Non-coding RNAlnc30 target spot and application thereof

Abstract

The invention discloses a long-chain non-coding RNA (lncRNA) lnc30 target spot of plasmodium falciparum in an erythrogenous stage and application of the long-chain non-coding RNA (lncRNA) lnc30 target spot, and relates to the technical field of biological medicines. The lnc30 nucleotide sequence is as shown in SEQ ID NO: 1, has the full length of 705nt, is positioned in a plasmodium falciparum cell nucleus, and is specifically and highly expressed in a schizosome stage. Researches find that lnc30 overexpression can significantly enhance the growth advantage of plasmodium falciparum and the ability of merozoite to invade erythrocytes, and participates in regulation of the erythroid stage development process of plasmodium, but after lnc30 is knocked down, plasmodium death may be caused. The key effect of the lnc30 in plasmodium falciparum development is disclosed for the first time, a new molecular tool is provided for antimalarial drug target screening, malaria diagnosis and pathogenesis research, and remarkable scientific value and application prospects are achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the discovery of long non-coding RNA (lncRNA) lnc30 in erythrocytic Plasmodium falciparum and its application in the development of antimalarial drug targets. Background Art

[0002] Malaria is a serious infectious disease caused by Plasmodium parasites and is one of the three most serious infectious diseases worldwide. The pathogen that causes malaria is Plasmodium. There are five species of Plasmodium that can parasitize humans: Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, Plasmodium ovale, and Plasmodium knowlesi. Among these, Plasmodium falciparum is the most virulent and has the highest mortality rate. The erythrocytic stage of Plasmodium falciparum, during its development within human erythrocytes, is the only pathogenic stage that results in clinical symptoms. The erythrocytic stage of Plasmodium falciparum undergoes multiple morphological changes, including rings, macrotrophozoites, schizonts, and merozoites, and its antigens are expressed in mutually exclusive ways. This suggests that the erythrocytic stage of Plasmodium falciparum possesses sophisticated gene expression regulation mechanisms, however, these mechanisms remain incompletely understood. Long noncoding RNAs (lncRNAs) play an important role in regulating gene expression in organisms, but the functions of lncRNAs in Plasmodium falciparum, particularly those derived from intergenic regions, are poorly understood. Therefore, it is necessary to explore the functions and regulatory mechanisms of key lncRNAs in Plasmodium falciparum in order to provide new targets for the development of antimalarial drugs. Summary of the Invention

[0003] The present invention aims to provide a Plasmodium long non-coding RNA lnc30 target and its application in the preparation of antimalarial drugs and detection kits.

[0004] A long non-coding RNA lnc30 target of Plasmodium, wherein the nucleotide sequence of lnc30 is shown in SEQ ID NO. 1. The lnc30 is located in the nucleus of the Plasmodium cell and is highly expressed in the schizont stage of the erythrocytic Plasmodium falciparum.

[0005] The lnc30 target is used in the preparation of a drug for inhibiting the growth and development of Plasmodium falciparum or in the preparation of a kit for detecting the growth and development of Plasmodium falciparum.

[0006] A reagent for detecting the expression of Plasmodium falciparum lnc30, comprising a primer or an antibody for detecting the lnc30 of claim 1.

[0007] The primers for lnc30 are as follows:

[0008] qPCR30-5′: 5′TTATTGTAAAGATAAAATTTGTCTGTAGTG 3′ (SEQ ID NO. 2);

[0009] qPCR30-3': 5'ATTTATGTAAAAAAATTTATTGATATACATGT 3' (SEQ ID NO. 3).

[0010] An antimalarial pharmaceutical composition comprising an effective dose of the lnc30 inhibitor of claim 1 and a pharmaceutically acceptable carrier. The inhibitor comprises an antisense oligonucleotide targeting lnc30 or a CRISPR-Cas system component.

[0011] Application of the lnc30 target in the study of the gene expression regulation mechanism of Plasmodium falciparum.

[0012] This study, published in the journal Nature Communications, identifies a previously unreported lncRNA (lnc30) in the 3D7 strain of Plasmodium falciparum. Overexpression of lnc30 significantly enhances the growth advantage of Plasmodium falciparum and its ability to invade erythrocytes, and is involved in regulating the development of the erythrocytic stage of the parasite. Knockdown of lnc30 may also lead to parasite death. This study identifies a novel mechanism by which lncRNAs contribute to Plasmodium pathogenicity—one that achieves growth advantage independently of traditional adhesion pathways and instead achieves a growth advantage through fine-tuning the host-parasite interface, resulting in a qualitative shift in invasion efficiency rather than quantitative dependence. This discovery of lnc30's critical role in Plasmodium falciparum development provides a new molecular tool for antimalarial drug target screening, malaria diagnosis, and pathogenesis research, with significant scientific value and potential applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 .Identification and intracellular localization of full-length lnc30.

