Application of MaHLP1 gene in regulation and control of sporulation quantity of metarhizium anisopliae
By knocking out the MaHLP1 gene of the saccana saccana, a microcirculation high-yield spore engineering strain was constructed, which solved the problems of high production costs and environmental factors, increased spore yield and simplified fermentation process, and improved insecticidal effect.
Patent Information
- Application Number
- CN202510671418.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-23
- Publication Date
- 2025-08-29
AI Technical Summary
The existing production costs of cystos cystos cystos are high and susceptible to environmental factors. The microcirculation spore production method has not been widely used, so it is necessary to increase the spore production and simplify the fermentation process.
By knocking out or inhibiting the expression of the MaHLP1 gene of the cysticus cysticus, an engineered strain with high yield of microcirculation was constructed, and the MaHLP1 gene was replaced by homologous recombination technology, and the glufosinate marker gene was used as screening markers.
It significantly increased the spore production of C. cystella saccana, changed to a microcirculation spore production method, reduced production costs and simplified the fermentation process, and improved the insecticidal effect.
Smart Images

Figure CN120555477A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering technology, and in particular to the application of the MaHLP1 gene in regulating the spore production of Metarhizium anisopliae and improving an engineered strain of Metarhizium anisopliae with microcirculation and high spore production by genetic engineering methods. Background Art
[0002] Spores are not only the primary means for insecticidal fungi to reproduce and adapt to their environment, but also serve as vectors for their infection and spread. Factors influencing spore formation are complex and diverse, primarily including environmental pH, oxygen concentration, light conditions, nutrient availability, temperature and humidity, and secondary metabolites. These factors directly influence spore yield and quality by regulating fungal physiological metabolism and gene expression. Metarhizium anisopliae has two modes of sporulation: normal sporulation and microcirculation sporulation, in which spores are directly formed from spores following a period of hyphal growth. These two sporulation modes in filamentous fungi can directly influence conidia yield and quality. In a microcirculation sporulation culture system for Metarhizium anisopliae, it was found that compared to normal sporulation, microcirculation sporulation resulted in faster sporulation, more uniform spore size, and improved resistance to adverse conditions, suggesting significant potential for application. Furthermore, microcirculation sporulation avoids the need for extensive hyphal production, effectively avoiding concentrated fermentation heat, facilitating large-scale solid-state fermentation and simplifying the process. Entomopathogenic fungi are important insecticidal microorganisms, offering advantages such as environmental friendliness, harmlessness to humans and animals, and sustainable control. However, these advantages, such as high production costs and susceptibility to environmental factors in the field, limit their widespread application. Currently, microspore production is often promoted through adverse conditions such as low oxygen and poor nutrient conditions, but these are not suitable for production applications. Identifying genes associated with microspore production in entomopathogenic fungi and constructing insecticidal fungal strains with high microspore production have practical applications in promoting the widespread use of insecticidal fungi. Summary of the Invention
[0003] In view of this, one of the objectives of the present invention is to provide the use of the MaHLP1 gene for regulating the conidia production of Metarhizium anisopliae. The nucleotide sequence of the MaHLP1 gene is shown in SEQ ID NO.1 or SEQ ID NO.2, or the encoded amino acid sequence is shown in SEQ ID NO.3. SEQ ID NO.1 is the genomic DNA sequence of the MaHLP1 gene, including introns; SEQ ID NO.2 is the CDS sequence of the MaHLP1 gene. The MaHLP1 gene belongs to the hemerythrin-like protein family.
[0004] Furthermore, the regulation of the spore production of Metarhizium anisopliae is to reduce the spore production of Metarhizium anisopliae.
[0005] Furthermore, the reduction of the spore production of Metarhizium anisopliae is achieved by reducing spore production in a microcirculation manner.
[0006] A second object of the present invention is to provide a method for cultivating an engineered strain of Metarhizium anisopliae with increased spore production, comprising the steps of reducing the expression level and / or activity of the mRNA or protein of the MaHLP1 gene in the recipient Metarhizium anisopliae to obtain a transgenic Metarhizium anisopliae; the nucleotide sequence of the MaHLP1 gene is as shown in SEQ ID NO.1 or SEQ ID NO.2, or the encoded amino acid sequence is as shown in SEQ ID NO.3.
[0007] Furthermore, the method of reducing the expression level and / or activity of the mRNA or protein of the MaHLP1 gene in the receptor Metarhizium anisopliae is achieved by knocking out, inhibiting or silencing the expression of the MaHLP1 gene of the receptor.
[0008] Furthermore, the MaHLP1 gene is knocked out to reduce the expression level of the mRNA or protein of the MaHLP1 gene in the recipient Metarhizium anisopliae, and the knockout method comprises the following steps:
[0009] 1) Construction of PK2-PB-MaHLP1 recombinant plasmid
[0010] PCR primers were designed based on the genome sequence of Metarhizium anisopliae to amplify the upstream and downstream recombination arms of the MaHLP1 gene, and the amplified products were purified. The upstream homologous recombination arm is the left arm, and the gene sequence is shown in SEQ ID NO.5; the downstream homologous recombination arm is the right arm, and the gene sequence is shown in SEQ ID NO.6. The vector plasmid PK2-PB was digested with enzymes and the linearized plasmid was purified. The upstream and downstream recombination arm fragments and the linearized plasmid were cloned in a single step with the recombinase. The recombinant product was inoculated into the competent Escherichia coli DH5α to obtain the PK2-PB-MaHLP1-L / R recombinant plasmid.
