polymorphism) labeled primer pair of swine chromosome 3 in African swine fever resistance breeding

By developing SNP markers and primer pairs on pig chromosome 3, combined with PCR amplification and sequencing technology, the time-consuming and labor-intensive problem of traditional breeding methods is solved, and the rapid screening of pig populations with strong ability to tolerate African swine fever is achieved, improving the tolerance and economic benefits of pig herds.

CN120536588APending Publication Date: 2025-08-26NANJING AGRICULTURAL UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510595474.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-01-21
Filing Date
2025-05-09
Publication Date
2025-08-26

AI Technical Summary

Technical Problem

Traditional breeding methods have limited effectiveness in improving pig herds' resistance to African swine fever, and are time-consuming and labor-intensive. The lack of effective vaccines and treatments makes it difficult to control the spread of African swine fever.

Method used

SNP markers related to African swine fever tolerant on pig chromosome 3 were developed, and corresponding primer pairs were designed. The A/G polymorphism of the SNP marker site in the pig herd was quickly detected through PCR amplification and sequencing technology, and the pig herd with stronger tolerance were screened out.

Benefits of technology

By quickly and accurately assessing the tolerance of the pig herd, the tolerance of pig herds to African swine fever is improved, the production cost is reduced, and it provides an important molecular genetic basis for breeding, which improves economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120536588A_ABST
    Figure CN120536588A_ABST
Patent Text Reader

Abstract

The invention relates to application of a pig chromosome 3 SNP (Single Nucleotide Polymorphism) labeled primer pair in African swine fever resistance breeding. The SNP marker is located at an rs331275432 nucleotide site of a pig chromosome 3, and the site of the SNP marker is a molecular marker of the rs331275432 nucleotide site of the pig chromosome 3 in a reference sequence of an international pig genome version 11.1, and has A / G polymorphism. According to a primer pair for detecting the SNP marker, an upstream primer is SEQ ID NO: 2, and a downstream primer is SEQ ID NO: 3. The SNP marker provided by the invention can be applied to marker-assisted selection of the African swine fever traits tolerant to pigs, and the genotype of the SNP marker is identified to screen pig populations or strains tolerant to the African swine fever traits. Establishment of the group or the strain can improve the capacity of resisting the swine African swine fever, and more social and economic benefits can be generated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology and relates to a SNP marker primer pair related to the African swine fever tolerance trait of pigs and an application thereof. Background Art

[0002] African swine fever (ASF), an acute, highly contagious disease of pigs caused by the African swine fever virus (ASFV), has become a major challenge for the global swine industry. The disease not only causes extremely high mortality rates but also severely impacts pig productivity, including growth rate and reproductive rate, resulting in significant economic losses for the industry. ASF can be transmitted through various routes, including direct contact, airborne transmission, and contaminated feed and equipment. Therefore, controlling the spread of the disease is extremely difficult, and there is a lack of effective vaccines and treatments.

[0003] African swine fever tolerance is a complex, polygenic trait influenced by multiple factors, including the environment, immune system, and genetic background. Due to the low heritability of this trait and the complex influencing factors, traditional breeding methods have been limited in their effectiveness in improving pig herds' resistance to African swine fever, and progress has been slow. In recent years, with the development of molecular genetics, researchers have begun exploring the relationship between single nucleotide polymorphism (SNP) markers and pig herds' resistance to African swine fever, using methods such as genomic selection and marker-assisted breeding to accelerate the development of resistant pig breeds. Research in this area provides new ideas and technical support for improving the prevention and control of African swine fever.

[0004] Against this backdrop, this patent proposes a SNP marker primer pair associated with African swine fever tolerance in pigs. This technology allows for rapid and accurate assessment of pig tolerance to African swine fever through genotyping. This technology not only reduces production costs and improves the tolerance of pigs to African swine fever, but also provides an important molecular genetic basis for pig breeding and improvement. Summary of the Invention

[0005] The purpose of the present invention is to provide a breeding molecular marker developed from SNP markers related to pig tolerance to African swine fever, as the traditional breeding of pigs to tolerate African swine fever is time-consuming and labor-intensive, with slow breeding effects and little progress.

[0006] Another object of the present invention is to provide a primer pair and a detection method for detecting the above-mentioned SNP marker.

[0007] Another object of the present invention is to provide uses of the above-mentioned SNP markers, molecular markers, and primers.