[0014] in Figure 1 Figure A is a 5'RACE PCR agarose gel image; M is a 5000 bp ladder; 1 is a positive control PCR product; 2 is a no-template control PCR product; 3 is a no-enzyme control PCR product; 4 is a lnc30 5'RACE PCR product; the white arrow indicates that the positive control product is 2.1 kb in length; the black arrow indicates that the lnc30 PCR product is 1 kb in length.

[0015] in Figure 1 Figure B is a 3'RACE PCR agarose gel image: M is a 5000 bp ladder; 1 is a no-template control; 2 is a no-enzyme control; 3 is the 3'RACE PCR product of lnc30; the black arrow indicates that the PCR product of lnc30 is 150 bp in length.

[0016] in Figure 1C in the figure is the length of lnc30 verified by Northern Blot; M is the RNA marker; 1 is the northern blot product of lnc30; the black arrow indicates the length of lnc30.

[0017] in Figure 1 D in the figure is the predicted secondary structure of lnc30.

[0018] in Figure 1 Figure E shows the localization information of lnc30 in Plasmodium falciparum 3D7 detected by FISH: DAPI is a fluorescent dye indicating the cell nucleus; Scramble is a negative control probe; U4 (U4 snRNA) is a positive control probe.

[0019] Figure 2 .Construction diagram of overexpression plasmid: A is the PLN-30 overexpression plasmid map; B is the control plasmid PLN map.

[0020] Figure 3 .Figure 1 shows the results of identification of lnc30 overexpressing insect strains.

[0021] in Figure 3 A in the figure is PCR identification of the BSD resistance gene; M is DL2000 DNA Marker; 1 is the 3D7 strain without plasmid transfection; 2 is the strain transfected with the control plasmid (con); 3 is the strain transfected with the overexpression plasmid (lnc30oe); the arrow indicates the BSD resistance gene, which is 399 bp in length.

[0022] in Figure 3 Figure B shows the qPCR verification of lnc30 transcription levels at different stages: the horizontal axis represents the different time points of the control and overexpression plasmid-transfected insect strains; the vertical axis represents the relative expression level of lnc30.

[0023] Figure 4 .Growth curve results of lnc30 overexpressing and control insect strains.

[0024] in Figure 4 A in the figure is the growth curve of the transfected worm strain. The horizontal axis is the number of days, and the vertical axis is the blood rate.

[0025] in Figure 4 B in the figure is the experiment of the number of merozoites of the transfected strain: the horizontal axis is the group, and the vertical axis is the number of merozoites;

[0026] in Figure 4 C in the figure is the merozoite invasion experiment of the transfected strain: the horizontal axis is the time for counting the parasitic blood rate, and the vertical axis is the parasitic blood rate;

[0027] in Figure 4D in the figure is the relative expression level of the Var gene in the transfected strain; the horizontal axis is the gene number of the 58 var genes; the vertical axis is the relative expression level of the var gene; U6 snRNA was used as the internal reference gene in the qRT-PCR experiment to calculate the relative expression level of each lncRNA at different stages (2-ΔΔCt);

[0028] in Figure 4 Figure E shows the adhesion experiment of the transfected parasite strain: the black arrow indicates HUVEC (human umbilical vein endothelial cells); the red arrow indicates the red blood cells infected with Plasmodium adhered to HUVEC; the parasite blood rate is * represents P < 0.05, represents P < 0.01, and * represents P < 0.001; the parasite blood rate is the ratio of red blood cells infected with Plasmodium falciparum to all red blood cells.

[0029] Figure 5 .Construction of lnc30 low-expression plasmid and identification of BSD-resistance gene in control insect strain.