[0011] The PK2-PB plasmid vector is constructed from the pAN52-1 vector. The pTrpC promoter and the glufosinate-ammonium marker Bar gene sequence controlled by it are fused by PCR amplification using the Aspergillus nidulans genomic DNA as a template. The pAN52-1 and the amplified fragment are double-digested with BamHI and EcoRV, respectively, and ligated using T4 ligase to obtain the PK2-PB vector.
[0012] 2) Transformation of Agrobacterium and Co-cultivation with Metarhizium anisopliae
[0013] The plasmid of PK2-PB-MaHLP1-L / R was transformed into Agrobacterium and then co-cultured with wild Metarhizium anisopliae spores to cause homologous recombination;
[0014] 3) Screening of Metarhizium anisopliae transformants
[0015] The transformants were preliminarily verified by PCR and RT-qPCR, and the MaHLP1 gene knockout mutant of Metarhizium anisopliae was obtained, which is an engineered strain of Metarhizium anisopliae with increased spore production.
[0016] Furthermore, the spore production is increased by increasing microcirculation.
[0017] The third object of the present invention is to provide an engineered bacterium of Metarhizium anisopliae with microcirculation and high spore production, wherein the expression level and / or activity of the mRNA or protein of the MaHLP1 gene in the engineered bacterium is reduced.
[0018] Furthermore, the method for reducing the expression level and / or activity of the mRNA or protein of the MaHLP1 gene in the engineered bacteria is achieved by knocking out, inhibiting or silencing the expression of the MaHLP1 gene.
[0019] Furthermore, the knockout is achieved by homologous recombination, that is, the marker gene replaces the MaHLP1 gene in the recipient Metarhizium anisopliae through homologous recombination of the recombinant gene composed of the upstream homologous arm of the MaHLP1 gene, the marker gene and the downstream homologous arm of the MaHLP1 gene. The marker gene can preferably be the glufosinate-ammonium marker Bar gene (glufosinate-ammonium resistance gene), and the Bar gene sequence is shown in SEQ ID NO.4.
[0020] The fourth object of the present invention is to provide an insecticide with good insecticidal effect and low cost, the active ingredient of which is the above-mentioned microcirculation and high-spore-producing engineered fungus Metarhizium anisopliae.
[0021] The engineered strain of Metarhizium anisopliae, which produces high microcirculation and spore production, was obtained by knocking out the MaHLP1 gene in the wild-type strain CQMa421. The strain is deposited with the China General Microbiological Culture Collection under the accession number CGMCC No. 4609. A patent application has been filed, with the patent application number CN201110105462.6 and the patent publication number CN102212483B.
[0022] The present invention provides the application of the MaHLP1 gene in regulating the spore production of Metarhizium anisopliae and provides an engineered strain of Metarhizium anisopliae with high microcirculation spore production. The MaHLP1 gene affects the spore production of Metarhizium anisopliae, reducing the spore production; thus, an engineered strain of Metarhizium anisopliae is obtained by reducing the expression level or / and activity of the mRNA or protein of the MaHLP1 gene in Metarhizium anisopliae. The spore production of the strain is significantly increased compared to the wild type, and it is found that the spore production mode of the engineered strain of Metarhizium anisopliae is transformed from normal spore production to microcirculation spore production, thereby increasing the spore production. The present invention reduces the expression or activity of the MaHLP1 gene to achieve a significant increase in its spore production through microcirculation spore production, providing a new engineered strain of Metarhizium anisopliae for reducing production costs and simplifying fermentation processes, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 Schematic diagram of the construction of the MaHLP1 knockout vector and the restoration vector of the present invention;
[0024] Figure 2 The relative expression results of the MaHLP1 gene knockout strain and the restored strain of the present invention;
[0025] Figure 3 The spore production method and spore production statistics of the 1 / 4SDAY culture medium of the present invention are as follows;
[0026] Figure 4 The figures are for the spore production statistics of locusts and Anopheles sinensis of the present invention. DETAILED DESCRIPTION
[0027] The present invention will be described in detail below with reference to the examples, which are only for illustrative purposes and are not limited to the scope of application of the present invention. The present invention is not limited to the following embodiments or examples, and any modifications and variations that do not violate the spirit of the present invention should be included within the scope of the present invention. The experimental materials used in the following examples are commercially available unless otherwise specified. The Metarhizium anisopliae used in the experiments in the following examples is the CQMa421 strain, which was provided by the Insecticidal Fungus and Biopesticide Engineering Technology Research Center of Chongqing University. This strain has been deposited in the China General Microbiological Culture Collection Center with a deposit number of CGMCC No. 4609, and is also recorded in the patent authorization announcement CN102212483B.