[0008] The purpose of the present invention can be achieved through the following technical solutions:

[0009] A molecular marker on pig chromosome 3 that is associated with the pig's tolerance to African swine fever, the molecular marker sequence is shown in SEQ ID NO: 1, which contains a SNP marker site associated with the pig's tolerance to African swine fever, which is the rs331275432 nucleotide site on pig chromosome 3 of the international porcine genome version 11.1 reference sequence. The SNP marker site described in SEQ ID NO: 1 is located at position 389 and has an A / G polymorphism.

[0010] The molecular marker sequence shown in SEQ ID NO: 1 is as follows:

[0011] CACAGCACGTGCAAAACGACCCCAGGTGTCCTTGGCTTCAATTTCTAACTTCTGATCTGGCATC

[0012] CAGGCAGGTGCCTGAGGTCAACTGAGCTGGGCTCTTGGTCCCAGCCCAGCCGCGAGGGAGCCTGGGAAA

[0013] GGGCATCTCTGGGACGTTCAGCTTCTCTGTGAAAGGCGGGCTATATGAAGAGGGTTCAACATCAACTCT

[0014] ACTTCACTAAAATGTTTTTAAAAATAAAGAAATATCATGTCCTGAAACCAGGGGGCAAAAAAGAAGGCT

[0015] TGGAAGAAGGACAGTTATCACTGTACCAGGAATGCAAATGAAGGTATGGATTTCAGTGGCTTTGCAGAC

[0016] CTCCTCCTCGGAGGGAACGTGCCTCCACCACTGAAGGAAATGAAGGAGCTCCCAGCCATGACGATGTTA

[0017] TTAACTCCTAAGGTGAGCCCTCCACTTCCTTAGCGGAAGCTCTGGCCCTGCAATTTGAAAGCAGCCCTG

[0018] CGCCCATGCATCATGGTTTCTGATCAGCGTGCAAGGAGGCTGGCCTGAACCACTGCCCGTGACACCAAC

[0019] AGCAGGTGTTTCCATCGCTGCTCCTCCGATCAGCCCGTCTGACTTGTCGAGGCTTTTACACCAACC

[0020] CGGAAGGC

[0021] A primer pair for detecting a SNP marker associated with the African swine fever tolerance trait of pigs, wherein the upstream primer is SEQ ID NO: 2 and the downstream primer is SEQ ID NO: 3.

[0022] A method for detecting the SNP marker associated with the African swine fever tolerance trait of pigs comprises PCR amplifying a sequence of the rs331275432 nucleotide site of pig chromosome 3 in the International Swine Genome Version 11.1 reference sequence, sequencing the amplified product, and interpreting the A / G polymorphism of the site.

[0023] As a further preference of the present invention, the method comprises the following steps:

[0024] (1) Extract DNA from pig ear tissue samples;

[0025] (2) using the extracted porcine genomic DNA as a template and performing PCR amplification using the primer pair described in the present invention;

[0026] (3) The amplified product was sequenced, the sequencing results were analyzed, and the A / G polymorphism at position 389 of SEQ ID NO: 1 was interpreted.

[0027] The molecular markers of the present invention are used to screen pig populations or new strains with stronger tolerance to African swine fever.

[0028] The primer pairs of the present invention are used in screening pig populations or new strains with stronger tolerance to African swine fever.

[0029] A method for screening a pig population with a stronger ability to tolerate African swine fever, comprising detecting the genotype of the rs331275432 nucleotide site on chromosome 3 of the reference sequence of the International Swine Genome Version 11.1, and selecting AA-type individuals at the rs331275432 nucleotide site as reserve breeding pigs.

[0030] As a preferred embodiment of the present invention, the pig breeds used are purebred pigs and hybrid pigs for commercial production.

[0031] As a preferred embodiment of the present invention, the method for detecting the genotype of the nucleotide site rs331275432 of pig chromosome 3 in the International Porcine Genome Version 11.1 reference sequence is selected from PCR or gene sequencing.

[0032] Beneficial effects

[0033] This invention develops a single-nucleotide polymorphism (SNP) marker on porcine chromosome 3 that is associated with African swine fever tolerance in pigs, and provides primer pairs and methods for detecting this marker. By identifying the genotype of this SNP marker, pig strains with enhanced tolerance to African swine fever can be screened. The establishment of such strains can improve pig tolerance to African swine fever and generate greater social and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Gel image of PCR amplification of the rs331275432 site on chromosome 3 in purebred and hybrid pigs for commercial production.

