CAPS molecular marker for identifying aphid resistance character of sorghum and application of CAPS molecular marker
Through whole-genome resequencing analysis and CAPS molecular marker technology, SNP sites related to sorghum aphid resistance were identified, primer pairs were designed, and enzyme digestion was used to identify the aphid resistance trait of sorghum, which solved the problem of scarce sorghum aphid-resistant germplasm resources and achieved efficient and accurate aphid resistance trait identification and breeding support.
Patent Information
- Application Number
- CN202510927863.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-07
- Publication Date
- 2025-09-09
AI Technical Summary
In the existing technology, sorghum aphid-resistant germplasm resources are scarce, breeding progress is slow, chemical control methods are time-consuming and labor-intensive and cause serious environmental pollution, and there is a lack of effective molecular markers for the identification and breeding of sorghum aphid-resistant traits.
Through whole-genome resequencing analysis, SNP sites related to sorghum aphid resistance were identified, CAPS molecular marker primer pairs were designed, and sorghum aphid resistance traits were identified using PCR amplification and restriction endonuclease Msc I digestion, developing an efficient molecular marker resource.
It has achieved rapid and accurate identification of sorghum aphid-resistant traits, screened out highly aphid-resistant materials, supported sorghum aphid-resistant breeding and trait screening, and provided a new molecular marker-assisted selection method.
Smart Images

Figure CN120608172A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular marker assisted breeding, in particular to a CAPS molecular marker for identifying aphid-resistance traits of sorghum and an application thereof. Background Art
[0002] The sorghum aphid (Malanaphis sacchari) is a widespread agricultural pest of the order Homoptera, family Aphididae. It causes widespread losses in sorghum yield and quality. Annually, aphid infestations cause sorghum yield losses of 40-70%. If left uncontrolled, aphids can even lead to total crop failure. The numerous plant viruses they carry with them can also impact food and feed safety. However, current aphid control is extremely difficult, relying on the use of chemical agents, which are time-consuming, labor-intensive, and cause significant environmental pollution. Furthermore, the scarcity of aphid-resistant sorghum germplasm and the inadequate development and utilization of existing aphid-resistant germplasm have slowed progress in aphid-resistant sorghum breeding. CAPS (Cleaved Amplified Polymorphic Sequences) molecular markers are a common and established molecular marker technology. Their principle is based on the generation of polymorphic fragments by altering enzyme cleavage sites through single-base mutations. These markers are widely present in the genome, are simple to operate, and their results are easily observed and identified. They are also universally applicable across diverse materials from the same species. Therefore, developing CAPS molecular markers that can identify sorghum aphid resistance and using them for sorghum aphid-resistant germplasm screening and molecular breeding is of great significance for analyzing the molecular mechanism of sorghum aphid resistance. It is also of great significance for developing effective aphid prevention and control measures and cultivating broad-spectrum, stable, efficient and long-lasting aphid-resistant varieties. Summary of the Invention
[0003] The purpose of the present invention is to provide a CAPS molecular marker for identifying the aphid resistance trait of sorghum and its application to solve the problems existing in the above-mentioned prior art. By analyzing the DNA sequence through whole genome resequencing, SNP sites related to the aphid resistance trait of sorghum are identified. This site can specifically detect aphid-resistant sorghum, providing a new molecular marker resource for marker-assisted selection of aphid-resistant sorghum.
[0004] To achieve the above object, the present invention provides the following solutions:
[0005] In a first aspect, the present invention provides a CAPS molecular marker for identifying the aphid-resistance trait of sorghum. The nucleotide sequence of the CAPS molecular marker is shown as SEQ ID NO.1.
[0006] In a second aspect, the present invention provides a detection primer pair for identifying the molecular marker, wherein the detection primer pair comprises an upstream primer as shown in SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.4.
[0007] In a third aspect, the present invention also provides the use of the detection primer pair in the preparation and identification of products related to sorghum aphid resistance traits.
[0008] Preferably, the product is obtained by amplifying sorghum genomic DNA using the detection primer pair, then digesting the amplified product with restriction endonuclease MscI, and identifying whether the sorghum is resistant to aphids based on the digested product.
[0009] Preferably, the method for identifying whether sorghum is aphid-resistant based on the enzyme digestion product is:
[0010] If the enzyme digestion product has or contains a 499 bp fragment, the sorghum is judged to exhibit aphid resistance;
[0011] If the enzyme digestion product does not have a 499 bp fragment, the sorghum is judged to be susceptible to aphids.