[0028] Example 1: Construction of PK2-PB-MaHLP1 recombinant plasmid
[0029] 1. Primer design
[0030] PCR primers were designed based on the genome sequence of Metarhizium anisopliae (WT genome) to amplify the upstream and downstream homology arm fragments of the MaHLP1 gene. The amplification template was the genomic DNA of the CQMa421 strain. MaHLP1_LF / LR was the upstream homology arm amplification primer, and MaHLP1_RF / RR was the downstream homology arm amplification primer. The amplification primer sequences for the upstream and downstream homology arms were as follows:
[0031]
[0032] The genomic DNA sequence of the MaHLP1 gene is shown in SEQ ID NO.1, the CDS sequence is shown in SEQ ID NO.2, and the encoded amino acid sequence is shown in SEQ ID NO.3.
[0033] 2. PCR amplification of upstream and downstream homology arm fragments of MaHLP1 gene
[0034] PCR amplified the left and right arms of MaHLP1. The upstream homology arm was the left arm, and its gene sequence is shown in SEQ ID NO. 5. The downstream homology arm was the right arm, and its gene sequence is shown in SEQ ID NO. 6. Verify the target fragments using a 1% agarose gel. Purify and recover the target fragments using a purification kit for subsequent experiments.
[0035] The PCR amplification system (25 μL) is:
[0036]
[0037]
[0038] The TouchDown PCR amplification procedure is:
[0039]
[0040] 3. Enzyme digestion of vector plasmid PK2-PB
[0041] The PK2-PB vector was constructed from the pAN52-1 vector (purchased from Guangzhou Tofly Biotechnology Co., Ltd.). The pTrpC promoter and the glufosinate-tagged Bar gene sequence under its control were amplified by fusion PCR using Aspergillus nidulans genomic DNA as a template. pAN52-1 and the amplified fragment were double-digested with BamHI and EcoRV (TaKaRa, Japan), respectively, and ligated using T4 ligase (TaKaRa, Japan) to generate the PK2-PB vector. The Bar gene sequence is shown in Seq. No. 4.
[0042] Culture and storage of PK2-PB vector:
[0043] 1) Remove the original PK2-PB plasmid vector stored at -80°C, thaw it, streak it onto LK solid medium (LB solid medium supplemented with kanamycin at a working concentration of 50 μg / mL), and culture it at 37°C overnight.
[0044] 2) Pick a single colony and place it in 20 mL of LB liquid medium (LB liquid medium supplemented with kanamycin at a working concentration of 50 μg / mL) and culture in a shaking incubator at 37°C and 220 rpm for 12 h.
[0045] 3) Pipette 500 μL of 50% (v / v) glycerol and 500 μL of bacterial solution into a sterile centrifuge tube, vortex to mix, mark, and snap-freeze in liquid nitrogen before storing at -80°C.
[0046] 4. Ligation of the plasmid to the left homology arm
[0047] The left arm of the knockout vector plasmid PK2-PB was double-digested (XbaI and HindIII).
[0048] The enzyme digestion system (20 μL) is:
[0049]
[0050]
[0051] Reaction conditions for enzyme digestion: digestion was carried out in a 37°C incubator for 30-40 min. After verification of complete digestion of the vector by 1% agarose gel, the plasmid was purified and recovered using a purification kit.
[0052] Use Novo Rec recombinase for ligation, mixing 1 μL of digested plasmid with 3 μL of the left-arm fragment by volume, and incubate at 37°C for 40 minutes. The digested plasmid and ligated fragments must be purified and recovered.
[0053] The ligation system (10 μL) is:
[0054]
[0055] 5. Transformation into competent E. coli
[0056] 1) Take 50 μL of -80°C frozen competent E. coli DH5α (BGT1, Baoguang Biotechnology), add 5 μL of the ligation product, gently rotate the tube to mix evenly, and place in an ice-water bath for 10 minutes.
[0057] 2) Heat shock at 42°C for 40 seconds and immediately place on ice in an ice-water bath for 10 minutes.
[0058] 3) Add 0.5-0.8 mL of LB liquid medium and culture at 37°C in a shaker at 220 rpm for 1 h.
[0059] 4) Centrifuge (room temperature, 5000 rpm, 5 min), collect about 50 μL of supernatant, and resuspend the cells.
[0060] 5) Pipette the bacterial solution onto LK plates (LB solid medium supplemented with kanamycin, working concentration: 50 μg / mL) and incubate at 37°C for 12-16 hours.