[0030] in Figure 5 A in the figure is the knockdown plasmid map of low-expression lnc30; Figure 5 B in the figure is the agarose gel electrophoresis result of the BSD drug screening gene of the control insect strain; M is the DL2000 DNA Marker; 1 is the 3D7 insect strain without plasmid transfection; 2 is the insect strain transfected with the control plasmid; the arrow indicates that the BSD resistance gene PCR product is 399 bp in length. DETAILED DESCRIPTION

[0031] Our laboratory previously predicted 55 previously unannotated lncRNAs using a combination of RNA-Seq and bioinformatics analysis. This study validated these predictions using RT-PCR, confirming the existence of 31 of these lncRNAs, including the lnc30 described in this study.

[0032] The erythrocytic development of Plasmodium falciparum can be divided into four stages based on their morphology: the ring stage (rs), the trophozoite stage (ts), the schizont stage (ss), and the merozoite stage (ms). The ring stage (rs) and the schizont stage (ss), respectively, represent the early and late stages of the erythrocytic development. The two stages exhibit significant morphological differences, and the formation of mature schizonts requires repeated nuclear divisions, making them the most active stages. This study used qRT-PCR to analyze the expression profiles of 31 validated novel lncRNAs during the ring and schizont stages. The results showed that, among these 31 novel lncRNAs, lnc30 was significantly more highly expressed in the schizont stage compared to the ring stage.

[0033] The experimental materials and experimental methods involved in the present invention are:

[0034] 1. Some experimental materials

[0035] 1. Culture supplies:

[0036] GIBCO: RPMI1640.

[0037] Beijing Blood Center: Fresh red blood cells from normal people.

[0038] 2. Insect strains:

[0039] MR4: Plasmodium falciparum 3D7 strain, ATCC, USA

[0040] 3. Primers: The primers involved in the present invention were synthesized by Sangon Biotech Co., Ltd.

[0041] The primers for lnc30 are as follows:

[0042] qPCR30-5′: 5′TTATTGTAAAGATAAAATTTGTCTGTAGTG 3′

[0043] qPCR30-3′: 5′ATTTATGTAAAAAAATTTATTGATATACATGT 3′;

[0044] The primers for U6 are as follows:

[0045] U6-5': 5'GGCTCTCTTCGGAGATGCCGTT 3'

[0046] U6-3': 5'AAAAAATTACATCCTTCTCGAACG 3'.

[0047] 4. Plasmid:

[0048] The empty overexpression plasmid was PLN-ENR-GFP plasmid;

[0049] The knockdown empty vector plasmid is Crispr-dCas9 plasmid;

[0050] The empty plasmids for dual luciferase experiments were PTT5 plasmid, pRL-TK plasmid, and pGL3-Promoter plasmid.

[0051] 5. Strains:

[0052] Homemade in this laboratory: Escherichia coli DH5α and GOLDEN.

[0053] 6. Instruments, equipment and chemical reagents, etc. (conventional equipment and reagents, omitted, the same below).

[0054] 7. Analysis software:

[0055] Primer sequence analysis: Primer5.0;

[0056] Statistical analysis: GraphPad Prism5, Excel, SPSS;

[0057] Sequence alignment analysis: DNAMAN, SeqMan;

[0058] Plasmid mapping: SnapGene.

[0059] 2. Some experimental methods

[0060] 1. Normal culture of erythrocytic stage Plasmodium falciparum

[0061] Culture Plasmodium falciparum with red blood cells and complete culture medium at a 5% packed volume ratio in a three-gas incubator. Test parasite blood counts using infected blood smears. Change the culture medium every 24 hours and add red blood cells as appropriate.

[0062] Method of smearing infected blood:

[0063] In a clean bench under sufficient UV light, use a 10μl pipette to draw up a small amount of infected red blood cells near the flame of an alcohol burner. Place the cells onto a glass slide and use another glass slide to spread the cells into a thin film. After fixation with methanol, add Giemsa stain. Let the cells rest at room temperature for approximately 10 minutes, then rinse with running water. Observe using an oil immersion lens after adding cedar oil.

[0064] Calculation method of parasite blood rate:

[0065] Parasitemia rate = number of red blood cells containing malarial parasites in the field of view ÷ number of red blood cells in the square grid under the microscope ÷ 3.14.

[0066] 2. Validation of lncRNA in erythrocytic Plasmodium falciparum

[0067] 2.1 RNA extraction from erythrocytic stage Plasmodium falciparum

[0068] 2.2 Reverse transcription to obtain cDNA template of erythrocytic Plasmodium falciparum

[0069] 2.3LncRNA PCR Verification

[0070] After the PCR reaction, if the gel electrophoresis results match the target band size, the PCR product is sent to a sequencing company for sequencing. After the sequencing results are returned, they are compared using DNAMAN. Verification is successful if the alignment is completely correct.

