Reagent for detecting peripheral blood miRNA markers of PCNSL and GBM, application and kit
By detecting specific miRNAs in plasma exosomes, the problem of differentiation between PCNSL and GBM is solved, providing a fast and accurate diagnostic method, and achieving early differential diagnosis.
Patent Information
- Application Number
- CN202510732690.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2025-08-29
AI Technical Summary
The prior art is difficult to clarify the distinction between PCNSL and GBM before surgery, especially in the surgery, which leads to limited surgical results.
Using hsa-miR-148a-3p, hsa-miR-142-5p, hsa-miR-139-5p and hsa-miR-4433b-5p as peripheral blood markers, kits and reagents are provided for early diagnosis of PCNSL and GBM by detecting the miRNA expression in plasma exosomes.
Early diagnosis and differentiation of PCNSL and GBM is achieved, and the detection is faster and more accurate. MiRNA is highly expressed in PCNSL patients and low in GBM patients, providing an efficient means of identifying biomarkers.
Smart Images
Figure CN120555600A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular medical diagnosis, and specifically relates to a reagent, application and kit for detecting peripheral blood miRNA markers of PCNSL and GBM. Background Art
[0002] Primary central nervous system lymphoma (PCNSL) is a highly malignant non-Hodgkin lymphoma that originates in the central nervous system. The incidence of PCNSL has been increasing in recent years. Currently, surgical resection alone cannot cure PCNSL; the primary benefit of surgery lies in obtaining pathological results. Therefore, it is crucial to clarify the nature of the tumor both preoperatively and intraoperatively, especially in differentiating it from intracranial glioblastoma multiform (GBM), which can be easily confused with it. Summary of the Invention
[0003] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a reagent, application and kit for detecting peripheral blood miRNA markers of PCNSL and GBM.
[0004] To achieve the above object, the technical solution adopted by the present invention is: A reagent for detecting peripheral blood miRNA markers of PCNSL and GBM, wherein the peripheral blood miRNA markers are one of hsa-miR-148a-3p, hsa-miR-142-5p, hsa-miR-139-5p and hsa-miR-4433b-5p, or a mixture of at least two of them.
[0005] Preferably, the peripheral blood miRNA marker is a combination of hsa-miR-148a-3p and hsa-miR-4433b-5p.
[0006] Preferably, the peripheral blood miRNA marker is a combination of hsa-miR-148a-3p, hsa-miR-139-5p and hsa-miR-4433b-5p.
[0007] Preferably, the peripheral blood miRNA marker is a combination of hsa-miR-148a-3p, hsa-miR-142-5p, hsa-miR-139-5p and hsa-miR-4433b-5p.
[0008] The present invention also includes an application of the reagent for detecting primary central nervous system lymphoma PCNSL and intracranial glioblastoma GBM for non-diagnostic and therapeutic purposes.
[0009] The present invention also includes a kit for detecting peripheral blood miRNA markers of PCNSL and GBM, comprising the reagent.
[0010] Compared with the prior art, the present invention has the following beneficial effects: The peripheral blood miRNA markers provided by this invention for detecting PCNSL and GBM enable faster and more accurate early diagnosis and prognosis of PCNSL and GBM by measuring the expression of circulating miRNAs in body fluids. Four differentially expressed miRNAs, used as biomarkers, are highly expressed in the plasma exosomes of PCNSL patients and low in the plasma exosomes of GBM patients. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 Figure 2 shows the results of exosome identification. A. Transmission electron microscopy results. B. Nanoparticle tracking analysis. The extracted exosomes are vesicles with a diameter of 130-150 nm.
[0012] Figure 2 This is the plasma exosome miRNA sequencing analysis map, including: A. heat map; B. volcano map;
[0013] Figure 3 The figure shows the heat map of cluster analysis of candidate differential miRNAs and the results of RT-qPCR validation experiments of four miRNAs; Figure 4 Diagnostic ROC curves for various combinations of four miRNAs. DETAILED DESCRIPTION
[0014] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is further described in detail below with reference to the accompanying drawings and the best embodiments.
[0015] Example 1: Sample collection and exosome extraction 1. Sample Collection: Blood samples were collected from 28 PCNSL patients and 28 GBM patients at Tianjin Huanhu Hospital. This experiment was approved by the Ethics Committee of Tianjin Huanhu Hospital.
[0016] 2. Plasma separation: Collect 5 mL of EDTA-anticoagulated blood, centrifuge at 1500 g for 10 minutes, and aliquot the supernatant and store at -80°C.