[0012] Preferably, the sorghum genomic DNA is taken from any period of the whole growth period of sorghum.
[0013] In a fourth aspect, the present invention further provides a method for identifying the aphid-resistant trait of sorghum, the method comprising the following steps:
[0014] (1) Extracting genomic DNA from the sorghum to be tested;
[0015] (2) using the genomic DNA obtained in step (1) as a template, performing PCR amplification using the above-mentioned detection primer pair to obtain an amplified product;
[0016] (3) The amplified product was digested with restriction endonuclease Msc I, and the aphid resistance of sorghum was determined based on the digested product.
[0017] Preferably, the method for identifying whether sorghum is aphid-resistant based on the enzyme digestion product in step (3) is:
[0018] If the enzyme digestion product has or contains a 499 bp fragment, the sorghum is judged to exhibit aphid resistance;
[0019] If the enzyme digestion product does not have a 499 bp fragment, the sorghum is judged to be susceptible to aphids.
[0020] Preferably, the PCR amplification reaction system is 2 μL each of 10 μM upstream and downstream primers, 1 μL of 100 ng / μL DNA template, 25 μL of 5 U / μL 2×Taq MasterMIX, and 20 μL of sterile deionized water; the reaction procedure is 94°C pre-denaturation for 1.5 min, 94°C denaturation for 20 s, 57°C annealing for 20 s, 72°C extension for 30 s, 34 cycles, and 72°C extension for 5 min.
[0021] Preferably, the enzyme digestion reaction system is 40 μL of PCR product, 1 μL of restriction endonuclease Msc I, 3 μL of buffer, and 6 μL of deionized water; the reaction conditions are: enzyme digestion at 37° C. in a water bath for 5 h, and inactivation at 80° C. for 20 min.
[0022] The method of the present invention can be used for assisted identification of sorghum aphid resistance traits, assisted breeding, and screening of sorghum aphid resistance traits.
[0023] The present invention discloses the following technical effects:
[0024] The present invention is based on an independently developed technology for efficiently identifying sorghum aphid resistance. The highly aphid-resistant sorghum materials L407B and TAM428, and the highly aphid-susceptible sorghum material 7B were screened from over 200 accessions. Whole-genome resequencing data from the aforementioned materials were used to compare 126 kb of sequence information for a known aphid-resistance QTL, which was disclosed in Wang, F., Zhao, S., Han, Y. et al. "Efficient and finemapping of RMES1 conferring resistance to sorghum aphid Melanaphissacchari." Mol Breeding 2013, 31: 777-784.
[0025] The SNP site found in this chromosome segment was developed into a CAPS molecular marker, and a primer pair was designed for amplifying the molecular marker. PCR amplification was performed on genomic DNA of sorghum seedlings using this primer pair. After obtaining the PCR amplification product, it was digested with the restriction endonuclease Msc I. Whether the sorghum was aphid-resistant can be distinguished based on whether the resulting digestion product contained a 499bp fragment, achieving the goal of more quickly and accurately identifying sorghum aphid resistance at the sorghum seedling stage.
[0026] This invention aims to provide a molecular marker, detection method, and application related to sorghum aphid resistance to address the shortcomings of existing technologies. By analyzing DNA sequences through whole-genome resequencing, a single nucleotide polymorphism (SNP) site associated with aphid resistance in sorghum was identified. This SNP site can specifically detect aphid-resistant sorghum, providing a new molecular marker resource for marker-assisted selection of aphid-resistant sorghum. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0028] Figure 1 The figure shows the location of the SNP site on RMES1 in Example 1; XN1, M5, 272, and 7B are aphid-susceptible sorghum materials, and 407B and TAM428 are aphid-resistant sorghum materials;