[0061] 6. Colony PCR verification of positive plasmids:
[0062] Once a single colony has grown on the plate, pick it with a sterile pipette tip and place it in a PCR tube containing 10 μL of sterile water to create a bacterial suspension. Perform colony PCR verification using the bacterial suspension as a template, using the primers MaHLP1_LF and the universal vector primer Pt_R to verify successful ligation of the transformant. Once the positive transformant is confirmed, culture it in a shake flask and extract the plasmid for the next step. The primer sequences are:
[0063]
[0064] The colony PCR amplification system (25 μL) is:
[0065]
[0066] TouchDown PCR Amplification Procedure:
[0067]
[0068] 7. Right arm vector plasmid ligation and transformation
[0069] Use a plasmid extraction kit to extract the positively verified left arm homology arm plasmid, and use EcoRI and EcoRV to double-digest the PK2-PB recombinant vector plasmid connected to the left arm.
[0070] The enzyme digestion system (20 μL) is:
[0071]
[0072]
[0073] Reaction conditions: Digest the vector in a 37°C incubator for 30-40 minutes. Verify complete digestion with a 1% agarose gel. If complete, purify the plasmid using a purification kit. If not, continue digestion in a 37°C incubator.
[0074] The linear recombinant vector that has been digested and purified and the purified right arm fragment were ligated and transformed according to the method of steps 4 and 5 above. The principle is as shown in the attached Figure 1The ligation product is PK2-PB-MaHLP1-L / R with Bar gene resistance.
[0075] 8. Colony PCR verification of positive transformants
[0076] The verification method and steps refer to the left arm PCR verification method, the verification primers are Bar_F and MaHLP1_RR, and the primer sequences are:
[0077]
[0078] The colony PCR amplification system (25 μL) is:
[0079]
[0080] TouchDown PCR Amplification Procedure:
[0081]
[0082] The plasmids of the successfully verified positive transformants were extracted and used for later use.
[0083] 9. Chemical transformation of Agrobacterium
[0084] Place 5 μL of the PK2-PB-MaHLP1-L / R plasmid into 50 μL of competent Agrobacterium (purchased from Broadtech Biotechnology). Place the culture on ice for 5 minutes, freeze in liquid nitrogen for 5 minutes, and heat in a 37°C metal bath for 5 minutes. Place the culture on ice for 5 minutes, then add 600 μL of liquid LB medium and incubate at 28°C, shaking at 220 rpm for 2 hours. Spread 50 μL of the culture onto LK medium, and verify positive transformants by colony PCR. Verification is the same as for left and right arm colony PCR of E. coli DH5α.
[0085] 10. Extraction of vector plasmid
[0086] The plasmid extraction in the present invention uses the TIANGEN rapid plasmid extraction kit, and the extraction steps are as follows:
[0087] 1) Culture E. coli in LK liquid medium with shaking for approximately 16 hours. Collect 3-4 mL of the culture medium in a 1.5 mL or 2.0 mL centrifuge tube. Centrifuge (room temperature, 12,000 rpm, 1 min) and discard the supernatant.
[0088] 2) Add 0.15 mL of solution P1 and resuspend the cells by pipetting.
[0089] 3) Add 0.15 mL of solution P2 and gently invert the tube to lyse the bacteria.
[0090] 4) Add 0.35 mL of solution P3 and mix thoroughly until a yellow flocculent precipitate appears in the tube.
[0091] 5) Centrifuge (room temperature, 12,000 rpm, 10 min), collect the supernatant, and transfer it to the adsorption column (the adsorption column is placed in the collection tube).
[0092] 6) Add 0.35 mL of rinse solution PW (to which anhydrous ethanol has been added) to the adsorption column adsorbed with the target DNA, centrifuge (room temperature, 12,000 rpm, 1 min), and discard the waste liquid.
[0093] 7) Repeat step 6.
[0094] 8) Empty the column (room temperature, 12,000 rpm, 2 minutes) to remove any remaining rinse solution. Open the cap of the adsorption column and air dry at room temperature for approximately 10 minutes to evaporate any remaining ethanol.
[0095] 9) Place the adsorption column containing the target DNA into a new 1.5 mL or 2.0 mL centrifuge tube and elute the plasmid from the adsorption membrane with 30-50 μL of 65°C ddH2O.
[0096] 10) Measure the concentration and store at -20℃ for future use.
[0097] Example 2: Construction of the reversion vector (PK2-MaHLP1-sur::egfp)
[0098] 1. Primer design and PCR amplification of target fragments
[0099] Reverse primers MaHLP1_CP_LF / MaHLP1_CP_LR were designed (with 18 and 19 bp of vector adaptor recognition sequences added 5' to the upstream and downstream primers, respectively) to amplify the entire sequence from 785 bp upstream of the ATG to before the stop codon TAG. The reverse target fragment was amplified using the WT genome as a template. The amplified target fragment was analyzed on a 1% agarose gel and recovered using a purification kit. The sequence of the MaHLP1 gene promoter and coding region ORF is shown in SEQ ID NO. 7.