[0035] Figure 2 This is an example of the genotyping map of the rs331275432 locus on chromosome 3 in purebred and hybrid pigs for commercial production.

[0036] Note: The genotype of A is GG, the genotype of B is AG, and the genotype of C is AA. Specific implementation plan

[0037] The following examples are provided to illustrate the present invention but are not intended to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0038] Example 1

[0039] 1. Data Source

[0040] The pig farm is confidential, and the breeds are purebred pigs and hybrid pigs for commercial production

[0041] 2 Extraction of pig genomic DNA

[0042] Ear tissue samples from 474 purebred and crossbred pigs used for commercial production were collected for individual DNA extraction;

[0043] Refer to the instructions of the tissue DNA extraction kit of Tiangen Biotechnology Co., Ltd. The extraction steps are as follows:

[0044] ① First, add 68 mL of anhydrous ethanol to buffer GD and 200 mL of anhydrous ethanol to rinse solution PW, respectively, and mix thoroughly.

[0045] ② Collect approximately 100 mg of ear tissue sample and place it in a 2 mL EP tube. After completely mincing, add 200 μL of buffer GA and shake until completely suspended.

[0046] ③ Add 20 μL of proteinase K solution, mix well, and digest in a 56°C water bath overnight until the tissue sample is dissolved. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0047] ④ Add 200 μL of buffer GB, mix thoroughly by inversion, and place in a 70°C metal bath for 10 min. The solution should become clear. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0048] ⑤ Add 200 μL of anhydrous ethanol and shake thoroughly for 15 seconds. Flocculent precipitation may appear at this time. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0049] ⑥ Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3, place the adsorption column in a collection tube, and then centrifuge at 12,000 rpm for 30 seconds. Discard the waste liquid and place the adsorption column CB3 back into the collection tube.

[0050] ⑦ Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 into the collection tube.

[0051] ⑧ Add 600 μL of rinse solution PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.

[0052] ⑨Repeat step ⑧.

[0053] ⑩ Return the adsorption column CB3 to the collection tube and centrifuge at 12,000 rpm for 2 minutes. Discard the waste liquid. Leave the adsorption column CB3 at room temperature for several minutes to completely dry any remaining rinse solution from the adsorption material.

[0054] Transfer the adsorption column CB3 to a clean centrifuge tube, add 100 μL of elution buffer TE to the middle part of the adsorption membrane, let it stand at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 2 minutes, collect the solution into a centrifuge tube, add the solution obtained by centrifugation to the adsorption column CB3, let it stand at room temperature for 2 minutes, centrifuge at 12,000 rpm for 2 minutes, and collect the solution into a centrifuge tube.

[0055] The quality and concentration of DNA were detected using a Nanodrop-2000 spectrophotometer. The DNA concentration was diluted to 50 ng / μL and stored at -20°C until use.

[0056] 3Antigen detection

[0057] ① Add 29.4uA buffer to each dry powder reaction tube

[0058] ② Add 2uL upstream primer, 2μL downstream primer and 0.6μL probe to each reaction tube

[0059] ③ Add 5 μL nucleic acid template and 8.5 μL ddH2O to the reaction tube in sequence.

[0060] ④Finally, add 2.5 μL of LB buffer to the reaction tube and mix thoroughly.

[0061] ⑤ After mixing, shake the reaction solution to the bottom of the tube and immediately place the reaction tube into the fluorescence detection device. The fluorescence detection program is set as follows: constant temperature 39°C; fluorescence signal acquisition every 30 seconds (the signal acquisition channel is selected in accordance with the fluorescence probe design); reaction time 20 minutes.

[0062] 4 Antibody detection

[0063] 5. PCR amplification and sequencing of target fragments

[0064] PCR amplification was performed using genomic DNA from commercial purebred and hybrid pigs as templates. The reaction system included 1 μL of DNA template, 1 μL each of the primers shown in SEQ ID NO: 2 (CACAGCACGTGCAAAACGA) and SEQ ID NO: 3 (GCCTTCCGGGTTGGTGTATAA), and 22 μL of PCR mix. The amplification procedure was as follows:

[0065]

[0066] The amplified product was subjected to agarose gel electrophoresis, and the product fragment size was about 625bp. The electrophoresis results were as follows Figure 1 The remaining amplified products were sequenced, and the sequencing results were compared with DNAman software to verify the accuracy of the sequence. Chromas software was used to type the rs331275432 site.