[0029] Figure 2 This is the gel electrophoresis diagram of the PCR amplification product in Example 3;
[0030] Figure 3 The results of the CAPS molecular marker verification test in Example 3 are shown; wherein, a represents the aphid resistance screening of wild sorghum resources; b represents the screening of sorghum inbred lines and hybrids; c represents the aphid feeding phenotype of representative aphid-resistant / susceptible materials; the marker is a 100 bp DNA ladder; the aphid-susceptible material can be digested by Msc I endonuclease into two bands of 235 bp and 264 bp; the aphid-resistant material cannot be digested by the endonuclease and shows a single 499 bp band. DETAILED DESCRIPTION
[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0032] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0036] The sequence information of SEQ ID NO.1 is as follows:
[0037] GCATGCTGAAATTCCCAAGGCT CAAGGACTTGTATCTGTATCATCTCTTCAGCCTGAGACAGATATGCGAGGCAAAAATATTTGCTCCTAAGCTCGAGACAGTCCGTCTCAGGGGCTGCTGGAGCCTGAAGCGTCTCCCGGCCACCAAACGCCGTCGGCACAATGCTCTCCGTGTCGTCGTGGACTGCGAGAAGGACTGGTGGGATAGTCTGGAGTGGGATGGGTTGGATTTCGGCCACCACCCCTCC CTCTTCGCGCCGAGCCACTCATCATATTACAAGAAGCAGATGCTGAGAGGTGCAGTGCTTCGATGAGTAGCCAACCTTGGGTGCTTACTGCTGATCGCTTGCATCATCCAGGTACATACACATGAGCAACATACTCTCTCTGCTTTGTAATTTTTTTCCCTCATTTATCTTACTTTGTGTTCCAGCACTAATCATTTGTATATATCATCATCAACTATGTAGATTT GATGATGGGATAATCGAGGAGACG ;
[0038] The sequence information of SEQ ID NO.2 is as follows:
[0039] GCATGCTGAAATTCCCAAGGCTCAAGGACTTGTATCTGTATCATCTCTCCAGCCTGAGACAGATATGCGAGGCAAAAATATTTGCTCCCAAGCTCGAGACAGTCCGTCTCAGGGGCTGCTGGGGCCTGAAGCGTCTCCCGGCCACCAAACACCGTCGGCACAATGCTCTCCGTGTCGTCGTGGACTGCGAGAAGGACTGGTGGGACAGTCTGGAGTGGGATGGGTTGGATTTTGGCCACCACCCTCC CTCTTCGCGCCGAGCCACTCATCATATTACAAGAAGCAGATGCTGAGAGGTGCAGTGCTTCGATGAGTAGCCAACCTTGGGTGCTTACTGCTGATCGCTTGCATCATCCAGGTACATACACATGAGCAACATACTCTCTCTGCTTTGTAATTTTTTTCCCTCATTTATCTTACTTTGTGTTCCAGCACTAATCATTTGTATATATCATCATCAACTATGTAGATTT GATGATGGGATAATCGAGGAGACG ;
[0040] Among them, the underlined positions in SEQ ID NO.1 and SEQ ID NO.2 are differential SNP sites, the underlined and bold positions are differential SNP sites selected for subsequent experiments in this application, and the underlined positions in SEQ ID NO.1 and SEQ ID NO.2 are upstream and downstream primer sequences. CAPS molecular markers are a labeling technology based on changes in enzyme cleavage sites caused by single-base mutations. Since the aphid-susceptible material has an Msc I enzyme cleavage site, namely TGGCCA (see 233-238 bp in SEQ ID NO.2), which can be cleaved by the Msc I enzyme, while the aphid-resistant material does not have an Msc I enzyme cleavage site, the underlined and bold positions in SEQ ID NO.1 and SEQ ID NO.2 were selected as differential SNP sites for subsequent research in this application.
[0041] Sources:
[0042] Information on species such as Bayeqi, Qisifeng, Malanhong, Getasui, Jiangchuwo, Gaopinggaoliang, Xiaohonggaoliang, Qianjinchui, Wubanglang, Baigaoliang, TAM428, Tieganqing, Duosui Nianggaoliang, and Bachigan can be obtained from the China Crop Germplasm Information Network (https: / / www.cgris.net / home).
[0043] 407B, XN1, M5, 272, 7B, 361, Ji Niang No. 3, Tx623, Tx430, 362, 363, 364, 408, 777, Ji Niang No. 4, 821, and 808 are all preserved by the Millet Research Institute of Hebei Academy of Agricultural and Forestry Sciences.
[0044] Example 1 Screening of CAPS molecular markers
[0045] Six sorghum varieties, including XN1, M5, 272, 7B, 407B, and TAM428, were selected for molecular marker screening.
[0046] 1. Genomic DNA Extraction
[0047] The method is based on the FastPure Plant DNA Isolation Mini Kit (DC104) from Nanjing Novozymes Biotechnology Co., Ltd. The specific steps are as follows:
[0048] 1) Take 100 mg of sorghum leaves, add liquid nitrogen and grind thoroughly into powder. Transfer the powder to a 1.5 mL centrifuge tube.