[0017] 3. Exosome extraction: Plasma exosomes were extracted using an exosome isolation and purification kit purchased from Shanghai Yumeibo Biotechnology Co., Ltd. Solution A (400 μL) and Solution B (120 μL) were added sequentially, and exosomes were precipitated after centrifugation and purification.
[0018] Example 2: Exosome identification and RNA extraction 1. Identify the extracted exosomes using transmission electron microscopy and nanoparticle tracking analysis. 10 μL of the exosome suspension was dripped onto a copper grid and negatively stained with phosphotungstic acid. The vesicle morphology was observed under a transmission electron microscope. The isolated exosome sample was appropriately diluted with PBS buffer. The particle size and concentration of the exosomes were measured using the ZetaView system at 25°C. Eleven replicates were performed and the average values were calculated. Figure 1 Figure 2 shows the results of exosome identification; A. Transmission electron microscopy results; B. Nanoparticle tracking analysis; the extracted exosomes are vesicles with a diameter of 130-150 nm.
[0019] 2. RNA extraction: Using the TRIzol method, 800 μL TRIzol was added to 200 μL of exosome suspension. After layering with chloroform, RNA was precipitated with isopropanol, washed with 75% ethanol, and dissolved in DEPC water.
[0020] Example 3: miRNA sequencing and data analysis sRNA sequencing libraries were prepared using the Illumina TruSeq Small RNA Kit. Following library preparation, the constructed libraries were sequenced using an Illumina HiSeq 2000 / 2500 system with a single-end read length of 50 bp. miRNA data were analyzed using ACGT101-miR (version 4.2) as follows: 1). Remove 3' adapter and junk sequences.
[0021] 2). sRNA length screening: retain the length of 18 to 26 nt.
[0022] 3). Comparison and analysis of various RNA databases: The remaining sequences were compared and filtered with the mRNA, RFam, and Repbase databases (excluding miRNA). Figure 2 Figure 2. Schematic diagram of plasma exosome miRNA sequencing analysis, including: A. heat map; B. volcano plot.
[0023] 4) miRNA identification: Obtain reads after length filtering, RFam and other database filtering, compare precursors and genomes, and perform miRNA identification.
[0024] 5) Analysis of miRNA differential expression: normalize the input data (norm value). The significant difference between the two groups was detected by Student's t test, P The difference was statistically significant when the value was <0.05.
[0025] 6) Target gene prediction: TargetScan (version 5.0) and miRanda (version 3.3a) were used to predict target genes of differentially expressed miRNAs. The intersection of these two software programs was used as the final target gene (TargetScan_score ≥ 50 and miRanda_Energy < -10).
[0026] Example 4: RT-qPCR verification: Reverse transcription and real-time quantitative fluorescence PCR reactions were performed using a miRNA first-strand cDNA synthesis kit and a ChamQ Universal SYBR qPCR Master Mix kit, respectively. Both kits were purchased from Nanjing Novozymes Biotech Co., Ltd.
[0027] 1. Reverse transcription (RT) 1) Set the following temperature program on the PCR instrument: 37°C for 60 minutes; 85°C for 5 minutes; 2) Prepare the RT reaction solution according to the following formula, mix the reaction system and centrifuge the reaction tube gently before performing the RT reaction: RNA (100ng-2μg) x μL RNase-free ddH2O 8-x μL miRNA RT Mix 10 μL HiScript miRNA Enzyme Mix 2 μL Total volume 20 μL 2. Primer Design Based on the principles of real-time quantitative fluorescence PCR primer design, primers for hsa-miR-148a-3p, hsa-miR-142-5p, hsa-miR-139-5p and hsa-miR-4433b-5p were designed, among which the sequence numbers of hsa-miR-148a-3p, hsa-miR-142-5p, hsa-miR-139-5p and hsa-miR-4433b-5p are shown below.
[0028] hsa-miR-148a-3p:UCAGUGCACUACAGAACUUUGU (SEQ NO.1) hsa-miR-142-5p: CAUAAAGUAGAAAGCACUACU (SEQ NO.2) hsa-miR-139-5p: UCUACAGUGCACGUGUCUCCAGU (SEQ NO.3) hsa-miR-4433b-5p: AUGUCCCACCCCCACUCCUGU (SEQ NO. 4).