[0071] 3. Detection of stage-specific expression of lncRNA in erythrocytic Plasmodium falciparum

[0072] 3.1 Obtaining qPCR templates for erythrocytic ring-stage and schizont-stage Plasmodium falciparum

[0073] 1) RNA from the ring stage and schizont stage was extracted according to the method in 2 above. The same amount of RNA was reverse transcribed into cDNA and used as template

[0074] 2) Design qPCR upstream and downstream primers with a target fragment length of 100-200bp

[0075] 3) Perform qPCR reaction

[0076] After the qPCR process was completed, the values ​​were calculated using the 2-ΔΔCt method and graphed using GraphPad Prism 5 software.

[0077] 4.5' RACE (conventional experimental method, omitted, the same below)

[0078] 5.3'RACE(omitted)

[0079] 6. Northern Blotting (omitted)

[0080] 7. Fluorescence in situ hybridization (omitted)

[0081] 8. Plasmid transfection into schizont-stage Plasmodium (omitted)

[0082] 9. Construction of Overexpression Plasmid

[0083] 9.1 Construction of pBSD Plasmid

[0084] The original plasmid pLN-ENR-GFP was digested with HindⅢ restriction endonuclease, the larger fragments were recovered, and then the fragments were self-ligated to obtain the pBSD plasmid.

[0085] 9.2 Construction of pBSD-30 Plasmid

[0086] The U6 promoter gene was obtained by PCR and purified, and then ligated into the 5' cloning site ApaⅠ and the 3' cloning site AvrⅡ of the PLN-ENR-GFP plasmid.

[0087] The full-length gene 30 was synthesized and ligated between the 5' cloning site AvrⅡ and the 3' cloning site AflⅡ of the PLN-ENR-GFP plasmid.

[0088] (The U6 gene promoter is a strong RNA polymerase III promoter specifically designed for efficient transcription of non-coding RNAs. The U6 promoter has high expression capacity. Connecting lncRNA30 to the U6 promoter can ensure that lncRNA30 reaches a high expression level in cells, which is conducive to functional research.)

[0089] 10. Construction of gene knockout plasmid

[0090] Crispr rgentool software was used to design sgRNA targeting lnc30.

[0091] The target sequence of sgRNA-1 is: 5'-ATGCATGTTTCCGCTGCTTG-3'

[0092] The target sequence of sgRNA-2 is: 5'-TTCATAAACAAGTATATGTG-3'.

[0093] After adding 20-25bp of sequence homologous to the ends of the plasmid to be connected, PCR is used to generate a double-stranded sgRNA. The sgRNA PCR product is directly connected to the vector using a seamless ligation method. The ligation product is transformed, a single clone is picked, and the plasmid is extracted and sent to a sequencing company for sequencing. Once the sequencing results are correctly aligned, the entire plasmid can be sequenced and transfection can be performed.

[0094] 11. Plotting the Growth Curve

[0095] After successful large-scale culture, pBSD, a control group (p30), a weak promoter experimental group (pU6+30), and a strong promoter experimental group (pU6+30) were synchronized twice during the ring stage to achieve high synchronization. After calculating the hemophilia, the cells were diluted to 0.5% with fresh red blood cells. Three replicate wells were constructed for each group. For the next five days, only the medium was changed without adding blood. Slides were stained daily, and the hemophilia was calculated. Graphs were generated using GraphPad Prism 5 software.

[0096] 12. Counting the number of merozoites

[0097] After successful large-scale culture, pBSD, a control group (pBSD), a weak promoter experimental group (p30), and a strong promoter experimental group (pU6+30) were synchronized twice at the ring stage to achieve high synchronization. After calculating parasite blood counts, the cells were diluted to 1% with fresh red blood cells at the schizont stage. Three replicate wells were constructed for each group. After 24 hours, parasites were transformed into ring-stage parasites, and slides were smeared for blood count calculation. GraphPad Prism 5 software was used for graphing.

[0098] 13. Adhesion Test

[0099] 1) Cell Slides: When the cells have grown to about 90%, digest them with trypsin. After complete digestion, pipette and evenly inoculate them into a 24-well plate with cell slides placed in advance and culture for 1-2 days (add a drop of culture medium to the well before placing the slides, otherwise the cells will grow all over the plate and it will be impossible to count them).