[0049] 2) Immediately add 400 μL of Buffer A1 and 4 μL of RNase A (10 mg / mL) to the ground sample powder and vortex to mix thoroughly to aid lysis;
[0050] 3) Incubate in a 65°C water bath for 10 min. Invert the tube 2-3 times to mix the sample.
[0051] 4) Add 130 μL of Buffer A2 to the mixture, mix thoroughly, place on ice for 5 minutes, centrifuge at 14,000 rpm (18,400 × g) for 5-10 minutes, and carefully aspirate the supernatant into a new 1.5 mL centrifuge tube (prepared by yourself), taking care not to aspirate any interface material.
[0052] 5) Calculate the amount of supernatant and add 1.5 times the volume of Buffer A3 (please check whether anhydrous ethanol has been added before use). For example, add 750 μL of Buffer A3 to 500 μL of supernatant and mix immediately by pipetting.
[0053] 6) Transfer the mixture (including the precipitate) from the previous step to FastPure gDNA Columns IV (the adsorption column has been placed in the collection tube), centrifuge at 12,000 rpm (13,400 × g) for 30-60 seconds, and discard the filtrate;
[0054] 7) Add 600 μL of Buffer AW (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (13,400 × g) for 30 seconds, and discard the filtrate;
[0055] 8) Repeat step 7;
[0056] 9) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm (13,400 × g) for 2 min to remove as much of the rinse solution as possible to prevent residual ethanol in the rinse solution from inhibiting downstream reactions.
[0057] 10) Place the adsorption column in a new 1.5 mL centrifuge tube (not provided). Add 50-100 μL of Elution Buffer, preheated to 65-70°C, to the center of the column membrane. Incubate at room temperature for 3-5 minutes. Centrifuge at 12,000 rpm (13,400 × g) for 1 minute. Discard the adsorption column and store the DNA at -20°C.
[0058] 2. Whole-genome resequencing and SNP annotation
[0059] 1) Genomic DNA is sonicated, fragmented, and end-repaired. Adapters are then added to each end of each fragment. Biotinylated RNA library probes are mixed with magnetic beads to facilitate target region selection using the Agilent SureSelect HumanAll Exon V6 Kit. The captured sequences are then sequenced at 150 bp using an Illumina X-Ten system.
[0060] 2) The sequences obtained from the sequencer include raw reads containing adapters or low-quality bases, which will affect subsequent assembly and analysis. Therefore, in order to obtain high-quality clean reads, the reads are further filtered according to the following rules: remove reads containing adapters; remove reads containing more than 10% unknown bases (N); remove low-quality reads containing more than 50% low-quality (Q value ≤ 20) bases;
[0061] 3) Clean reads from each sample were aligned to the public reference genome using Burrows-WheelerAligner (BWA) with the settings "mem 4-k 32-M". Here, -k is the minimum seed length, and -M is an option to mark shorter split alignments as secondary alignments. Alignment files were converted to SAM / BAM files using SAMtools.
[0062] 4) Multi-sample variant calling was performed using the Unified Genotyper of the Genome Analysis Toolkit (GATK). SNPs and indels were filtered using the GATK Variant Filtration function using the following criteria: -Window 4, -filter "QD < 4.0 || FS > 60.0 || MQ < 40.0", and -G_filter "GQ < 20". Variants exhibiting segregation disorders or sequencing errors were removed. To determine the physical location of each variant, the software tool ANNOVAR was used to align and annotate the SNPs or indels, and SNP information within the 126 kb region of the known RMES1 was also obtained.
[0063] 5) Compare the SNP information of the above 6 materials and find the differential SNPs of the aphid-resistant materials. The sequence information is shown in SEQ ID NO.1 and SEQ ID NO.2. Among them, the marker sites that can be cut by Msc I enzyme are as follows: Figure 1 .
[0064] Conclusion analysis:
[0065] Whole genome resequencing technology was used to obtain differential SNP sites (i.e., Msc I restriction enzyme cleavage sites) of aphid-resistant materials screened in accordance with the CAPS molecular marker technology. The difference between the sequence information shown in SEQ ID NO.1 and the sequence information shown in SEQ ID NO.2 is that the base at position 233 is C and T, respectively.
[0066] Thus, the present invention obtains a CAPS molecular marker that is closely linked to the aphid-resistance trait of sorghum. The nucleotide sequence of the CAPS molecular marker is shown in SEQ ID NO.1.
[0067] Example 2 Primer Design
[0068] Based on the CAPS molecular marker closely linked to the aphid resistance trait of sorghum obtained in Example 1, a primer pair for amplifying the molecular marker was designed. The primer pair consisted of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4.