[0100] The primers for amplifying the promoter and open reading frame of the MaHLP1 gene of Metarhizium anisopliae are as follows:
[0101]
[0102] The PCR amplification system (25 μL) is:
[0103]
[0104] The PCR amplification procedure is:
[0105]
[0106] 2. Enzyme digestion of PK2-sur::egfp vector and target fragment ligation transformation
[0107] The PK2-sur::egfp vector was constructed from the PK2-PB vector. The expression vector of the sulfonylurea resistance marker sur gene was PCR amplified using genomic DNA from the rice blast fungus. The PK2-PB and amplified fragment were double-digested with EcoRI and EcoRV (TaKaRa, Japan), respectively, and ligated using T4 ligase (TaKaRa, Japan) to create the PK2-PB-sur vector. The egfp fragment was amplified using the commercial vector pDC316-mCMV-EGFP (purchased from Shanghai Zeye Biotechnology Co., Ltd.) as a template. The PK2-PB-sur and amplified egfp fragment were double-digested with BamHI and EcoRV (TaKaRa, Japan), respectively, and ligated using T4 ligase (TaKaRa, Japan) to create the PK2-sur::egfp vector. The PK2-sur::egfp vector was digested with BamHI and HindIII, and the target fragment was ligated into the PK2-sur::egfp vector. The digestion and ligation procedures are as follows:
[0108] The enzyme digestion system (20 μL) is:
[0109]
[0110] Reaction conditions: Digest in a 37°C incubator for 30-40 minutes. Verify complete digestion on a 1% agarose gel. If complete, purify the plasmid using a purification kit. Ligate the recovered fragment and digested vector using NovoRec recombinase (Novoprotein, USA). The resulting product is PK2-MaHLP1-sur::egfp.
[0111] The ligation system (10.0 μL) is:
[0112]
[0113] The samples were mixed and treated at 37°C for 40 min. The ligation products were transformed into Escherichia coli DH5α. The PK2-MaHLP1-sur::egfp positive transformants were obtained by colony PCR and enzyme digestion verification. The plasmid was extracted for later use. The construction method is as shown in the attached Figure 1As shown. Use primers MaHLP1_CP_LF and EGFP_VR to verify successful ligation of transformants. The PCR amplification system and procedure are as described in the previous step. After verifying the correct band size on a 1% agarose gel, the correct revertant positive transformant has been obtained.
[0114] The primers for sequence verification are:
[0115]
[0116] Example 3: Transformation of Agrobacterium and Co-cultivation with Metarhizium anisopliae
[0117] 1. Chemical transformation of Agrobacterium
[0118] 5 μL of PK2-PB-MaHLP1-L / R plasmid was placed in 50 μL of Agrobacterium competent medium (purchased from Broadtech Biotechnology Co., Ltd.), ice bathed for 5 minutes, frozen in liquid nitrogen for 5 minutes, treated in a 37°C metal bath for 5 minutes, then placed on ice for 5 minutes, added with 600 μL of LLB liquid culture medium, and cultured in a shaker at 28°C and 200 rpm for 2 hours. 50 μL was spread on LK medium, and positive transformants were verified by colony PCR.
[0119] The PK2-MaHLP1-sur::egfp vector plasmid was also transformed into Agrobacterium using the same method, and positive transformants were verified by PCR.
[0120] 2. Co-culture of Agrobacterium and Metarhizium anisopliae CQMa421
[0121] 1) Inoculate the successfully verified Agrobacterium-positive colonies into 20 mL of LK liquid medium (LB liquid medium supplemented with kanamycin, working concentration is 50 μg / mL) and culture in a constant temperature shaking incubator (28°C, 200 rpm) for 18-20 hours until the absorbance value OD 660 It is 0.6-1.0.
[0122] 2) Collect 6 mL of bacterial culture in a sterilized 1.5 mL or 2.0 mL centrifuge tube. Centrifuge (room temperature, 12,000 rpm, 1 min) and discard the supernatant.
[0123] 3) Add 1 mL of NIM liquid medium (containing 200 μM acetosyringone), resuspend the cells, and measure the absorbance A 660 .
[0124] 4) According to the formula A=[(0.15×10) / A 660 ]mL, calculate the A value. The A value is the initial bacterial liquid volume required in 10mL NIM liquid medium (containing 200μM acetosyringone).
[0125] 5) Culture in a constant temperature shaking incubator (28°C, 220 rpm) in the dark for 12-16 hours until the absorbance value OD 660 It is 0.5-0.7.
[0126] 6) Scrape the conidia of Metarhizium anisopliae strain and prepare spore suspension (1×10 6 spores / mL).
[0127] 7) Mix according to the following proportions:
[0128]
[0129] 8) Pipette 0.1 mL of the mixed bacterial solution onto NIM solid medium (containing 200 μM acetosyringone) covered with a sterilized conversion film and incubate inverted in a dark incubator at 28°C for 48 h.
[0130] 9) After culturing in the dark for 48 hours, transfer the conversion membrane to a Czapek medium plate.
[0131] 10) Incubate the culture in an inverted position at 28°C until a single colony grows. The culture time is generally 7-10 days.
[0132] 11) Use a sterile pipette tip to pick a single colony and streak it in a zigzag pattern onto fresh Czapek medium (containing 120 μg / mL glufosinate (PPT) and 200 mg / mL cephalexin). Expand the culture for 3-5 days. Micro-extract the genome and perform preliminary screening of transformants. (For knockout strains, prepare a spore suspension using the WT strain; for revertant strains, prepare a spore suspension using the knockout strain.)