[0100] 2) When the cells reach 80%-90% growth, inoculate each tube with 500 μl of red blood cells infected with the transfected Plasmodium falciparum strain 3D7. Incubate at 37°C for 1 hour, shaking every 15 minutes. Resuspend the infected red blood cells in complete medium containing 1640 for the growth of Plasmodium falciparum and add them to HUVEC cells that have been pre-washed with 1640.

[0101] 3) Gently wash three times with PBS or use 1640 complete medium to wash away non-adherent red blood cells.

[0102] 4) Fix the slides with 1% glutaraldehyde for 1 hour at room temperature.

[0103] 5) After fixation, rinse thoroughly and stain with Giemsa for approximately 1 hour at room temperature. Observe adhesion under a microscope.

[0104] 6) Count the number of infected erythrocytes adhered to 300-500 HUVECs (human umbilical vein endothelial cells). Design three parallel wells and calculate the average number of infected erythrocytes adhered to each HUVEC (human umbilical vein endothelial cell). Take photos and prepare graphs.

[0105] 14. Gametophyte Experiment

[0106] Gametocyte culture method:

[0107] 1) Maintain a hematocrit of 4% with a parasite blood rate of less than 6%

[0108] 2) When the blood rate of the ring stage reaches 3%-5%, synchronization is carried out. This is recorded as day 0

[0109] 3) On the second day (recorded as day 1), only change the medium without adding blood. When changing the medium, be sure to preheat it to 37℃ in advance.

[0110] 4) When the ring stage is reached (usually the second day), dilute the blood rate to 0.1%

[0111] 5) Change the fluid every day but do not add blood

[0112] 6) Sexual parasites can be observed around day 9, which are in stages III-IV, and stage V parasites can be observed around day 10-12

[0113] Example 1: Identification and sequence analysis of lnc30 ( Figure 1 )

[0114] We used RACE (rapid-amplification of cDNA ends) to identify the full-length sequences of late highly expressed lncRNAs. Only the 5′ and 3′ RACE sequences of lnc30 were successfully obtained, while the others were unsuccessful. The 5′ sequence of lnc30 was extended by 267 bp (see Figure 1 A in the figure), the 3′ sequence was extended by 30 bp (see Figure 1 Finally, by sequencing the complete clone, we determined that the full length of lnc30 was 705 nt. We further used the Northern Blot method to detect and verify lnc30, and the results showed that a clear and highly specific band appeared at 705 nt. Figure 1 C in the figure, which is consistent with the RACE results. The secondary structure of lnc30 was then analyzed, and the results showed that the secondary structure of lnc30 is complex, with multiple stem-loop structures (see Figure 1 D in the figure) indicates that it can form a relatively stable structure, thus laying the foundation for its function. In order to clarify the localization of lnc30 in Plasmodium falciparum cells, we used FISH (fluorescence in situ hybridization) technology to detect it. The results showed that the signal of lnc30 completely overlapped with DAPI, indicating that lnc30 is located in the cell nucleus (see Figure 1 E).

[0115] RACE assay: SMARTer RACE kits were used for rapid cloning of the 5' and 3' ends. Sequencing confirmed the full length of lnc30 to be 705 nt, with a 267 bp extension at the 5' end and a 30 bp extension at the 3' end. Sequencing confirmed the sequence of lnc30 as shown in SEQ ID NO: 1.

[0116] Northern Blot verification: prepare 6% polyacrylamide-urea denaturing gel, separate RNA by electrophoresis and transfer to membrane, hybridize with digoxigenin-labeled specific probe (5′-CGTTATAATAAGTACGTACATAACTATCTAAATATACTTACAACACTGGA-3′), and chemiluminescence detection shows a specific band at 705 nt.

[0117] The SEQ ID NO: 1 sequence is:

[0118] Example 2: Construction, identification and phenotypic study of lnc30 overexpressing insect strains

[0119] 1. Construction of lnc30 overexpression plasmid

[0120] 1.1 Construction of pBSD plasmid

[0121] The original plasmid pLN-ENR-GFP was digested with HindⅢ restriction endonuclease, the larger fragments were recovered, and then the fragments were self-ligated to obtain the pBSD plasmid.

[0122] 1) Enzyme digestion:

[0123]

[0124] The above system was added into a sterile Epp tube and reacted at 37°C for 2 h.

[0125] 2) Prepare a 1% small-well agarose gel and add the enzyme digestion system and 10× Loading Buffer at a ratio of 10:1 to the agarose gel wells, approximately 10 μl per well.