[0067] 4 Statistical analysis

[0068] The genotype-phenotype association analysis was performed using the editor of SAS 9.4 software. The code is as follows:

[0069]

[0070] 5 Results

[0071] Table 1 shows the effects of different genotypes at the rs331275432 locus on the tolerance of purebred and hybrid pigs to African swine fever (ASF-SR) in commercial production. The results showed that the genotype at the rs331275432 locus was significantly associated with disease resistance (P < 0.001). Among them, individuals with the AA allele had significantly higher disease resistance than those with the GG allele (P < 0.001). Furthermore, significant differences in disease resistance were observed between the AA and AG alleles, as well as between the AG and GG alleles (P < 0.05). Therefore, in selective breeding for disease resistance, the A allele at rs331275432, particularly the AA allele, is beneficial for improving individual disease resistance and economic benefits.

[0072] Table 1 Association analysis between the rs331275432 locus on pig chromosome 3 and the rate of resistance to African swine fever

[0073]

[0074] Note: The percentage values ​​in the table represent the mortality rate.

[0075] Numbers in the same row with different letters indicate significant differences (P<0.001).

Claims

1. A molecular marker associated with African swine fever tolerance in pigs, characterized in that The molecular marker sequence is shown in SEQ ID NO: 1, which contains a SNP marker site related to the pig's tolerance to African swine fever. The site is the rs331275432 nucleotide site on chromosome 3 of the international swine genome version 11.1 reference sequence. The SNP marker site described in SEQ ID NO: 1 is located at position 389 and has an A / G polymorphism. The AA type pig individuals have significantly higher resistance to African swine fever than the GG type individuals.

2. A primer pair for detecting SNP markers associated with African swine fever tolerance in pigs, characterized in that The upstream primer is: SEQ ID NO: 2, and the downstream primer is: SEQ ID NO: 3; the SNP marker associated with the African swine fever tolerance trait of pigs is located at the rs331275432 nucleotide site on pig chromosome 3. The site of the SNP marker is a molecular marker at the rs331275432 nucleotide site on pig chromosome 3 of the international pig genome version 11.1 reference sequence, and has an A / G polymorphism. The disease resistance of AA type pig individuals to African swine fever is significantly higher than that of GG type individuals.

3. A method for detecting the SNP marker associated with the African swine fever tolerance trait of pigs as claimed in claim 2, characterized in that The method comprises amplifying a section of the nucleotide site rs331275432 of the pig chromosome 3 of the international pig genome version 11.1 reference sequence by PCR, sequencing the amplified product, and interpreting the A / G polymorphism of the site.

4. The use according to claim 3, characterized in that The pigs are purebred pigs and hybrid pigs for commercial production.

5. The method according to claim 3, characterized in that The pig genomic DNA is amplified by PCR using the primer pair described in claim 2.

6. The method according to claim 5, characterized in that The following steps are involved: (1) Extract total DNA from pig tissue samples; (2) using the extracted porcine genomic DNA as a template and performing PCR amplification using the primer pair described in claim 2; (3) The amplified product was sequenced, the sequencing results were analyzed, and the A / G polymorphism at position 389 of SEQ ID NO: 1 was interpreted.

7. The application of SNP markers related to the pig's tolerance to African swine fever in screening pig populations resistant to African swine fever. The site of the SNP marker is a molecular marker at the rs331275432 nucleotide site of the pig chromosome 3 in the international pig genome version 11.1 reference sequence, and has an A / G polymorphism. AA type pig individuals have significantly higher resistance to African swine fever than GG type individuals.

8. Use of the molecular marker according to claim 1 in screening a population resistant to African swine fever.

9. Use of the primer pair according to claim 2 in screening a population resistant to African swine fever.

10. A method for screening a pig population resistant to African swine fever, characterized in that This includes detecting the genotype of the rs331275432 nucleotide site on chromosome 3 of the international pig genome version 11.1 reference sequence, and selecting AA type individuals at the rs331275432 nucleotide site as reserve breeding pigs.