[0069] SEQ ID NO.3: 5'-GCATGCTGAAATTCCCAAGGCT-3';
[0070] SEQ ID NO. 4: 5'-CGTCTCCTCGATTATCCCATCATC-3'.
[0071] Example 3 Validation of CAPS molecular markers for identifying aphid resistance traits in sorghum
[0072] Subsequent experiments were conducted using the 31 sorghum varieties described above as materials.
[0073] 1. Genomic DNA Extraction
[0074] The method is based on the FastPure Plant DNA Isolation Mini Kit (DC104) from Nanjing Novozymes Biotechnology Co., Ltd. The specific steps are as follows:
[0075] 1) Take 100 mg of sorghum leaves, add liquid nitrogen and grind thoroughly into powder. Transfer the powder to a 1.5 mL centrifuge tube.
[0076] 2) Immediately add 400 μL of Buffer A1 and 4 μL of RNase A (10 mg / mL) to the ground sample powder, vortex and mix thoroughly to aid lysis.
[0077] 3) Incubate in a 65°C water bath for 10 minutes. Invert the tube 2-3 times to mix the sample.
[0078] 4) Add 130 μL of Buffer A2 to the mixture, mix thoroughly, place on ice for 5 minutes, centrifuge at 14,000 rpm (18,400 × g) for 5-10 minutes, and carefully aspirate the supernatant into a new 1.5 mL centrifuge tube (self-prepared), taking care not to aspirate the interface material.
[0079] 5) Calculate the amount of supernatant and add 1.5 times the volume of Buffer A3 (please check whether anhydrous ethanol has been added before use). For example, add 750 μL of Buffer A3 to 500 μL of supernatant and mix immediately by pipetting.
[0080] 6) Transfer the mixture obtained in the previous step (including the precipitate) to FastPure gDNA Columns IV (the adsorption column has been placed in the collection tube), centrifuge at 12,000 rpm (13,400 × g) for 30-60 seconds, and discard the filtrate.
[0081] 7) Add 600 μL of Buffer AW (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (13,400 × g) for 30 seconds, and discard the filtrate.
[0082] 8) Repeat step 7.
[0083] 9) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm (13,400 × g) for 2 min. Remove as much rinse solution as possible to prevent residual ethanol in the rinse solution from inhibiting downstream reactions.
[0084] 10) Place the adsorption column in a new 1.5 mL centrifuge tube (not provided). Add 50-100 μL of Elution Buffer, preheated to 65-70°C, to the center of the column membrane. Incubate at room temperature for 3-5 minutes. Centrifuge at 12,000 rpm (13,400 × g) for 1 minute. Discard the adsorption column and store the DNA at -20°C.
[0085] 2. PCR reaction
[0086] The genomic DNA of the sorghum to be tested obtained above was taken, and the concentration of the genomic DNA was adjusted to 100 ng / μL. PCR amplification was performed using the primer pair designed in Example 2.
[0087] Add samples and reagents according to the following PCR system:
[0088] The reaction system for the above PCR amplification was as follows: 2 μL each of upstream and downstream primers (primer concentration was 10 μM), 1 μL DNA template (concentration was 100 ng / μL), 25 μL 2× Taq MasterMIX (5 U / μL), and 20 μL sterile deionized water;
[0089] The reaction program of the above PCR amplification was as follows: pre-denaturation at 94°C for 1.5 min, denaturation at 94°C for 20 s, annealing at 57°C for 20 s, extension at 72°C for 30 s, 34 cycles, extension at 72°C for 5 min, and storage at 4°C.
[0090] The verification method of PCR amplification products is to take 10μL of PCR products, mix them and spot them into 2% agarose gel, and run electrophoresis at 180V / 500mA for 20min. The electrophoresis results of some materials are shown below. Figure 2 The fragment length was 499 bp, indicating that the above PCR reaction successfully amplified the expected product.
[0091] 3. Enzyme Digestion
[0092] The PCR amplification product was digested with enzymes. The digestion reaction system was as follows: 40 μL of PCR product (concentration 0.1-0.5 μg), 1 μL of restriction endonuclease Msc I, 3 μL of buffer, and 6 μL of deionized water. The digestion reaction conditions were as follows: digestion at 37°C in a water bath for 5 h, followed by inactivation at 80°C for 20 min.