[0133] Example 4: Screening of Metarhizium anisopliae transformants
[0134] 1. PCR electrophoresis verification of Metarhizium anisopliae knockout transformants
[0135] In the knockout strain screened, the MaHLP1 gene was replaced by the selection gene Bar, which enables growth on media containing glufosinate (PPT). Therefore, positive transformants of the knockout strain were initially screened using Czapek medium (containing 120 μg / mL glufosinate (PPT) and 200 mg / mL cephalexin).
[0136] Pick out knockout strain transformants:
[0137] 1) After 7-10 days of culture, a single dark-colored colony will appear on the conversion membrane. Pick the colony with a sterile pipette tip and streak it in a zigzag pattern onto Czapek solid medium (containing 120 μg / mL glufosinate (PPT) and 200 mg / mL cephalexin).
[0138] 2) After incubation at 28°C for 3-4 days, pipette 0.5 mL of 1 / 4SDAY liquid culture medium into a 1.5 mL centrifuge tube. Use a sterile yellow pipette tip to scrape a small amount of bacteria and inoculate it into the centrifuge tube. Label the plate and the centrifuge tube to ensure a consistent match for subsequent verification.
[0139] 3) Culture in a constant temperature shaking incubator (28°C, 220 rpm) for 3 days.
[0140] Mini-extract the genome of the knockout strain transformant:
[0141] 1) Centrifuge (room temperature, 12,000 rpm, 5 min) and discard the supernatant.
[0142] 2) Quickly freeze the cells in liquid nitrogen and immediately grind them into a white powder using a pestle.
[0143] 3) Add 0.4 mL of Lysis Buffer to the centrifuge tube, carefully remove the pestle, and incubate at 37°C for 2-3 hours to lyse the cells. Shake the tube 1-2 times during lysis to ensure thorough lysis.
[0144] 4) Add 0.25 mL of potassium acetate solution to each tube of sample and mix thoroughly by inverting.
[0145] 5) Place the sample in an ice bath for 10-15 minutes and centrifuge (room temperature, 12,000 rpm, 10 minutes);
[0146] 6) Transfer 0.5 mL of the supernatant to a new centrifuge tube, add 0.5 mL of isopropanol, mix thoroughly, and incubate on ice for at least 30 minutes. Mark the tube after transfer to avoid mixing.
[0147] 7) Centrifuge (room temperature, 12,000 rpm, 10 min). After discarding the supernatant, a small amount of white precipitate can be seen at the bottom of the centrifuge tube, which is DNA.
[0148] 8) Add 1 mL of 70%-75% ethanol, centrifuge (room temperature, 12,000 rpm, 5 min), and discard the supernatant.
[0149] 9) Open the centrifuge tube and place it in a 37°C incubator overnight to allow the residual ethanol to evaporate completely.
[0150] 10) Add 20-25 μL of 65°C sterile double-distilled water, dissolve, and store in a -20°C refrigerator. This will serve as a template for preliminary screening of transformants.
[0151] PCR verification of positive strain transformants:
[0152] The left arm verification primers of the knockout strain transformants are: MaHLP1_VF and Pt_R, and the right arm verification primers of the knockout strain transformants are: Bar_F and MaHLP1_VR. The base sequences are as follows:
[0153]
[0154] The amplification system (25.0 μL) is:
[0155]
[0156] PCR amplification procedure:
[0157]
[0158] 1% agarose gel was used to verify the correct size of the PCR amplified bands. A knockout strain ΔMaHLP1 with the MaHLP1 gene knocked out was obtained.
[0159] 2. Verification of Metarhizium anisopliae Revertant Transformants
[0160] Initial screening of MaHLP1 revertant transformants: Among the revertant strains of MaHLP1, screening was performed for resistance to the gene chlorimuron (Sur), which allowed normal growth on media containing chlorimuron (Sur). Therefore, 400 μL of 90 mg / mL Sur and 400 μL of 200 mg / mL ceftriaxone were added to 200 mL of Czapek solid medium, and positive transformants of the revertant strain were initially screened.
[0161] The genome of the revertant transformants was microextracted using the same method as that of the knockout transformants.
[0162] PCR verification of positive strains:
[0163] The transformed cells were verified by PCR using primers MaHLP1_CP_LF and EGFP_VR. The primer sequences are:
[0164]
[0165] The PCR amplification system (25 μL) is:
[0166]
[0167] PCR amplification procedure:
[0168]
[0169] 1% agarose gel was used to verify the correct size of the PCR amplified bands, and the restored strain CP with restored MaHLP1 gene was obtained.
[0170] Example 5: Quantitative PCR Verification
[0171] 1. Sample collection
[0172] The transformant strain and the WT strain were cultured on 1 / 4SDAY medium for 14 days, and the mycelia were scraped into sterile ddH2O, quickly frozen in liquid nitrogen and stored for later use.