[0126] 3) Excise and weigh the target fragment, then add three times the volume of Buffer PG. If the gel weighs 100 mg, the volume can be considered 100 μl. Add 300 μl of Buffer PG.

[0127] 4) Mix the 50℃ sol by constantly turning it upside down to fully dissolve the lumps. After it is completely dissolved, cool it to room temperature, add one volume of isopropyl alcohol and mix well.

[0128] 5) Add 200 μl of Buffer PS to the adsorption column already loaded into the collection tube, centrifuge at 13,000 rpm for 2 minutes, and discard the waste liquid.

[0129] 6) Add the solution obtained in step 4 to the adsorption column, place it at room temperature for 2 minutes, centrifuge it at 13,000 rpm for 2 minutes, and discard the waste liquid.

[0130] 7) (Optional) Add 500 μl of Buffer PG to the column, centrifuge at 13,000 rpm for 2 min, and discard the waste liquid.

[0131] 8) Add 750 μl of Buffer PW to the column, centrifuge at 13,000 rpm for 2 min, and discard the waste liquid.

[0132] 9) Spin the tube and centrifuge at 13000 rpm for 2 min, then discard the waste liquid.

[0133] 10) Place the adsorption column in a 1.5ml EPP tube and add 15µl of sterile water heated to 60°C. Allow to stand at room temperature for 2 minutes, then centrifuge at 13,000 rpm for 2 minutes. Collect the DNA solution and store it at -20°C.

[0134] 11) Self-connecting system:

[0135]

[0136] The above system was added to a sterile Epp tube and connected at 22°C overnight.

[0137] 12) Transform the ligation product, pick a single clone, extract the plasmid and send it to a sequencing company for sequencing. Once the sequencing results are correct, the plasmid can be extracted and prepared for transfection.

[0138] 1.2 Construction of pBSD-30 plasmid

[0139] The full-length gene 30 was synthesized and ligated between the 5' cloning site AvrⅡ and the 3' cloning site AflⅡ of the PLN-ENR-GFP plasmid.

[0140] The U6 gene was obtained and purified by PCR and ligated between the 5' cloning site ApaⅠ and the 3' cloning site AvrⅡ of the PLN-ENR-GFP plasmid.

[0141] 1) Enzyme digestion:

[0142]

[0143] The above system was added into a sterile Epp tube, reacted at 37°C for 2 h, and then all of it was added into the large holes of agarose gel and tapped for recovery.

[0144]

[0145] The above system was added to a sterile EPP tube and reacted at 37°C for 2 hours. Then all of it was added to the large wells of agarose gel and the gel was tapped for recovery.

[0146] 2) Connection of 30 full-length genes:

[0147]

[0148] The above system was added to a sterile Epp tube and connected at 22°C overnight.

[0149] The ligation product is transformed, a single clone is picked, and the plasmid is extracted and sent to a sequencing company for sequencing. Once the sequencing results are correctly aligned, the next fragment can be prepared for ligation.

[0150] 3) PCR of U6 gene:

[0151] Using the U6-T Vector plasmid previously used in the laboratory as a template, an ApaⅠ restriction site was added to U6-5' and an AvrⅡ restriction site was added to U6-3'.

[0152] The PCR system is:

[0153]

[0154]

[0155] The PCR program is:

[0156]

[0157] 4) After PCR is completed, the PCR products are recovered by tapping and then enzyme digestion is performed:

[0158]

[0159] The above system was added to a sterile EPP tube and reacted at 37°C for 2 hours. Then all of it was added to the large wells of agarose gel and the gel was tapped for recovery.

[0160] 5) U6 gene connection:

[0161]

[0162] The above system was added to a sterile Epp tube and connected at 22°C overnight.

[0163] The ligation product is transformed, single clones are picked, and the plasmid is extracted and sent to a sequencing company for sequencing. After the sequencing results are correctly aligned, the entire plasmid can be sequenced and prepared for transfection.

[0164] The full-length sequence of lnc30 was cloned into the original plasmid PLN-ENR-GFP, and the CAM promoter of the original plasmid was transformed into the U6 promoter suitable for Plasmodium falciparum, named PLN-30 overexpression (see Figure 2 A). PLN plasmid was used as a control plasmid (see Figure 2 B). The transformed recombinant plasmids were verified to be completely correct by sequencing.