[0093] Enzyme digestion product detection: Take 10 μL of the digestion product, mix well, and then spot it on a 2% agarose gel. Electrophoresis is performed at 180V / 500mA for 20 minutes. Since the aphid-susceptible material has an Msc I digestion site, namely TGGCCA (233-238bp of SEQ ID NO. 2), it can be digested by the enzyme, while the aphid-resistant material has CGGCCA at this site, which cannot be digested by the enzyme. Therefore, if the digestion product has or contains a 499bp fragment, the sorghum is judged to be aphid-resistant; if the digestion product does not have a 499bp fragment, the sorghum is judged to be aphid-susceptible.
[0094] Identification results such as Figure 3 As shown in Table 1:
[0095] Table 1 Validation results of CAPS molecular markers for identification of aphid resistance in sorghum
[0096]
[0097]
[0098] On this basis, the present invention also conducted an experimental study on the feeding phenotype of aphids on representative aphid-resistant / susceptible materials: seeds of different materials with a germination rate of more than 90% were spread on glass dishes for germination, and then transplanted into flower pots filled with nutrient soil. When they grew to the 3-leaf stage (growth conditions: 16 hours of light at 28°C / 8 hours of darkness at 26°C, relative humidity of 60%), 10 sorghum aphids were inoculated. The number of aphids was counted on the 7th day after inoculation, and phenotypic photos of different materials were collected at the same time. Sorghum materials with aphid counts below 50 were considered aphid-resistant materials, and those with aphid counts above 50 were considered aphid-susceptible materials. The experimental results show that Figure 3 Middle C. This phenotypic experimental study further verified the accuracy of the technical solution of the present invention.
[0099] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. A CAPS molecular marker for identifying aphid resistance in sorghum, characterized in that: The nucleotide sequence of the CAPS molecular marker is shown in SEQ ID NO.
1.
2. A detection primer pair for identifying the molecular marker according to claim 1, characterized in that: The detection primer pair includes an upstream primer as shown in SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.
4.
3. Use of the detection primer pair according to claim 2 in the preparation and identification of products related to the aphid resistance trait of sorghum.
4. The use according to claim 3, characterized in that The product is obtained by amplifying sorghum genomic DNA using the detection primer pair according to claim 2, then digesting the amplified product with restriction endonuclease Msc I, and identifying whether the sorghum is resistant to aphids based on the digested product.
5. The use according to claim 4, characterized in that The method for identifying whether sorghum is aphid-resistant based on the enzyme-digested product is as follows: If the enzyme digestion product has or contains a 499 bp fragment, the sorghum is judged to exhibit aphid resistance; If the enzyme digestion product does not have a 499 bp fragment, the sorghum is judged to be susceptible to aphids.
6. The use according to claim 4, characterized in that The sorghum genomic DNA is taken from any period of the whole growth period of sorghum.
7. A method for identifying aphid resistance in sorghum, characterized in that: The method comprises the following steps: (1) Extracting genomic DNA from the sorghum to be tested; (2) using the genomic DNA obtained in step (1) as a template, performing PCR amplification using the detection primer pair described in claim 2 to obtain an amplified product; (3) The amplified product was digested with restriction endonuclease Msc I, and the aphid resistance of sorghum was determined based on the digested product.
8. The method according to claim 7, wherein The method for identifying whether sorghum is aphid-resistant based on the enzyme digestion product in step (3) is: If the enzyme digestion product has or contains a 499 bp fragment, the sorghum is judged to exhibit aphid resistance; If the enzyme digestion product does not have a 499 bp fragment, the sorghum is judged to be susceptible to aphids.
9. The method according to claim 7, wherein The PCR amplification reaction system consisted of 2 μL each of 10 μM upstream and downstream primers, 1 μL of 100 ng / μL DNA template, 25 μL of 5 U / μL 2×Taq MasterMIX, and 20 μL of sterile deionized water; the reaction procedure was 94°C pre-denaturation for 1.5 min, 94°C denaturation for 20 s, 57°C annealing for 20 s, 72°C extension for 30 s, 34 cycles, and 72°C extension for 5 min.
10. The method according to claim 7, wherein The enzyme digestion reaction system comprises 40 μL of PCR product, 1 μL of restriction endonuclease Msc I, 3 μL of buffer, and 6 μL of deionized water. The reaction conditions are: enzyme digestion in a 37° C. water bath for 5 h, followed by inactivation at 80° C. for 20 min.
Citation Information
Patent Citations
Clone and application of sorghum aphid-resisting gene RMES1
CN108004249A
CAPS molecular marker for identifying sorghum leaf sheath color, primer and application
CN117144048A