Molecular marker for detecting wheat pre-harvest sprouting resistance gene TaPI4K-2A promoter region variation and application of molecular marker in breeding

By designing the molecular marker PI4K_Pro, using specific primer pairs to PCR amplification and electrophoresis to detect the variants of the promoter region of TaPI4K-2A in wheat, the problem of rapid and high-throughput detection of anti-spike germination genes is solved, and the wheat breeding efficiency and screening effect of anti-spike germination varieties is improved.

CN120536613APending Publication Date: 2025-08-26NORTHWEST A & F UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510291907.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-12
Publication Date
2025-08-26

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and with high throughput to detect the variation of the wheat ear-resistant germination gene TaPI4K-2A, which leads to low wheat breeding efficiency and cannot effectively alleviate the impact of ear germination on yield and quality.

Method used

The molecular marker PI4K_Pro was designed and applied, and the InDel-1359 variant at TaPI4K-2A promoter region-1359 bp was detected by PCR amplification of specific primers and agarose gel electrophoresis to distinguish between anti-spike germination and sensitive genotypes, and mark-assisted selection was performed in combination with the spike germination phenotype.

Benefits of technology

It has achieved rapid and efficient screening of wheat varieties with ear-resistant germination genotypes, improved breeding efficiency, significantly reduced ear-germination rate, and improved wheat yield and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120536613A_ABST
    Figure CN120536613A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular marker for detecting wheat preharvest sprouting resistance gene TaPI4K-2A promoter region variation and application of the molecular marker in breeding, and relates to the technical field of wheat breeding, the molecular marker can correctly distinguish a deletion mutation site InDel-1359 located at a TaPI4K-2A gene promoter region-1359bp, marker-assisted selection is carried out according to a result in combination with a preharvest sprouting phenotype, and the molecular marker can be used for detecting wheat preharvest sprouting resistance gene TaPI4K-2A promoter region variation. The excellent germplasm containing the pre-harvest sprouting resistant site is screened for wheat pre-harvest sprouting resistant breeding, the breeding efficiency is improved, and the wheat pre-harvest sprouting resistant breeding process is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of wheat breeding, and in particular to a molecular marker for detecting variations in a promoter region of a wheat anti-ear sprouting gene TaPI4K-2A and an application thereof in breeding. Background Art

[0002] Wheat is one of my country's three major grain crops, making a significant contribution to national food security. Ensuring high and stable wheat yields is crucial for ensuring this. Pre-harvest sprouting (PHS) can reduce wheat yield and quality, and occurs in major wheat-producing regions worldwide, resulting in losses of approximately US$1 billion annually and posing a serious threat to wheat production. Pre-harvest sprouting harms crops in three key ways: First, after sprouting, stored nutrients in the kernels are continuously hydrolyzed and consumed, leading to a decrease in bulk density and thousand-kernel weight, severely impacting crop yield. Second, pre-harvest sprouting weakens seed germination, resulting in smaller, weaker seedlings and even a significant decrease in emergence rate, causing significant economic losses to farmers and seed producers. Third, pre-harvest sprouting reduces the nutrient content of the seeds, reducing the dough's extensibility, elasticity, and water-retention capacity, and altering the gelatinization, gelation, and retrogradation properties of starch, significantly impacting the quality of rice noodles, pasta, cakes, and bread.

[0003] Effective means of alleviating the damage caused by wheat spike sprouting are to identify anti-spike sprouting genes / sites, develop functional markers that can be used for rapid and high-throughput detection of anti-spike sprouting genes / sites, screen for superior germplasm with excellent anti-spike sprouting genes / sites, cultivate wheat varieties that are resistant to spike sprouting, and promote their cultivation. The anti-spike sprouting gene TaPI4K-2A was reported by Tai et al. in 2024. This gene affects wheat spike sprouting resistance by responding to the plant hormone abscisic acid (ABA) signal. The deletion mutation InDel-1359 at -1359 in the promoter region of this gene causes the loss of ABRE (Abscisic Acid Responsive Elements), which has a significant effect on wheat spike sprouting. Summary of the Invention

[0004] The present invention aims to provide a molecular marker for detecting variations in the promoter region of a wheat anti-ear sprouting gene TaPI4K-2A and its application in breeding.

[0005] The present invention protects a molecular marker PI4K_Pro for detecting key allelic variations in the promoter region of the wheat anti-ear sprouting gene TaPI4K-2A. The molecular marker is used to distinguish the deletion mutation site InDel-1359 located at -1359bp in the promoter region of the TaPI4K-2A gene.