[0165] 2. Transfection and Construction of Lnc30 Overexpression Strains

[0166] The constructed plasmid was transformed into the ring-stage Plasmodium falciparum 3D7 strain using electroporation (transfection parameters: 310V / 950uf). Thirty days after transfection, an increase in parasite blood count was observed. The genome was extracted and tested for BSD resistance genes. Results showed that compared to the untransfected 3D7 strain, both the control plasmid-transfected strain (con) and the overexpression plasmid-transfected strain (lnc30oe) showed the presence of the BSD gene (see ). Figure 3 A), indicating that the plasmid transfection was successful.

[0167] qRT-PCR was further used to detect whether lnc30 was overexpressed. The results showed that the expression level of lnc30 in the overexpression strain (lnc30oe) was significantly higher than that in the control group (con) (see Figure 3 B), indicating that the lnc30 overexpression strain was successfully constructed.

[0168] 3. Phenotypic Observation of Lnc30 Overexpression Strains

[0169] The overexpression plasmid transfected strain (lnc30oe) and the control plasmid transfected strain (con) were synchronized continuously and the changes in their parasite blood rate were observed for 8 consecutive days. The results are shown below. Figure 4As shown in Figure A, compared with the control plasmid transfected strain (con), although the initial blood rate was the same, the blood rate of the lnc30oe strain increased significantly after one growth cycle, indicating that the overexpression plasmid transfected strain (lnc30oe) had a significant growth advantage.

[0170] In order to clarify the reasons why the overexpression plasmid transfectant strain (lnc30oe) has a growth advantage, the present invention explored the two aspects of merozoite number and merozoite invasion ability.

[0171] (1) Merozoite number experiment

[0172] We counted the number of merozoites in 40 consecutive schizonts obtained after synchronizing the lnc30 overexpressing strain (lnc30 oe) and the control plasmid transfected strain (con). 60 schizonts were randomly selected from each group. The results showed that there was no difference in the number of merozoites between the experimental group and the control group (p = 0.2845) (see Figure 4 (B in Figure 1). Therefore, the growth advantage of the lnc30-overexpressing strain is not due to the production of more merozoites.

[0173] (2) Merozoite invasion experiment

[0174] Late schizonts were enriched to make the initial parasitic blood rate of schizonts the same. After 12 hours, all of them were ring bodies. The parasitic blood rate of lnc30oe was higher than that of the control group, and the difference was statistically significant (see Figure 4 C in the figure), therefore, the growth advantage is likely due to the increased invasion ability of merozoites. In Plasmodium, enhanced adhesion ability can lead to increased invasion ability. So does the overexpression of lnc30 affect the transcription level of var genes related to adhesion? So we tested 58 var genes in lnc30oe and con strains. qRT-PCR results showed that in the lnc30 overexpression strain, only pf3D7-0900100 in the adhesion-related var gene family increased by 3 times (see Figure 4 D), HUVEC cells were used to further detect the adhesion ability of red blood cells infected with Plasmodium (see Figure 4 However, the results showed that the adhesion ability of erythrocytes infected with the lnc30-overexpressing strain was not enhanced, suggesting that the increased merozoite invasion ability is not caused by enhanced adhesion ability.

[0175] Regarding the aforementioned studies examining merozoite number and merozoite invasion ability, the authors found that lnc30 overexpression promoted parasite growth but did not increase merozoite number or adhesion ability. This finding suggests a novel mechanism by which lncRNAs contribute to malarial parasite pathogenicity—one that transcends traditional adhesion pathways and instead achieves a growth advantage by finely regulating the host-parasite interface. This suggests a qualitative shift in invasion efficiency, rather than a quantitative dependence. For example, lnc30 may enhance the invasion success rate of individual merozoites by regulating post-translational modifications or conformational changes in parasite surface proteins (such as AMA1 and the RON complex) without altering the total number of adhesion molecules. Alternatively, lnc30 may induce the parasite to secrete specific enzymes (such as serine proteases) that pre-degrade cytoskeletal proteins in localized regions of the erythrocyte membrane, pre-softening the membrane and making it more susceptible to invasion. However, the specific mechanism of action of lnc30 in invasion requires further investigation.

[0176] Based on the experiments that have been completed, it is suggested that lnc30 can be used as a potential drug target for the development of antimalarial drugs, and the ability of merozoites to invade red blood cells can be affected by controlling the expression level of lnc30.