[0173] 2. RNA Extraction
[0174] Total RNA was extracted using the Bioviz Ultrapure RNA Kit (DNase I). Detailed steps are described in the manufacturer's instructions.
[0175] 3. Reverse transcription and quantitative PCR
[0176] ① Synthesize cDNA: First, reverse transcribe the total RNA of Metarhizium anisopliae into cDNA using PrimeScript TM RNA was reverse transcribed using the RTMaster Mix kit (TAKARA, Dalian). Specific steps are described in the instructions.
[0177] ②Prepare template and primers: The specific internal reference gene is GAPDH (glyceraldehyde 3phosphate dehydrogenase).
[0178] The reaction system (20.0 μL) is:
[0179]
[0180] The base sequences of the F primer and the R primer are:
[0181] Primers Sequence(5'-3') Seq.No. GAPDH-qF GACTGCCCGCATTGAGAAG 18 GAPDH-qR AGATGGAGGAGTTGGTGTTG 19 MaHLP1_qF CACCGTGAGCTTGAGCAGTA 20 MaHLP1_qR TTGCGCCCAAGAACTTTTCG 21
[0182] ③ Real-time PCR reaction: After preheating the PCR instrument to 95°C, set the parameters such as annealing temperature, extension time, and number of cycles to perform the real-time PCR reaction. During each cycle, the PCR instrument will monitor the fluorescence signal and record the data.
[0183] ④Data analysis: Based on the data collected by the real-time PCR instrument, draw the standard curve and Ct value. -ΔΔCt The Livak method is a relative quantitative method to calculate the mRNA expression level of the target gene in the sample to be tested.
[0184] 2 -ΔΔCt Calculation steps of Livak method:
[0185] 1) Calculate the mean Ct value of each reference gene;
[0186] 2) Calculate the first ΔCt, which is the Ct value of the target gene minus the internal reference gene in each group;
[0187] 3) Calculate the mean ΔCt of the control group, and then subtract the mean ΔCt of the control CK group just calculated from each ΔCt to obtain ΔΔCt;
[0188] 4) Relative expression level = 2 -ΔΔCt .
[0189] The relative expression results of MaHLP1 gene are as follows Figure 2 As shown, it shows that the MaHLP1 gene of the knockout strain ΔMaHLP1 was successfully knocked out, and the MaHLP1 gene of the restoration strain CP was successfully restored. The ΔMaHLP1 strain and the CP strain were used for subsequent experiments.
[0190] Example 6: Observation experiment on conversion of spore production mode
[0191] Prepare the spore suspension of Metarhizium anisopliae with a concentration of 1×10 7 Spores / mL. Preparation of spore suspension: Use a sterile pipette to scrape spores of WT, ΔMaHLP1, and CP strains cultured for 14 days and add them to sterile 0.05% Tween. Vortex and mix thoroughly. Filter through sterile lens paper. Dilute to a certain multiple and count using a hemocytometer. The final concentration of the spore suspension is 1×10 7 spores / mL.
[0192] Spreading observation: 50 μL of spore suspension from each of the WT, ΔMaHLP1, and CP strains was evenly spread onto 1 / 4 of SDAY solid medium. 50 μL of spore suspension from each strain was evenly spread onto SYA solid medium. After spreading, the plates were inverted and incubated in a 28°C incubator. Starting at 2 hours, a piece was cut every 2 hours and observed under an optical microscope, while photographing.
[0193] Sporulation observation experiment Figure 3 As shown in a, after knocking out MaHLP1, the sporulation mode of Metarhizium anisopliae was transformed from normal sporulation to microcirculation sporulation in 1 / 4SDAY solid medium.
[0194] Example 7: Spore production determination experiment
[0195] Prepare the spore suspension of Metarhizium anisopliae with a concentration of 1×10 6Spores / mL, the configuration of the spore suspension is as in Example 6. 2 μL of the spore suspension of each strain was aspirated with a pipette and dropped into a 24-well plate. Each well contained 2 mL of 1 / 4SDAY solid culture medium. Sampling was performed every 3 days starting from the 3rd day (inclusive) until the 15th day, with three replicates for each strain. The taken samples needed to be ground, then vortexed with water, thoroughly mixed, and diluted a certain multiple, and the spores were counted using a hemocytometer to calculate the spore production of each strain. Repeat the experiment 3 times.
[0196] The conidia production of WT, ΔMaHLP1 and CP strains was counted and the conidia production of each strain at different time points was counted under a microscope using a hemocytometer. M. anisopliae grows on 1 / 4SDAY solid medium and matures in about 15 days. Figure 3 The statistical results of spore production shown in b showed that the difference was significant on the 12th day (P<0.05) and extremely significant on the 15th day (P<0.01). When cultured to the 15th day, the spore production of ΔMaHLP1 increased by 48.62% compared with the wild type, indicating that the MaHLP1 gene affects the spore production of Metarhizium anisopliae.
[0197] Example 8: Infection and death spore production measurement experiment
[0198] Prepare the spore suspension of Metarhizium anisopliae with a concentration of 1×10 6 spores / mL, and the spore suspension was prepared as in Example 6.