[0006] The upstream primer PI4K_Pro-F of the molecular marker is located at -1430 to -1411 bp in the promoter region of TaPI4K-2A, and the downstream primer PI4K_Pro-R is located at -1172 to -1154 bp in the promoter region of TaPI4K-2A. The physical location information is based on the reference genome Chinese Spring sequence.

[0007] The present invention also protects a primer pair for amplifying the above-mentioned molecular marker, which is a KASP high-throughput SNP marker, including one forward primer and one reverse primer; the primer sequences are as follows:

[0008] PI4K_Pro-F:

[0009] 5'GGTTGGATCCTTGCAGTTCG 3', the nucleotide sequence of which is shown in SEQ ID NO. 1;

[0010] PI4K_Pro-R:

[0011] 5'CATTTTTGAGGGGTGACGG 3', the nucleotide sequence of which is shown in SEQ ID NO.2.

[0012] The present invention also protects a detection kit containing the primer pair for identifying molecular markers related to the wheat anti-ear sprouting trait.

[0013] The present invention also protects the use of the above primer pair or the above detection kit in molecular marker-assisted wheat ear sprout resistance selection breeding, the specific operation of which is:

[0014] The DNA of the wheat sample to be tested was used as a template, and the template was amplified by PCR using the primers shown in SEQ ID NO.1 and SEQ ID NO.2 respectively;

[0015] The amplified PCR products were detected by agarose gel electrophoresis, and the genotype of TaPI4K-2A was determined based on the length of the amplified fragment. The amplified product fragment of the ear sprout-resistant genotype hap1 was 277 bp in length, and the amplified product fragment of the ear sprout-sensitive genotype hap2 was 568 bp in length.

[0016] The molecular marker PI4K_Pro provided by the present invention can correctly distinguish the natural variation site InDel-1359 that has a significant impact on wheat ear sprouting resistance. Based on the results and combined with the ear sprouting phenotype, marker-assisted selection is performed to screen excellent germplasm containing the ear sprouting resistance site for wheat ear sprouting resistance breeding, thereby improving breeding efficiency and accelerating the wheat ear sprouting resistance breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1To identify key allelic variants in the promoter region of the ear sprout resistance gene TaPI4K-2A;

[0018] Figure 2 This is the design result of the molecular marker PI4K_Pro;

[0019] Figure 3 This is the genotyping diagram of the molecular marker PI4K_Pro in 8 wheat varieties;

[0020] Figure 4 The results of molecular marker PI4K_Pro detection in 113 wheat varieties. DETAILED DESCRIPTION

[0021] To facilitate understanding of the present invention, the present invention will be described more fully below with reference to the accompanying drawings and specific embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, the purpose of providing these embodiments is to provide a more thorough and comprehensive understanding of the disclosure of the present invention.

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention pertains. The terms used in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The technical solutions of the present invention will be described more clearly and completely below with reference to specific examples and comparative examples.

[0023] Note: The wheat varieties (lines) used in the examples of the present invention are all parental groups or varieties (lines) constructed from conventional parental varieties and can be obtained from the market or other public channels.

[0024] 1. Extraction of Wheat Genomic DNA

[0025] 1) At the three-leaf stage, young wheat leaves were selected, numbered, and placed in corresponding 2 mL 96-well plates. They were then dried using a freeze dryer and ground into powder using a high-throughput tissue grinder.

[0026] 2) Add 800 μL of CTAB solution and place in a 65°C water bath for 60 minutes, gently shaking 3-5 times to fully cleave the DNA.

[0027] 3) Add 800 μL of chloroform / isoamyl alcohol (volume ratio 24:1) and shake gently for 10 minutes (operate in a fume hood);

[0028] 4) Centrifuge at 12,000 rpm for 10 min in a high-speed refrigerated centrifuge and extract 600 μL of the supernatant. Place the supernatant into a new 96-well plate with the corresponding number. Add an equal volume of isopropanol and 1 / 10 volume of 3M sodium acetate to the supernatant.

[0029] 5) Centrifuge at 12000 rpm for 10 min in a high-speed refrigerated centrifuge, discard the supernatant, and wash twice with ice-cold ethanol (70%);

[0030] 6) After drying until there is no ethanol smell, add 200 μL of double-distilled water, dissolve completely, and store in a -20°C refrigerator.

[0031] 2. Primer Design

[0032] According to the allelic variation at -1359bp in the promoter region of the anti-ear sprouting gene TaPI4K-2A, Figure 1 Length polymorphism markers were designed using Primer Premier 5. The specific results are shown in Figure 2 As shown, the labeled primer includes 1 forward primer and 1 reverse primer, which are shown as SEQ NO.1 and SEQ NO.2 respectively.