[0029] All primers used in this study were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The upstream primer sequence of hsa-miR-148a-3p was 5'-CGCTCAGTGCACTACAGAACTTTGT-3' (SEQ NO. 5), the upstream primer sequence of hsa-miR-142-5p was 5'-GCGCCCCATAAAGTAGAAAGCACTA-3' (SEQ NO. 6), the upstream primer sequence of hsa-miR-139-5p was 5'-GCTCTACAGTGCACGTGTCTCCAGT-3' (SEQ NO. 7), and the upstream primer sequence of hsa-miR-4433b-5p was 5'-TGTCCCACCCCCACTCCTGTT-3' (SEQ NO. 8). All downstream primers were reverse universal primers.
[0030] U6 is an internal reference gene. The upstream primer sequence of U6 is: 5'-CTCGCTTCGGCAGCACA-3', and the downstream primer sequence is: 5'-AACGCTTCGGCAGCACA-3'. 3. Real-time quantitative fluorescence PCR reaction to detect expression 1) Prepare the PCR reaction system according to the following ratio: 1 μL cDNA template RNase-free ddH2O 7 μL Upstream primer (10 μM) 1 μL Downstream primer (10 μM) 1 μL ChamQ Universal SYBR qPCR Master Mix 10 μL Total volume 20 μL 2) Reaction conditions: 95°C pre-denaturation for 20 seconds, followed by 95°C denaturation for 30 seconds, 60°C annealing for 30 seconds, and 72°C extension for 30 seconds. 40 cycles in total.
[0031] 3). Result analysis: Application of relative quantification 2 -∆∆CT Method for data processing and analysis.
[0032] Figure 3 Figure 2 shows a heat map of candidate differentially expressed miRNAs clustering analysis and the results of RT-qPCR validation experiments for four miRNAs. Real-time quantitative fluorescence PCR results showed that the expression levels of the four miRNAs in plasma exosomes from PCNSL patients were significantly higher than those in GBM patients.
[0033] Example 5: Receiver operating characteristic (ROC) curves and area under the curve (AUC) were used to evaluate the effectiveness of any one or more combinations of the four miRNAs for differential diagnosis between PCNSL and GBM. The results are shown in Table 1. Among the individual miRNAs, hsa-miR-4433b-5p had the highest AUC (AUC = 0.597). Among the two miRNAs, the highest AUC was the combination of hsa-miR-148a-3p and hsa-miR-4433b-5p (AUC = 0.758). Among the three miRNAs, the highest AUC was the combination of hsa-miR-148a-3p, hsa-miR-139-5p, and hsa-miR-4433b-5p (AUC = 0.860). The AUC for the four-miRNA combination was 0.870. These results indicate that the screened exosomal miRNAs are highly effective in differential diagnosis between PCNSL and GBM, with the four-miRNA combination achieving the highest diagnostic efficacy. Figure 4 Diagnostic ROC curves for various combinations of four miRNAs.
[0034] Table 1
[0035] In summary, the peripheral blood miRNA markers for detecting PCNSL and GBM provided by the present invention can achieve early diagnosis and prognosis of PCNSL and GBM by detecting the expression levels of circulating miRNAs in body fluids, which is faster and more accurate. Four differentially expressed miRNAs, used as biomarkers, are highly expressed in the plasma exosomes of PCNSL patients and lowly expressed in the plasma exosomes of GBM patients.
[0036] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A reagent for detecting peripheral blood miRNA markers of PCNSL and GBM, characterized in that: The peripheral blood miRNA marker is one of hsa-miR-148a-3p, hsa-miR-142-5p, hsa-miR-139-5p and hsa-miR-4433b-5p, or a mixture of at least two of them.
2. The reagent for detecting peripheral blood miRNA markers of PCNSL and GBM according to claim 1, characterized in that The peripheral blood miRNA marker is a combination of hsa-miR-148a-3p and hsa-miR-4433b-5p.
3. The reagent for detecting peripheral blood miRNA markers of PCNSL and GBM according to claim 1, characterized in that The peripheral blood miRNA marker is a combination of hsa-miR-148a-3p, hsa-miR-139-5p and hsa-miR-4433b-5p.
4. The reagent for detecting peripheral blood miRNA markers of PCNSL and GBM according to claim 1, characterized in that The peripheral blood miRNA marker is a combination of hsa-miR-148a-3p, hsa-miR-142-5p, hsa-miR-139-5p and hsa-miR-4433b-5p.
5. Use of the reagent according to any one of claims 1 to 4, characterized in that: For the detection of primary central nervous system lymphoma (PCNSL) and intracranial glioblastoma (GBM) for non-diagnostic therapeutic purposes.
6. A kit for detecting peripheral blood miRNA markers of PCNSL and GBM, characterized in that: Comprising the reagent according to any one of claims 1 to 4.