[0199] For the East Asian migratory locust: Use a pipette to draw up 5 μL of spore suspension of each strain and spot it onto the dorsal plate of a fifth-instar Oriental migratory locust (Locusta). Replace the pipette tip every five instars to ensure correct sampling. A blank control is a 5 μL droplet of paraffin oil. Continue incubating until the locust dies. Select locusts that died at the same time and transfer them to a 28°C incubator for moisturizing. After 4 days of incubation, it was found that the ΔMaHLP1 strain produced significantly more spores on the surface of dead locusts than the WT strain. Cut the entire locust into pieces and place in 50 mL of 0.5% Tween-80. Vortex to evenly disperse the spores. Count the spores using a hemocytometer. Repeat three times.
[0200] For Anopheles sinensis: Spray the spore suspension using a spray tower (POTTER, BURKARD, ENGLAND). Place a plastic bowl-shaped container under the spray tower and spray at a pressure of 0.6 bar at a rate of 4 × 10 5 conidia / cm 2600 μL of the spore suspension was evenly sprayed onto the container surface at a density of 100 μL. A Tween-80 solution was used as a control. Then, 30 adult Anopheles sinensis mosquitoes, stunned at 4°C, were placed into plastic containers sprayed with either the fungal spore suspension or the Tween-80 solution. The containers were sealed with mesh fabric to provide ventilation and prevent the mosquitoes from escaping. Finally, the dead insects were removed and placed in glass culture dishes at 28°C for 6 days. The number of spores on each insect was counted. This experiment was repeated three times.
[0201] The results showed that the MaHLP1 gene affected the spore production of Metarhizium anisopliae on the East Asian migratory locust and Anopheles sinensis. For the East Asian migratory locust, the spore production increased by 33.8% after the MaHLP1 gene was knocked out, and for the Anopheles sinensis, the spore production increased by 48.16% after the MaHLP1 gene was knocked out. Figure 4 ).
[0202] In summary, the MaHLP1 gene affects the spore production of Metarhizium anisopliae. After knocking out the MaHLP1 gene, the spore production of Metarhizium anisopliae increased significantly, and the microcirculation spore production mode increased.
[0203] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art and will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail, but the present invention is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present invention, various simple variations of the technical scheme of the present invention can be made, and these simple variations all fall within the scope of protection of the present invention.
Claims
1. Application of the MaHLP1 gene in regulating the spore production of Metarhizium anisopliae, wherein the nucleotide sequence of the MaHLP1 gene is shown in SEQ ID NO.1 or SEQ ID NO.2, or the encoded amino acid sequence is shown in SEQ ID NO.
3.
2. The use according to claim 1, characterized in that The method of regulating the spore production of Metarhizium anisopliae is to reduce the spore production of Metarhizium anisopliae.
3. The use according to claim 2, characterized in that The method of reducing the spore production of Metarhizium anisopliae is to reduce the spore production in a microcirculation manner.
4. A method for cultivating an engineered strain of Metarhizium anisopliae with increased spore production, characterized in that: The method comprises the steps of reducing the expression level and / or activity of the mRNA or protein of the MaHLP1 gene in the recipient Metarhizium anisopliae to obtain a transgenic Metarhizium anisopliae; the nucleotide sequence of the MaHLP1 gene is as shown in SEQ ID NO.1 or SEQ ID NO.2, or the encoded amino acid sequence is as shown in SEQ ID NO.
3.
5. The method according to claim 4, wherein The method for reducing the expression level and / or activity of the mRNA or protein of the MaHLP1 gene in the receptor Metarhizium anisopliae is achieved by knocking out, inhibiting or silencing the expression of the MaHLP1 gene of the receptor.
6. The method according to claim 4, wherein The spore production is increased by increasing microcirculation.
7. An engineered strain of Metarhizium anisopliae with microcirculation and high spore production, characterized in that: The expression level and / or activity of the mRNA or protein of the MaHLP1 gene in the engineered bacteria is reduced.
8. The engineered strain of Metarhizium anisopliae according to claim 7, characterized in that The method for reducing the expression level and / or activity of the mRNA or protein of the MaHLP1 gene in the engineered bacteria is achieved by knocking out, inhibiting or silencing the expression of the MaHLP1 gene.
9. The engineered strain of Metarhizium anisopliae according to claim 8, characterized in that The knockout is achieved by homologous recombination, which includes replacing the MaHLP1 gene with the marker gene through a recombination gene composed of the upstream homologous arm of the MaHLP1 gene, the marker gene and the downstream homologous arm of the MaHLP1 gene.
10. A fungicide with good insecticide effect and low cost, characterized in that: The active ingredient is the engineered Metarhizium anisopliae bacteria described in any one of claims 7-9.
Citation Information
Patent Citations
Pesticidal Metarhiziumanisopliaevar. anisopliae strain and application thereof
CN102212483A
Pesticidal Metarhiziumanisopliaevar. anisopliae strain and application thereof
CN102212483B