[0033] 3. PCR Amplification

[0034] The PCR amplification system was prepared with the following proportions:

[0035] Reagents volume Template DNA 1μL (100ng / μL) 2×MasterMix 10 μL GCenhancer 5μL Upstream primer 1 μL Downstream primer 1 μL <![CDATA[ddH2O]]> 2μL

[0036] The PCR amplification procedure is:

[0037] 1) Pre-denaturation at 94°C for 5 min;

[0038] 2) Denaturation at 94°C for 30 seconds;

[0039] 3) Annealing at 55°C for 30 seconds;

[0040] 4) Extension at 72°C for 30 seconds;

[0041] 5) 38 cycles;

[0042] 6) Extension at 72°C for 5 min;

[0043] 7) Store at 4℃.

[0044] 4. Results Analysis

[0045] The amplified PCR products were genotyped by 1% agarose gel electrophoresis, and the distribution of TaPI4K-2A promoter region mutations in wheat was collected (refer to Figure 3 ), the judgment criteria were that the length of the amplified fragment was 277 bp, which was consistent with the genotype of the control parent resistant to ear sprouting, and it was judged to be the ear sprout-resistant genotype hap1; the length of the amplified fragment was 568 bp, which was consistent with the genotype of the control parent sensitive to ear sprouting, and it was judged to be the ear sprout-sensitive genotype hap2.

[0046] 5. Verification of the effect of the anti-ear sprouting gene TaPI4K-2A / molecular marker PI4K_Pro in wheat anti-ear sprouting breeding The molecular markers provided by the present invention were used to detect 113 wheat varieties, and 77 wheat varieties with anti-ear sprouting genotypes (consistent with the control anti-ear sprouting parent "Xumai" genotype hap1) and 36 wheat varieties with susceptible ear sprouting genotypes (consistent with the control susceptible ear sprouting parent "Kenon 9204" genotype hap2) were obtained. Among them, the wheat varieties containing the anti-ear sprouting genotype had a significantly lower spike germination rate than the wheat varieties containing the susceptible ear sprouting genotype, indicating that the anti-ear sprouting gene TaPI4K-2A has a significant effect on the spike sprouting resistance of wheat (refer to Figure 4 Based on the results and combined with the ear sprout phenotype, marker-assisted selection is performed to screen for excellent germplasm containing ear sprout resistance loci for wheat ear sprout resistance breeding, thereby improving breeding efficiency and accelerating the wheat ear sprout resistance breeding process.

[0047] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A molecular marker for detecting variations in the promoter region of wheat anti-ear sprouting gene TaPI4K-2A, characterized in that: The upstream primer PI4K_Pro-F of the molecular marker is located at -1430 to -1411bp in the TaPI4K-2A promoter region, and the downstream primer PI4K_Pro-R is located at -1172 to -1154bp in the TaPI4K-2A promoter region; the molecular marker is used to distinguish the deletion mutation site InDel-1359 located at -1359bp in the TaPI4K-2A gene promoter region.

2. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The molecular marker is a KASP high-throughput SNP marker, which includes one forward primer and one reverse primer; the primer sequences are as follows: PI4K_Pro-F: 5'GGTTGGATCCTTGCAGTTCG 3', the nucleotide sequence of which is shown in SEQ ID NO. 1; PI4K_Pro-R: 5'CATTTTTGAGGGGTGACGG 3', the nucleotide sequence of which is shown in SEQ ID NO.

2.

3. A detection kit containing the primer pair according to claim 2 for identifying molecular markers related to the wheat ear sprouting resistance trait.

4. Use of the primer pair according to claim 2 or the detection kit according to claim 3 in molecular marker-assisted wheat ear sprout resistance selection breeding.

5. The use according to claim 5, characterized in that The specific operations are: The DNA of the wheat sample to be tested was used as a template, and the template was amplified by PCR using the primers shown in SEQ ID NO.1 and SEQ ID NO.2 respectively; The amplified PCR products were detected by agarose gel electrophoresis, and the genotype of TaPI4K-2A was determined based on the length of the amplified fragment. The amplified product fragment of the ear sprout-resistant genotype hap1 was 277 bp in length, and the amplified product fragment of the ear sprout-sensitive genotype hap2 was 568 bp in length.

Citation Information

Patent Citations

  • Transcription factor TaMYB7A-CS for improving wheat pre-harvest sprouting resistance and drought resistance and application of transcription factor TaMYB7A-CS

    CN117986339A

  • Gene TaCDPK21-7A for regulating dormancy and pre-harvest sprouting resistance of plant seeds as well as InDel marker and application of gene TaCDPK21-7A

    CN118325949A

  • Vehicle control device and method for identifying u-turn objcet thereof

    KR1020250009251A