[0177] Example 3: Construction and transfection of lnc30 knockdown plasmid

[0178] The original plasmid of low expression plasmid was donated by the Jiang research group of Shanghai Pasteur Institute, Chinese Academy of Sciences. Figure 5 As shown, the sgRNA targeting the lnc30 promoter region was successfully linked into the original vector, and the knockdown plasmid for low-expression lnc30 was successfully constructed (see Figure 5 After sequencing verification, the A) in the figure was transfected into the ring stage Plasmodium falciparum 3D7 strain by electroporation, and the control strain was successfully constructed. However, after repeated experiments, a low-expressing strain was still not obtained. At the same time, the control plasmid was transfected, and a transfected strain was successfully obtained 30 days after transfection. Through the detection of drug screening genes (see Figure 5 B) further demonstrates the successful generation of a control plasmid transfectant. Despite repeated experiments, the present invention failed to construct a low-expressing strain. Comparing the phenotypic observations of the production curves of the lnc30-overexpressing strain suggests that lnc30 expression may play a crucial role in the survival of Plasmodium falciparum, and knocking down lnc30 may lead to the death of Plasmodium falciparum. This further demonstrates that lnc30 is an important target for the prevention and treatment of Plasmodium falciparum.

[0179] Example 4: Screening and preparation of antimalarial drug compositions

[0180] Inhibitor screening: Using high-throughput screening technology, small molecule compound A (e.g., an oligonucleotide targeting the stem-loop structure of lnc30) that can bind to lnc30 and inhibit its function is screened.

[0181] Preparation of pharmaceutical composition: Compound A is mixed with pharmaceutical excipients (such as physiological saline, polyethylene glycol) to prepare an injection solution, wherein the concentration of Compound A is 10 mg / mL. Alternatively, other pharmaceutical dosage forms can be prepared.

[0182] Example 5: Preparation of detection kit

[0183] Primer design: Specific primers were designed based on the lnc30 sequence. The lnc30 primers are as follows:

[0184] qPCR30-5′: 5′TTATTGTAAAGATAAAATTTGTCTGTAGTG 3′;

[0185] qPCR30-3′: 5′ATTTATGTAAAAAAATTTATTGATATACATGT 3′.

[0186] Kit composition: includes the above primers, qPCR reaction mixture (including dNTP, Taq enzyme, buffer), RNA extraction reagents (Trizol reagent, DNase), etc.

[0187] Detection method: Plasmodium falciparum RNA was extracted and reverse transcribed before qPCR. The expression level of lnc30 was calculated using the 2-ΔΔCt method.

[0188] Summary: This study identifies, for the first time, lnc30 in erythrocytic Plasmodium falciparum and finds that it is highly expressed in the schizont stage and localized to the nucleus. Overexpression enhances merozoite invasion, while knockout may lead to parasite lethality. Based on these findings, the application of lnc30 as an antimalarial drug target, along with corresponding detection reagents and pharmaceutical compositions, is provided, providing new approaches and tools for the treatment and research of malaria, with significant theoretical and practical value.

Claims

1. A long non-coding RNA lnc30 target of Plasmodium, characterized in that: The nucleotide sequence of lnc30 is shown in SEQ ID NO.

1.

2. The lnc30 target according to claim 1, characterized in that The lnc30 is located in the nucleus of malarial parasites and is highly expressed in the schizont stage of erythrocytic Plasmodium falciparum.

3. Use of the lnc30 target according to claim 1 or 2 in the preparation of a drug for inhibiting the growth and development of Plasmodium falciparum or in the preparation of a kit for detecting the growth and development of Plasmodium falciparum.

4. Use of the lnc30 target site according to claim 1 in the study of the gene expression regulation mechanism of Plasmodium falciparum.

5. A reagent for detecting the expression of lnc30 in Plasmodium falciparum, characterized in that: Comprising primers or antibodies for detecting the lnc30 according to claim 1.

6. The reagent according to claim 5, characterized in that The primers for lnc30 are as follows: qPCR30-5': 5'TTATTGTAAAGATAAAATTTGTCTGTAGTG 3' (SEQ ID NO. 2); qPCR30-3': 5'ATTTATGTAAAAAAATTTATTGATATACATGT 3' (SEQ ID NO. 3).

7. An antimalarial pharmaceutical composition, characterized in that: Comprising an effective dose of the lnc30 inhibitor according to claim 1 and a pharmaceutically acceptable carrier.

Images